Application of CCDC25 inhibitor in the preparation of drugs for preventing and / or treating myocardial infarction and / or myocardial ischemia-reperfusion

Abstract

The present invention discloses the use of CCDC25 inhibitors in the preparation of drugs for preventing and / or treating myocardial infarction and / or myocardial ischemia-reperfusion. The present invention first discovered that CCDC25 is associated with myocardial infarction, and CCDC25 mediates the damaging effects of ischemia or ischemia-reperfusion on the myocardium. Experimental data show that after knocking out or targeting CCDC25 with drugs, the cardiac function of mice is significantly improved and the infarction range is significantly reduced; this indicates that CCDC25 can be used as a target for the treatment of myocardial infarction and myocardial ischemia-reperfusion, and the effect of preventing and / or treating myocardial infarction and myocardial ischemia-reperfusion can be achieved by inhibiting CCDC25, which has great application value for the research and development of drugs for myocardial infarction and myocardial ischemia-reperfusion.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the use of a CCDC25 inhibitor in the preparation of a drug for preventing and / or treating myocardial infarction and myocardial ischemia-reperfusion. Background Art

[0002] Cardiovascular disease remains one of the leading causes of death worldwide, and the morbidity and mortality of acute myocardial infarction remain high. At present, the clinical treatment of acute myocardial infarction mainly includes percutaneous coronary intervention (PCI), coronary artery bypass grafting (CABG), and combined anticoagulation and antiplatelet therapy. Although revascularization therapy has greatly reduced the mortality rate of acute myocardial infarction, it still faces the problem of further aggravation of injury after reperfusion, as well as adverse outcomes such as severe heart failure. There is currently no effective treatment strategy for both ischemia-reperfusion injury and chronic heart failure caused by acute myocardial infarction. People have tried many times to use various strategies to regenerate the heart to improve the prognosis of myocardial infarction, including implanting exogenous cells, inducing hypoxia, stimulating pro-regenerative genetic programs, injecting extracellular matrix (ECM) components, or administering growth factors. However, these methods have not been successfully transformed and applied to the clinic.

[0003] CCDC25 is a transmembrane protein present on the plasma membrane. However, there is no report on the involvement of CCDC25 in myocardial infarction. Summary of the invention

[0004] The object of the present invention is to provide a use of a CCDC25 inhibitor in the preparation of a drug for preventing and / or treating myocardial infarction and / or myocardial ischemia-reperfusion;

[0005] The technical solution adopted by the present invention is:

[0006] The first aspect of the present invention provides use of a CCDC25 inhibitor in the preparation of a medicament for preventing and / or treating myocardial infarction and / or myocardial ischemia-reperfusion.

[0007] Preferably, the CCDC25 inhibitor comprises at least one of the following:

[0008] (a1) Substances that inhibit the activity of CCDC25 protein;

[0009] (a2) substances that reduce the content of CCDC25 protein;

[0010] (c3) a substance that silences the CCDC25 gene;

[0011] (c4) a substance for knocking out the CCDC25 gene;

[0012] (c5) A substance that inhibits the expression of the CCDC25 gene.

[0013] Preferably, the CCDC25 inhibitor is a nucleic acid molecule, a protein molecule or a small molecule compound;

[0014] Preferably, the nucleic acid molecule is microRNA, siRNA, shRNA, dsRNA, sgRNA and / or antisense oligonucleotide;

[0015] Preferably, the protein molecule is a specific antibody for CCDC25, and the compound is a small molecule or polypeptide compound that binds to CCDC25.

[0016] Preferably, the sequence of the sgRNA is shown in at least one of SEQ ID NO.1 to SEQ ID NO.4.

[0017] In the present invention, sgRNA is used in conjunction with CRRSPR / Cas9 to achieve the purpose of gene knockout.

[0018] Furthermore, the CCDC25 inhibitor also includes the sgRNA used when knocking out the CCDC25 gene in the animal cell or in the animal body using CRISPR / Cas9 technology, or a DNA molecule that can transcribe the sgRNA, or an expression cassette or expression vector containing the DNA molecule, and of course, it can also include Cas9 protein or an expression vector for expressing Cas9 protein.

[0019] Preferably, the medicament comprises pharmaceutical excipients.

[0020] Preferably, the auxiliary materials include: at least one of a diluent, a binder, a wetting agent, a lubricant, a disintegrant, an emulsifier, a cosolvent, a solubilizer, a preservative, a pH regulator, an osmotic pressure regulator, a surfactant, a coating material, an antioxidant, an antibacterial agent or a buffer.

[0021] Preferably, the dosage form of the drug includes at least one of a suspension, granules, capsules, powders, tablets, emulsions, solutions, pills, injections, oral preparations, suppositories, enemas, aerosols, patches or drops.

[0022] Preferably, the administration route of the drug includes at least one of intravenous injection, intraperitoneal injection, intramuscular injection, subcutaneous injection, oral administration, sublingual administration, nasal administration, aerosol administration or transdermal administration.

[0023] In a second aspect of the present invention, an sgRNA, a DNA molecule encoding the sgRNA, or an expression cassette, a recombinant vector, or a recombinant cell containing the DNA molecule is provided.

[0024] Preferably, the sequence of the sgRNA is shown in at least one of SEQ ID NO.1 to SEQ ID NO.4.

[0025] Preferably, the vector comprises a viral vector or a non-viral vector.

[0026] Preferably, the viral vector comprises at least one of a lentiviral vector, an adenoviral vector, a baculoviral vector, a retroviral vector, a poxvirus vector, a Sendai virus vector, and a herpes simplex virus vector.

[0027] Preferably, the non-viral vector comprises at least one of a plasmid vector, a cationic polymer vector, chitosan, a liposome, and a nanoparticle vector.

[0028] Preferably, the cells include prokaryotic cells and eukaryotic cells; the cells are not new species of plants or animals.

[0029] Preferably, the prokaryotic cells include Escherichia coli, Streptomyces, Bacillus subtilis and other bacteria well known in the art that can be used to express target proteins.

[0030] Preferably, the eukaryotic cell comprises at least one of a yeast cell, a mammalian cell, a plant cell and an insect cell.

[0031] The third aspect of the present invention provides a drug for preventing and / or treating myocardial infarction and / or myocardial ischemia-reperfusion, wherein the drug comprises the sgRNA according to the second aspect of the present invention, a DNA molecule encoding the sgRNA, or an expression cassette, a recombinant vector, or a recombinant cell containing the DNA molecule.

[0032] Preferably, the drug also includes Cas9 protein.

[0033] In a fourth aspect of the present invention, a method for constructing a CCDC25 gene knockout mouse model is provided, comprising the following steps: performing CCDC25 gene knockout on mouse fertilized eggs using the CRISPR / Cas9 gene editing system to obtain F0 generation mice, mating the F0 generation mice with wild mice to obtain CCDC25 gene knockout heterozygous mice, and then selfing the CCDC25 gene knockout heterozygous mice to obtain CCDC25 gene knockout homozygous mice.

[0034] Preferably, the CCDC25 gene knockout is specifically a knockout in the exon 3 sequence region of CCDC25.

[0035] Preferably, the sequence of the sgRNA in the CRISPR / Cas9 gene editing system is shown in any one of SEQ ID NO.1 to SEQ ID NO.4.

[0036] Preferably, the construction method further comprises the step of identifying the genotype of the mouse;

[0037] Preferably, the method for identifying the mouse genotype comprises a PCR method, and the sequences of the primers used comprise SEQ ID NO.5 to SEQ ID NO.8.

[0038] The fifth aspect of the present invention provides a kit comprising primers as shown in SEQ ID NO: 5 to SEQ ID NO.8.

[0039] The sixth aspect of the present invention provides the use of the CCDC25 gene knockout mouse constructed according to the fourth aspect of the present invention in the study of CCDC25 gene function.

[0040] In the seventh aspect of the present invention, there is provided the use of the CCDC25 gene as a drug target in screening drugs for preventing and / or treating myocardial infarction and / or myocardial ischemia-reperfusion; the drug is a drug that inhibits the expression of the CCDC25 gene, and the drug has the function of preventing and / or treating myocardial infarction and / or myocardial ischemia-reperfusion injury, and the application is non-diagnostic and non-therapeutic.

[0041] Preferably, the applications include screening of drug targets, screening of drugs, pharmacodynamic evaluation of drugs and safety evaluation of drugs.

[0042] The beneficial effects of the present invention are:

[0043] The present invention discovers for the first time that CCDC25 is associated with myocardial infarction, and that CCDC25 mediates the damaging effects of ischemia or ischemia-reperfusion on the myocardium. Experimental data show that after knocking out CCDC25, the cardiac function of mice is significantly improved and the range of infarction is significantly reduced. This indicates that CCDC25 can be used as a target for the treatment of myocardial infarction, and that inhibiting CCDC25 can achieve the effect of preventing and / or treating myocardial infarction and myocardial ischemia-reperfusion, which has great application value in the research and development of drugs for myocardial infarction and myocardial ischemia-reperfusion. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 Strategies for constructing knockout mice.

[0045] Figure 2 This is the result of mouse genotype identification in Example 1.

[0046] Figure 3 This is the experimental flow chart of Example 2.

[0047] Figure 4 After the myocardial infarction model was constructed by knocking out the CCDC25 gene in mice, the mouse hearts were evaluated by ultrasound (AB), blood biochemical tests (CD), and cardiac Masson staining (EF).

[0048] Figure 5 This is the experimental flow chart of Example 3.

[0049] Figure 6 After establishing the mouse myocardial ischemia-reperfusion model, the mice were treated (normal saline or CCDC25 monoclonal antibody) and evaluated by cardiac ultrasound (EF), blood biochemistry (CD), cardiac TTC staining (AB) and masson staining (GH). DETAILED DESCRIPTION

[0050] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0051] Experimental animals used in the following examples: Wild-type mice were purchased from Guangdong Jicui Yaokang Biotechnology Co., Ltd. - / - Mice were purchased from Shanghai Model Organisms Technology Co., Ltd.; the breeding, reproduction, and use of mice followed the rules and regulations of the Laboratory Animal Care Committee of Sun Yat-sen University, and the relevant facilities have been accredited by AAALAC.

[0052] Example 1

[0053] 1. Construction of Ccdc25-eKO1 knockout mice

[0054] Knockout gene name (MGI number): Ccdc25 (MGI:1914429);

[0055] Knockout gene MGI website link: http: / / www.informatics.jax.org / marker / MGI:1914429;

[0056] Knockout gene name (Ensembl): Ccdc25 (ENSMUSG00000022035);

[0057] Knockout gene Ensembl website link: http: / / asia.ensembl.org / Mus_musculus / Gene / Summary?db=core;g=ENSMUSG00000022035;r=14:65837302-65866604;t=ENSMUST00000022614;

[0058] Transcript targeted by knockout (Ensembl number): Ccdc25-201 (ENSMUST00000022614.6);

[0059] Exon targeted by knockout: exon 3;

[0060] Build strategies such as Figure 1 As shown:

[0061] 1) gRNA preparation: the sequence is shown in Table 1;

[0062] Table 1

[0063] gRNA Sequence(5'-3') gRNA1 AGGGAGTGGATCTCAAGCCTTGG(SEQ ID NO.1) gRNA2 TTACTCTGGGAGGTAGGGAGTGG(SEQ ID NO.2) gRNA3 CCGTAGTAAGAAGCTGAGTTAGG(SEQ ID NO.3) gRNA4 CCAAAGAGAAGGGTGCGGGCGGG(SEQ ID NO.4)

[0064] 2) Genotype identification of F0 generation mice

[0065] F0 mice were obtained by microinjection of fertilized eggs, and their genotypes were subsequently identified by PCR.

[0066] Primer information is shown in Table 2:

[0067] Table 2

[0068] Primer Sequence 5'-->3' Primer Type P1 CGAACTCTTGGCAGGTCTGT(SEQ ID NO.5) Forward P2 ATGCCATTGGAGCCATGAA(SEQ ID NO.6) Reverse

[0069] The reaction system is shown in Table 3:

[0070] Table 3

[0071] Reaction Component Volume(μl) <![CDATA[ddH2O]]> 8 2*PCR Buffer 10 Primer P1 (10 pmol / μl) 0.5 Primer P2 (10 pmol / μl) 0.5 Tail genomic DNA 1 Total 20

[0072] 2*PCR Buffer:*2×Phanta Max Master Mix (Vazyme, Code No: P515-03)

[0073] The reaction conditions are shown in Table 4:

[0074] Table 4

[0075]

[0076] The sequence mutation of the F0 generation mice is finally obtained as shown in the table:

[0077] Table 5

[0078]

[0079]

[0080] 3) Obtaining F1 generation mice and identifying their genotypes

[0081] Positive F0 mice were selected to mate with wild-type C57BL / 6J mice, and the genotype of the obtained F1 heterozygous mice was identified using the same method as that of the F0 mice.

[0082] 4) Experimental mouse breeding

[0083] The obtained heterozygous knockout mice (Ccdc25 + / - ) were divided into two groups: one part of the heterozygous mice was mated with wild-type mice to expand the group and breed more heterozygous mice; the other part of the heterozygous mice were self-fertilized and homozygous mice with gene knockout (Ccdc25) were obtained through PCR identification. - / - ), to verify the gene knockout effect and conduct subsequent phenotypic analysis;

[0084] The primers used for PCR identification are shown in the following table:

[0085] Table 6

[0086] Primer Sequence(5'→3') P1 CGAACTCTTGGCAGGTCTGT(SEQ ID NO.5) P2 ATGCCATTGGAGCCATGAA(SEQ ID NO.6) P3 TCTATCTACCTGCTGCCTAT(SEQ ID NO.7) P4 TGTATTGACACTTGGCAGTT(SEQ ID NO.8)

[0087] The reaction system is shown in the following table:

[0088] Table 7

[0089]

[0090]

[0091] The reaction procedure is as follows:

[0092] Table 8

[0093]

[0094] Results Figure 2 ; Among them, the wild type: P1 and P2 PCR obtained a single 1675bp fragment; P3 and P4 could obtain a 310bp fragment; heterozygous: P1 and P2 PCR obtained two fragments of 1045bp and 1675bp; P3 and P4 could obtain a 310bp fragment; homozygous: P1 and P2 PCR obtained a single 1045bp fragment; P3 and P4 could not obtain a band.

[0095] Example 2 Exploring the application potential of targeting Ccdc25 in the treatment of myocardial infarction using a mouse myocardial infarction model

[0096] The present invention combines wild-type mice and Ccdc25 gene knockout mice, and constructs a mouse myocardial infarction model (LAD-MI) by ligating the anterior descending branch of the mouse coronary artery; continuously monitors the mouse heart ultrasound for 2 weeks (Echo); collects the mouse serum on the third day to measure the LDH and CK-MB levels; collects the mouse heart samples after 2 weeks for pathological staining and evaluation; the specific process is shown in Figure 3 .

[0097] 1) Combining wild-type mice and Ccdc25 knockout mice, a mouse myocardial infarction model was established by ligating the anterior descending branch of the mouse coronary artery.

[0098] The specific method is as follows: prepare 10 6-8 week old Ccdc25 - / - Mice and 10 matched C57BL / 6 wild-type (WT) mice were anesthetized with a mixture of ketamine (100 mg / kg) and thiazide (10 mg / kg) under mechanical ventilation, followed by left thoracotomy and ligation. During the operation, the body temperature of the mice was maintained by heating the surgical platform. The anterior descending branch of the coronary artery of the mouse heart was ligated with 6-0 sutures, and success was observed when a large area of ​​myocardium below the ligation site turned pale. The pleural blood was cleaned and the chest was closed layer by layer with 8-0 sutures. After the mouse recovered spontaneous breathing, the ventilator intubation was removed, and it was disinfected again with alcohol and placed on an electric blanket to maintain body temperature. After it woke up, it was returned to the cage for feeding.

[0099] 2) Continuous monitoring of mouse heart ultrasound for 2 weeks: Mouse echocardiography was performed at the Experimental Animal Center of Sun Yat-sen University using a VisualSonics 3100 echocardiography system. Small animal anesthesia (isoflurane) was used for sedation, and two-dimensional and M-mode images were obtained in the long-axis view. Ejection fraction (EF) was calculated using edge detection software and standard techniques.

[0100] 3) Collect serum from mice on the third day to measure LDH and CK-MB levels: Blood was collected from the posterior ocular vein of the mice, centrifuged at 3500 rpm for 10 minutes using a low-temperature high-speed centrifuge, and the upper serum was collected. LDH and CK-MB were detected using an automatic biochemical analyzer (Chemray 420).

[0101] 4) After 2 weeks, mouse heart samples were collected for Masson staining. Heart samples were made into paraffin sections and morphologically analyzed using Masson trichrome staining to calculate the fibrosis area.

[0102] Paraffin embedding and sectioning: After the mouse heart is removed, it is immediately placed in 4% paraformaldehyde and fixed overnight. Dehydrate with gradient alcohol, make it transparent with xylene, and soak it in paraffin according to the procedure, and embed it with an embedding machine and a suitable mold. Before slicing, precool the wax block at -10℃ for more than 10 minutes, then fix the wax block on the slicer for continuous slicing, with a slice thickness of 2.5μm. Spread the slice in a 45℃ water bath, dry it at room temperature after scooping it out, and bake it at 60℃ for more than 1h; Masson staining:

[0103] 1. Bake the slices and dewax until they are wet.

[0104] 2. Stain with Weigert's hematoxylin for 5-10 minutes and rinse gently with distilled water;

[0105] 3. After differentiation with 1% hydrochloric acid and alcohol, put it in water for a few minutes and it will turn blue;

[0106] 4. Dye with Ponceau red for 5-10 minutes and rinse gently with distilled water;

[0107] 5. Differentiate with 1% phosphomolybdic acid for 10 minutes until the color of the collagen fibers becomes noticeably lighter, and then immediately stain with toluidine blue for 5 minutes;

[0108] 6. Differentiation with 1% glacial acetic acid for 1 min;

[0109] 7. Dehydration: Immerse the sections in 85%, 95%, 100%, and 100% ethanol solutions for 2 minutes each time;

[0110] 8. Immerse the dehydrated sections in xylene three times, 5 minutes each time, and seal the sections.

[0111] The results showed that after knocking out Ccdc25 in mice, the cardiac ultrasound results showed that the ejection fraction of mice was significantly improved ( Figure 4 AB); On the third day, the blood biochemical test results of mice showed that myocardial injury indicators were significantly reduced ( Figure 4 CD); The results of masson staining of mouse hearts showed that the infarction area of ​​mice was significantly reduced ( Figure 4 EF). This indicates that after knocking out Ccdc25, the cardiac function of mice was significantly improved and the infarction area was significantly reduced; inhibition of Ccdc25 can be used to prevent or treat myocardial infarction.

[0112] Example 3

[0113] The potential application of targeting Ccdc25 in myocardial ischemia-reperfusion injury was explored using a mouse myocardial ischemia-reperfusion model.

[0114] 1) Establishing myocardial ischemia-reperfusion model and giving CCDC25 monoclonal antibody treatment (for details, see Figure 5 ).

[0115] The specific method is as follows: 40 6-8 week old C57BL / 6 wild-type (WT) mice were prepared and divided into a saline group and a CCDC25 monoclonal antibody treatment group. Under mechanical ventilation, the mice were anesthetized with a mixture of ketamine (100 mg / kg) and thiazide (10 mg / kg), followed by a left thoracotomy ligation. During the operation, the body temperature of the mice was maintained by heating the surgical platform. The anterior descending branch of the coronary artery of the mouse heart was ligated with 8-0 sutures, and it was successful when a large area of ​​myocardium below the ligation site turned pale. Half an hour after the ligation, the ligation was released, the pleural blood was cleaned, and the chest was closed layer by layer with 6-0 sutures. After the mouse resumed spontaneous breathing, the ventilator intubation was removed, and it was disinfected again with alcohol and placed on an electric blanket to maintain body temperature. After it woke up, it was returned to the cage for feeding.

[0116] 2) Collect serum from mice on the first day to measure LDH and CK-MB levels: Blood was collected from the posterior ocular vein of the mice, centrifuged at 3500 rpm for 10 minutes using a low-temperature high-speed centrifuge, and the upper serum was collected. LDH and CK-MB were detected using an automatic biochemical analyzer (Chemray 420).

[0117] 3) Collect mouse heart samples for TTC staining 24 hours after surgery: After killing the mouse by decapitation, quickly collect the heart (within 10 minutes), transfer it to a 0-4℃ PBS solution, and freeze it in a -20℃ refrigerator for 30 minutes. Cut the heart slices with a thickness of 2mm, put the slices in a 2% red tetrazolium solution in a 37℃ dark water bath for 30 minutes, and shake the container slightly every 5 minutes to ensure sufficient staining. Take out the heart slices and wash them with PBS solution for 3-5 minutes. You can take pictures immediately, or fix the brain slices with 10% neutral formaldehyde for 6 hours. Use imagej software for image analysis to measure the infarct area and total area of ​​each slice.

[0118] 4) Continuous monitoring of mouse heart ultrasound for one week: Mouse echocardiography was performed at the Experimental Animal Center of Sun Yat-sen University using a VisualSonics 3100 echocardiography system. Small animal anesthesia (isoflurane) was used for sedation, and two-dimensional and M-mode images were obtained in the long-axis view. Ejection fraction (EF) was calculated using edge detection software and standard techniques.

[0119] 5) One week later, mouse heart samples were collected for Masson staining. The heart samples were made into paraffin sections and morphologically analyzed using Masson trichrome staining to calculate the fibrosis area.

[0120] Paraffin embedding and sectioning: After the mouse heart is removed, it is immediately placed in 4% paraformaldehyde and fixed overnight. Dehydrate with gradient alcohol, make it transparent with xylene, and soak it in paraffin according to the procedure, and embed it with an embedding machine and a suitable mold. Before slicing, precool the wax block at -10℃ for more than 10 minutes, then fix the wax block on the slicer for continuous slicing, with a slice thickness of 2.5μm. Spread the slice in a 45℃ water bath, dry it at room temperature after scooping it out, and bake it at 60℃ for more than 1h; Masson staining:

[0121] 1. Bake the slices and dewax until they are wet.

[0122] 2. Stain with Weigert's hematoxylin for 5-10 minutes and rinse gently with distilled water;

[0123] 3. After differentiation with 1% hydrochloric acid and alcohol, put it in water for a few minutes and it will turn blue;

[0124] 4. Dye with Ponceau red for 5-10 minutes and rinse gently with distilled water;

[0125] 5. Differentiate with 1% phosphomolybdic acid for 10 minutes until the color of the collagen fibers becomes noticeably lighter, and then immediately stain with toluidine blue for 5 minutes;

[0126] 6. Differentiation with 1% glacial acetic acid for 1 min;

[0127] 7. Dehydration: Immerse the sections in 85%, 95%, 100%, and 100% ethanol solutions for 2 minutes each time;

[0128] 8. Immerse the dehydrated sections in xylene three times, 5 minutes each time, and seal the sections.

[0129] The results showed that compared with the saline group, CCDC25 monoclonal antibody treatment could significantly reduce the infarct size after 24 hours of myocardial ischemia-reperfusion ( Figure 6 AB); The results of blood biochemical tests on the first day showed that myocardial injury indicators were significantly reduced ( Figure 6 CD); The results of mouse cardiac ultrasound showed that the ejection fraction of mice was significantly improved ( Figure 6 EF); Seven days after ischemia-reperfusion, the results of Masson staining of mouse hearts showed that the infarction area of ​​mice was significantly reduced ( Figure 6 GH).

[0130] The above specific implementations have been described in detail for the present invention, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. Use of a CCDC25 inhibitor in the preparation of a drug for preventing and / or treating myocardial infarction and / or myocardial ischemia-reperfusion, wherein the CCDC25 inhibitor is a nucleic acid molecule; The nucleic acid molecule is sgRNA; The sequence of the sgRNA is shown in at least one of SEQ ID NO.1 to SEQ ID NO.

4.

2. The use according to claim 1, characterized in that: The drug includes pharmaceutically acceptable excipients.

Images