An insertion-deletion molecular marker of rice salt-tolerance gene OsCam1-1 and its application, primer pair and identification method

Abstract

The present invention relates to the field of genetic engineering technology, and in particular to an insertion-deletion molecular marker of a rice salt-tolerant gene OsCam1-1, and its application, primer pair and identification method. The physical position of the insertion-deletion molecular marker is located at the 1205bp to 1215bp of the promoter genome sequence of the rice salt-tolerant gene OsCam1-1, and the base is ACATGATTGA, and the salt-tolerant rice variety lacks the base. By screening molecular markers closely linked to the salt-tolerant gene, rice varieties with strong salt tolerance can be identified. The molecular markers of the present invention can be used for the identification and selection of salt-tolerant genotypes during the germination period of rice seeds, and individuals carrying excellent salt-tolerant alleles can be obtained, which can overcome the shortcomings of conventional breeding methods such as the long time period required, and cultivate new rice varieties with strong salt tolerance.

Description

Technical Field

[0001] The invention relates to the technical field of gene engineering, and in particular to an insertion / deletion molecular marker of a rice salt-tolerance gene OsCam1-1 and an application thereof, a primer pair and an identification method. Background Art

[0002] Through scientific and technological innovation, the salinized soil can be gradually and scientifically and rationally developed and utilized, which can provide large-scale available reserve arable land for my country's grain production and realize the goal of "storing grain in the land". Planting rice is an efficient way to improve and utilize saline soil by "improving and utilizing". However, planting rice on saline soil first requires improving its salt tolerance. Genetic improvement is an effective way to improve rice salt tolerance.

[0003] The traditional method of breeding rice varieties is to select excellent salt-tolerant germplasm as parents for hybrid breeding, and then select new salt-tolerant varieties (lines) through systematic selection methods. However, this method has many problems such as long cycle, large workload, insignificant improvement effect, or the introduction of undesirable agronomic traits due to the influence of linkage disequilibrium between genes while improving the salt tolerance of germplasm. By studying the genetic mechanism of rice salt tolerance, discovering rice salt-tolerant genes, developing linkage or functional markers, and using molecular design breeding and molecular marker-assisted selection breeding, the breeding time of new rice salt-tolerant varieties can be shortened and the breeding efficiency can be improved. At present, the rice salt-tolerant genes widely used in breeding are OsRR22 gene and SKC1 gene, and the above genes have achieved remarkable results in molecular marker-assisted breeding. The role of OsCam-1 gene in regulating rice salt tolerance has been reported, but there are no reports on functional molecular markers located in its promoter region and gene coding region. Summary of the invention

[0004] In order to solve the above problems, the present invention provides an insertion-deletion molecular marker of the rice salt-tolerance gene OsCam1-1 and its application, primer pair and identification method. The present invention separates the genotypes of different rice varieties by designing In-Del (insertion-deletion) markers in the promoter region of the gene according to the differences (including variations and deletions) in the internal nucleotide sequences of the gene among different varieties. The method has stability (different base deletions exist stably in different rice varieties) and marker tracking reliability (the marker is co-separated with the gene inside the gene).

[0005] In order to achieve the above object, the present invention provides the following technical solutions:

[0006] The invention provides an insertion-deletion molecular marker of a rice salt-tolerant gene OsCam1-1. The physical position of the insertion-deletion molecular marker is located at -1205bp to -1215bp of a promoter genome sequence of the rice salt-tolerant gene OsCam1-1. The base is ACATGATTGA, and the salt-tolerant rice variety lacks the base.

[0007] The present invention also provides the application of the insertion-deletion molecular marker described in the above technical solution in identifying the salt tolerance of rice.

[0008] Preferably, the application includes: when the rice lacks the insertion and deletion molecular marker described in the above technical solution, the rice is salt-tolerant rice;

[0009] When the rice contains the insertion / deletion molecular markers described in the above technical solution, the rice is salt-sensitive rice.

[0010] The present invention also provides a primer pair for amplifying the insertion / deletion molecular marker described in the above technical solution, wherein the nucleotide sequence of the upstream primer of the primer pair is as shown in SEQ ID No.1, and the nucleotide sequence of the downstream primer is as shown in SEQ ID No.2.

[0011] The present invention also provides a kit for identifying salt tolerance of rice, wherein the kit contains the primer pair described in the above technical solution.

[0012] The present invention also provides a method for identifying salt tolerance of rice, comprising the following steps:

[0013] 1) extracting rice genomic DNA, and using the genomic DNA as a template to amplify using the primer pair described in the above technical solution to obtain an amplified product;

[0014] 2) When the length of the amplified product is 245 bp, the rice is salt-tolerant rice;

[0015] When the length of the amplified product is 255 bp, the rice is salt-sensitive rice.

[0016] Preferably, when the length of the amplified product is 245 bp, the nucleotide sequence of the amplified product is as shown in SEQ ID No.3.

[0017] Preferably, when the length of the amplified product is 255 bp, the nucleotide sequence of the amplified product is as shown in SEQ ID No.4.

[0018] Preferably, the amplification system is: 50 ng genomic DNA, 0.2 μl of 10 mM dNTP, 1 unit Taq enzyme, 1 μl of 10× reaction buffer and 0.2 μl of each of 10 mM upstream and downstream primers, and ddH2O is added to 10 μl.

[0019] Preferably, the amplification program is: denaturation at 94°C for 2 min; denaturation at 94°C for 45 s, annealing at 55°C for 30 s, extension at 72°C for 0.5 min, for a total of 35 cycles; extension at 72°C for 10 min.

[0020] Beneficial effects of the present invention:

[0021] By screening molecular markers that are closely linked to salt-tolerance genes, rice varieties with strong salt tolerance can be identified.

[0022] The molecular markers of the present invention can be used to identify and select salt-tolerant genotypes during the germination period of rice seeds, obtain individuals carrying excellent salt-tolerant alleles, overcome the shortcomings of conventional breeding methods such as the long time period required, and cultivate new rice varieties with strong salt tolerance. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0024] Figure 1 This is the sequence alignment of the OsCam1-1 promoter in Jileng 1 and Miyang 23. The red box indicates the insertion of 10 bases (ACATGATTGA) at the position of -1205bp to -1215bp in the sequence;

[0025] Figure 2 Seed germination of Jileng 1 and Miyang 23 under 150 mM NaCl and H2O conditions;

[0026] Figure 3 The results of the amplified fragment length of different rice varieties under the marker OsCam1-1-M1 are shown in the figure;

[0027] Figure 4 The differences in salt tolerance among varieties with different functional molecular markers OsCam1-1-M1 genotypes;

[0028] Figure 5 is the relative expression level of OsCam1-1 gene in different varieties. DETAILED DESCRIPTION

[0029] The invention provides an insertion-deletion molecular marker of a rice salt-tolerant gene OsCam1-1. The physical position of the insertion-deletion molecular marker is located at -1205bp to -1215bp of a promoter genome sequence of the rice salt-tolerant gene OsCam1-1. The base is ACATGATTGA, and the salt-tolerant rice variety lacks the base.

[0030] The present invention also provides an application of the insertion-deletion molecular marker described in the above technical solution in identifying rice salt tolerance. In the present invention, the application preferably includes: when the rice lacks the insertion-deletion molecular marker described in the above technical solution, the rice is salt-tolerant rice; when the rice contains the insertion-deletion molecular marker described in the above technical solution, the rice is salt-sensitive rice.

[0031] The present invention also provides a primer pair for amplifying the insertion / deletion molecular marker described in the above technical solution, wherein the nucleotide sequence of the upstream primer of the primer pair is as shown in SEQ ID No.1, and the nucleotide sequence of the downstream primer is as shown in SEQ ID No.2.

[0032] SEQ ID No.1:

[0033] CGCGAGGTCGCTCATGGCGGT;

[0034] SEQ ID No.2:

[0035] AAGCTACCACGTGCATTGCTGC.

[0036] The present invention also provides a kit for identifying salt tolerance of rice, wherein the kit contains the primer pair described in the above technical solution.

[0037] The present invention also provides a method for identifying salt tolerance of rice, comprising the following steps:

[0038] 1) extracting rice genomic DNA, and using the genomic DNA as a template to amplify using the primer pair described in the above technical solution to obtain an amplified product;

[0039] 2) When the length of the amplified product is 245 bp, the rice is salt-tolerant rice;

[0040] When the length of the amplified product is 255 bp, the rice is salt-sensitive rice.

[0041] In the present invention, when the length of the amplified product is 245 bp, the nucleotide sequence of the amplified product is shown in SEQ ID No. 3, which is as follows:

[0042] AAGCTACCACGTGCATTGCTGCCCATTTTACTCGCCGCTTTGGACGCTTCACCGTGCTTCTCTGCAGGCTGCGATGATTGGCTGCAGCGGTGCGATCTGCCTGCATGTATAATCTCGCTTGACCAGATCCCAATCCTCCCTGCTGATGTTGCCGGAGCAAGCGATCCAAATCTCCTCTCCCAGGCTTTTCCCAAAGAAAGGTGAAAGGATGCAAAGCGACCGACCGCCATGAGCGACCTCGCG.

[0043] In the present invention, when the length of the amplified product is 255 bp, the nucleotide sequence of the amplified product is shown in SEQ ID No. 4, which is as follows:

[0044] AAGCTACCACGTGCATTGCTGCCCATTTTACTCGCCGCTTTGGACGCTTTCACCGTGCTTCTCTGCAGGCTGCGATGATTGGACATGATTGACTGCAGCGGTGCGATCTGCCTGCATGTATAATCTCGCCTTGACCAGATCCCAATCCTCCCTGCTGATGTTGCCGGAGCAAGCGATCCAAATCTCCTCTCCCAGGCTTTTCCCAAAGAAAGGTGAAAGGATGCAAAGCGACCGACCGCCATGAGCGACCTCGCG. The bold ones are the insertion and deletion molecular markers described in the above technical solution.

[0045] In the present invention, the amplification system is preferably: 50ng genomic DNA, 0.2μl of 10mM dNTP, 1 unit Taq enzyme, 1μl of 10× reaction buffer and 0.2μl of 10mM upstream and downstream primers, and ddH2O is added to 10μl. In the present invention, the 10× reaction buffer contains Mg 2+ In the present invention, the amplification procedure is preferably: denaturation at 94°C for 2 min; denaturation at 94°C for 45 s, annealing at 55°C for 30 s, extension at 72°C for 0.5 min, for a total of 35 cycles; extension at 72°C for 10 min.

[0046] In order to further illustrate the present invention, the present invention is described in detail below in conjunction with embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0047] Example 1

[0048] Gene sequence analysis of the promoter region of rice salt tolerance gene OsCam1-1 (accession number: Os03g0319300) in different rice varieties and differences in salt tolerance during seed germination

[0049] Rice materials: Jileng 1 and Miryang 23.

[0050] The salt-tolerance gene OsCam1-1 in the above-mentioned different rice varieties was sequenced, and the genomic sequences of the promoters of the salt-tolerance gene OsCam1-1 in each variety were further compared and analyzed ( Figure 1 ). According to the comparison analysis results, it was found that there was a regular continuous insertion of 10 bases in the OsCam1-1 promoter genomic sequence in some sequenced varieties. Further, according to the results of rice salt tolerance phenotype identification, it was found that the Miyang 23 type variety with 10 bases (ACATGATTGA) inserted at the -1205bp--1215bp site of the OsCam1-1 promoter genomic sequence showed salt sensitivity. However, there was no base insertion at this site, and the salt tolerance of varieties such as Jiling No. 1 showed salt tolerance ( Figure 2 ).

[0051] According to the sequencing comparison analysis of the salt-tolerant gene OsCam1-1 in different varieties, and further combined with the salt-tolerant phenotype identification results, it was found that in the -1205bp to -1215bp of the OsCam1-1 promoter genomic sequence, 10 bases (ACATGATTGA) were inserted in the salt-sensitive variety, while no base insertion was found in the salt-tolerant variety. Based on the above results, the present invention develops an In-Del marker OsCam1-1-M1; the OsCam1-1-M1 marker amplifies a band with a fragment length of 245bps (nucleotide sequence as shown in SEQ ID No.3) in the salt-tolerant variety; and a 255bps fragment band is amplified in the salt-sensitive variety (nucleotide sequence as shown in SEQ ID No.4). OsCam1-1-M1 is the functional molecular marker of the rice salt-tolerant gene OsCam1-1. When identifying salt-tolerant molecular markers in rice, this functional molecular marker is used for amplification, and then the marker genotype is identified. If a 245bps band is amplified, it indicates that there is no base insertion in the variety, the OsCam1-1 gene is expressed normally, and it is salt-tolerant. If a 255-bps band is amplified, it indicates that there are 10 base insertions in the OsCam1-1 gene of the variety, the gene expression level is significantly increased under salt stress, and the variety has poor salt tolerance. Therefore, OsCam1-1-M1 can be used to quickly and efficiently distinguish salt-tolerant varieties from salt-sensitive varieties.

[0052] OsCam1-1 promoter sequence in rice salt tolerance gene OsCam1-1, SEQ ID No.5:

[0053]

[0054] Example 2

[0055] Genotyping detection of a new rice salt tolerance gene OsCam1-1 functional molecular marker in salt-tolerant and salt-sensitive rice varieties

[0056] (1) Rice materials: Jileng 1, Jijing 509, Lisuibo, Dakong, Longjing 31, Jijing 515, Dan 137, Jijing 51, Shennong 016, Liaojing 534, Qianchonglang 1, Fujing 8, Songjing 7, Hongke 79, Dongyandao 11, Longjing 10, Guandong 53, Nonglin 11, Songjing 6, Fujing 8, Tongxi 935, Liaojing 10, Bajin.

[0057] (2) Genotyping of rice salt tolerance gene OsCam1-1 using functional molecular markers in different rice varieties

[0058] The functional molecular marker developed for the rice salt tolerance gene OsCam1-1 was used to perform PCR amplification on different rice varieties (the reaction system and reaction procedure are as follows), and then the marker was separated by electrophoresis with a volume fraction of 3% agarose gel (the gel configuration method is as follows), and the band type and genotype of the marker were identified in different rice varieties; then, the practicality of the functional molecular marker was determined by combining the salt tolerance phenotypic identification results of each rice variety.

[0059] PCR reaction system: total volume is 10 μl, which contains 50 ng template DNA, 0.2 μl 10 mM dNTP, 1 unit Taq enzyme, 1 μl 10× reaction buffer and 0.2 μl each of 10 mM upstream and downstream primers, and double distilled water is added to 10 μl;

[0060] The PCR reaction procedure is: denaturation at 94°C for 2 min; denaturation at 94°C for 45 s, annealing at 55°C for 30 s, extension at 72°C for 0.5 min, for a total of 35 cycles; extension at 72°C for 10 min. 2+ .

[0061] The gel electrophoresis process is as follows: the PCR reaction product is electrophoresed on a 3% agarose gel at 100V for 1 hour; after being stained with ethidium bromide (EB), it is observed and recorded under a gel imaging system.

[0062] After the above test results were analyzed, it was found that the rice varieties: Jileng 1, Jijing 509, Lisuibo, Dakong, Longjing 31, Jijing 515, Dan 137, Jijing 51, Shennong 016, Liaojing 534, Qianchonglang 1, Fujing 8, Songjing 7, Hongke 79, Dongyandao 11, Longjing 10, showed consistent genotypes, marker OsCam1-1-M1, and the length of the amplified fragment was a single band of 245bps ( Figure 3 , 1-16). The results of salt tolerance phenotype identification showed that these varieties had strong salt tolerance during seed germination. However, the genotype identification of rice varieties: Guandong 53, Nonglin 11, Songjing 6, Fujing 8, Tongxi 935, Liaojing 10, Bajin showed that the length of the amplified fragment of marker OsCam1-1-M1 in these varieties was 255bps ( Figure 3 , 17-24). The results of salt tolerance phenotype identification showed that these varieties have poor salt tolerance ( Figure 4 ). Therefore, the functional molecular marker OsCam1-1-M1 of the rice salt-tolerance gene OsCam1-1 has clear genotypes in different rice varieties, and different genotypes correspond well to the salt-tolerance phenotype, indicating that the functional molecular marker OsCam1-1-M1 is practical.

[0063] Example 3

[0064] Differential expression of rice salt tolerance gene OsCam1-1 in salt-tolerant and salt-sensitive rice varieties

[0065] Rice materials: Jileng 1, Miyang 23.

[0066] The genomic sequence of the promoter region of a rice salt-tolerant variety during the germination period (Jileng 1) does not contain the sequence (ACATGATTGA), while the genomic sequence of the promoter region of a rice salt-tolerant variety during the germination period (Miyang 23) contains the sequence (ACATGATTGA).

[0067] The transcriptome sequencing technology (RNA-seq) and relative fluorescence quantitative PCR (qRT-PCR) technology were used to detect the transcriptional expression of the salt-tolerant gene OsCam1-1 in the above-mentioned different rice varieties during the seed germination period. The results showed that the gene expression level was significantly increased in the varieties whose promoter sequence of OsCam1-1 contained the sequence (ACATGATTGA), showing salt sensitivity. However, the gene expression level did not increase significantly in the varieties whose promoter sequence of OsCam1-1 did not contain the sequence (ACATGATTGA), showing salt tolerance ( Figure 5 ). In rice varieties containing different functional molecular markers OsCam1-1-M1 genotypes, gene expression was significantly different under salt treatment and normal environment, indicating that the functional molecular marker OsCam1-1-M1 affects the gene expression level.

[0068] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Application of insertion-deletion molecular markers in identifying salt tolerance in rice; The physical position of the insertion and deletion molecular marker is located at -1205bp to -1215bp of the promoter genome sequence of the rice salt-tolerant gene OsCam1-1, and the base is ACATGATTGA, which is missing in salt-tolerant rice varieties; The applications include: When the rice lacks the insertion / deletion molecular marker, the rice is salt-tolerant rice; When the rice contains the insertion / deletion molecular marker, the rice is salt-sensitive rice.

2. A method for identifying salt tolerance of rice, characterized in that: The following steps are involved: 1) extracting rice genomic DNA, and amplifying the genomic DNA as a template using a primer pair to obtain an amplified product; The nucleotide sequence of the upstream primer of the primer pair is as shown in SEQ ID No. 1, and the nucleotide sequence of the downstream primer is as shown in SEQ ID No. 2; 2) When the length of the amplified product is 245 bp, the rice is salt-tolerant rice; When the length of the amplified product is 255 bp, the rice is salt-sensitive rice.

3. The method according to claim 2, characterized in that When the length of the amplified product is 245 bp, the nucleotide sequence of the amplified product is shown as SEQ ID No.

3.

4. The method according to claim 2, characterized in that: When the length of the amplified product is 255 bp, the nucleotide sequence of the amplified product is shown as SEQ ID No.

4.

5. The method according to claim 2, characterized in that: The amplification system is: 50 ng genomic DNA, 0.2 µl of 10 mM dNTP, 1 unit Taq enzyme, 1 µl of 10× reaction buffer and 0.2 µl of 10 mM upstream and downstream primers, and ddH2O is added to 10 µl.

6. The method according to claim 2 or 5, characterized in that: The amplification program is: denaturation at 94°C for 2 min; denaturation at 94°C for 45 s, annealing at 55°C for 30 s, extension at 72°C for 0.5 min, for a total of 35 cycles; extension at 72°C for 10 min.

Images