TCRs targeting KIT D816V mutation-derived antigens and their applications

Abstract

This invention provides a TCR targeting the KIT D816V mutation-derived antigen, a nucleic acid molecule comprising a nucleotide sequence encoding the TCR or its complementary sequence, a vector containing the nucleic acid molecule, a cell transducing the nucleic acid molecule or the vector, a pharmaceutical composition comprising the TCR, the nucleic acid molecule, the vector, or the cell as active ingredients, and the use of the TCR, the nucleic acid molecule, the vector, the cell, and the pharmaceutical composition in the detection, prevention, and / or treatment of cancers associated with the KIT D816V gene mutation-derived neoantigen.

Description

Technical Field

[0001] This invention belongs to the field of peptide drugs and peptide vaccines, specifically relating to antigenic peptides targeting the KIT D816V mutation and their application in tumor immunotherapy. Background Technology

[0002] KIT is a type III receptor tyrosine kinase located on chromosome 4q11-12, encoding the KIT protein (SCF receptor), which plays a crucial role in signal transduction in hematopoietic stem cells, mast cells, and gastrointestinal cajal cells. Upon binding to its ligand, stem cell factor, KIT leads to receptor dimerization and kinase activation, mediating biological processes such as cell proliferation, adhesion, migration, and apoptosis through the RAS / ERK, PI3K / AKT / mTOR, and JAK / STAT signaling pathways. Mutations in the KIT gene alter its expression pattern and internal kinase structure, deactivating autoinhibition and enabling ligand-independent autophosphorylation, thereby activating downstream proliferation pathways and leading to unregulated cell proliferation and tumorigenesis. Therefore, targeted elimination of KIT gene mutations is crucial for tumor prevention and treatment.

[0003] KIT gene mutations are found in approximately 90% of mastocytosis cases, 80%-90% of gastrointestinal stromal tumors, 26% of seminomas, 10%-20% of melanomas, and acute myeloid leukemia (AML), especially CBF-AML. Gain-of-function KIT mutations are located in exons 8 and 17 and are most common in solid tumors and hematologic malignancies. Among the many KIT mutations, the most common is the 816 aspartate (D816) mutation, which can be detected in more than 90% of systemic mastocytosis cases and 45% of CBF-AML patients. The KIT D816 mutation has clear clinical significance and is closely associated with poor prognosis, high relapse risk, and low survival. Some multi-target tyrosine kinase inhibitors are effective against KIT gene mutations; however, a significant number of patients still do not respond to initial treatment or develop secondary resistance, highlighting the urgent need for the development of novel targeted therapies.

[0004] Immunotherapy has become a hot topic and focus in the field of anti-tumor treatment in recent years. Among them, immunotherapy targeting neoantigens has attracted much attention. Neoantigens are derived from somatic cell gene mutations, specifically expressed in cancer cells, do not induce central immune tolerance, and have the advantages of strong immunogenicity and good safety, making them ideal targets for immunocellular therapy. In our previous studies, we found that the most common hotspot mutation of KIT—the neoantigen derived from KIT D816V (peptide sequence: KICDFGLARV)—has high immunogenicity. It is presented to the surface of tumor cells by the human leukocyte antigen HLA-A*02:01 molecule, forming a pHLA complex, which induces T cell activation and significantly kills tumor cells, making it an important target for anti-tumor immunotherapy.

[0005] The initiation of T-cell immune responses depends on the recognition of antigens by TCRs. Engineered TCR-T cells, constructed by artificially transducing antigen-specific TCRs into T cells, can target and kill tumor cells, potentially altering the body's immunosuppressive state, inducing specific immune responses, and promoting a virtuous cycle of immune protection. Neoantigen-targeting TCR-T cells have shown remarkable anti-tumor efficacy in pioneering clinical studies, and these neoantigen-specific TCR-T cells have a long duration of survival in patients, continuously exerting immune surveillance functions. However, there is currently no TCR-T cell therapy specifically targeting KIT D816V.

[0006] Given that KIT D816V is a promising target for immunotherapy and that T cells recognize KIT D816V mutations, alternative approaches targeting KIT D816V mutation-derived neoantigens include T cell-mediated immunotherapy using TCRs. However, artificial transduction of natural TCR structures has limitations such as low expression rates and high mismatch rates. Therefore, there is a need to develop TCR mutants with enhanced affinity. Summary of the Invention

[0007] The purpose of this invention is to address the shortcomings of existing technologies by providing an antigenic peptide targeting the KIT D816V mutation and its application in tumor immunotherapy.

[0008] According to a first aspect of the present invention, a TCR targeting a KIT D816V mutation-derived neoantigen is provided.

[0009] The novel antigen derived from the KIT D816V mutation (peptide sequence: KICDFGLARV) binds to the HLA-A*02:01 molecule and is presented to the surface of target cells to form the KICDFGLARV-HLA-A*02:01 complex.

[0010] The KICDFGLARV-HLA-A*02:01 complex is recognized by specific TCRs on the surface of T cells, inducing and initiating a specific immune response.

[0011] The TCR has the property of binding to the KICDFGLARV-HLA-A*02:01 complex, and the TCR contains a TCR α chain variable region and a TCR β chain variable region;

[0012] The CDR3 amino acid sequence of the variable region of the TCRα chain is CAVEGSWDNQGGKLIF (SEQ ID NO:7).

[0013] And / or the CDR3 amino acid sequence of the variable region of the TCRβ chain is CSATLGQGSTDTQYF (SEQ ID NO:10).

[0014] Preferably, the amino acid sequences of the three complementarity-determining regions of the TCRα chain variable region are as follows:

[0015] αCDR1: SEQ ID NO:5.

[0016] αCDR2: SEQ ID NO:6.

[0017] αCDR3: SEQ ID NO:7.

[0018] Preferably, the amino acid sequences of the three complementarity-determining regions of the TCRβ chain variable region are as follows:

[0019] βCDR1: SEQ ID NO:8.

[0020] βCDR2: SEQ ID NO:9.

[0021] βCDR3: SEQ ID NO:10.

[0022] Preferably, in the TCR targeting the KIT D816V mutation-derived neoantigen described above, the amino acid sequence of the variable region of the TCR α chain is an amino acid sequence with at least 90% sequence identity with SEQ ID NO:1; and / or the variable region of the TCR β chain is an amino acid sequence with at least 90% sequence identity with SEQ ID NO:2.

[0023] Preferably, the TCR contains the α-chain amino acid sequence SEQ ID NO:17.

[0024] Preferably, the TCR contains the β-chain amino acid sequence SEQ ID NO:18.

[0025] Preferably, the TCR is an αβ heterodimer.

[0026] Preferably, the TCR contains artificial interchain disulfide bonds between the α chain and the β chain.

[0027] Preferably, the amino acid sequence of the TCR is shown in SEQ ID NO:21.

[0028] A second aspect of the invention provides a nucleic acid molecule comprising a nucleic acid sequence encoding the TCR molecule described in the first aspect of the invention, or a complementary sequence thereof.

[0029] Preferably, the nucleic acid molecule contains a nucleotide sequence SEQ ID NO:3 encoding the TCRα chain variable region.

[0030] Preferably, the nucleic acid molecule contains a nucleotide sequence encoding the variable region of the TCRβ chain, SEQ ID NO:4.

[0031] Preferably, the nucleic acid molecule contains a nucleotide sequence SEQ ID NO:19 encoding the TCRα chain.

[0032] Preferably, the nucleic acid molecule contains a nucleotide sequence SEQ ID NO:20 encoding the TCRβ chain.

[0033] Preferably, the nucleic acid molecule comprises the nucleotide sequence SEQ ID NO:22.

[0034] In a third aspect, the present invention provides a carrier containing the nucleic acid molecule described in the second aspect of the present invention.

[0035] Preferably, the vector is a viral vector.

[0036] More preferably, the viral vector is a lentiviral vector or a retroviral vector.

[0037] In a fourth aspect, the present invention provides an isolated host cell containing a vector or genome of the present invention with an exogenous nucleic acid molecule of the present invention as described in the third aspect.

[0038] In a fifth aspect, the present invention provides a cell that expresses a TCR or antigen-binding fragment thereof targeting a KIT D816V mutation-derived neoantigen as described in the first aspect of the present invention, or carries a polynucleotide as described in the second aspect of the present invention, or contains a vector as described in the third aspect of the present invention.

[0039] Preferably, the cells are T cells, peripheral blood mononuclear cells (PBMCs), or stem cells.

[0040] In a sixth aspect, the present invention also provides a method for preparing the TCR or antigen-binding fragment thereof targeting the KIT D816V mutation-derived neoantigen, the method comprising culturing the cells of the fifth aspect.

[0041] The seventh aspect of the present invention also provides the use of a TCR or antigen-binding fragment thereof targeting a KIT D816V mutation-derived neoantigen according to the first aspect of the present invention, or a polynucleotide according to the second aspect of the present invention, or a vector according to the third aspect of the present invention, or a cell according to the fourth aspect of the present invention, or a cell according to the fifth aspect of the present invention, or a preparation method according to the sixth aspect of the present invention in the preparation of a medicament for treating leukemia.

[0042] In an eighth aspect, the present invention also provides a medicament for treating tumors, the medicament comprising a TCR or antigen-binding fragment thereof targeting a KIT D816V mutation-derived neoantigen according to the first aspect of the present invention, or a polynucleotide according to the second aspect, or a carrier according to the third aspect, or a cell according to the fourth aspect, or a cell according to the fifth aspect.

[0043] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here.

[0044] This invention, through extensive and in-depth research, yields a high-affinity TCR or its antigen-binding fragment targeting a novel KIT D816V mutation-derived antigen, a nucleic acid molecule comprising a nucleotide sequence encoding the TCR or its complementary sequence, a vector containing the nucleic acid molecule, a cell transducing the nucleic acid molecule or the vector, a pharmaceutical composition comprising the TCR, the nucleic acid molecule, the vector, or the cell as active ingredients, and the uses of the TCR, the nucleic acid molecule, the vector, the cell, and the pharmaceutical composition for preparing drugs for detecting, preventing / treating tumors.

[0045] Compared with the prior art, the present invention has the following beneficial effects:

[0046] The TCR of the present invention can directly eliminate tumor cells by precisely targeting the KIT D816V mutation; the TCR of the present invention has a high protein expression level in vivo and no mismatch with the endogenous TCR chain; T cells expressing the TCR of the present invention have strong killing ability and high specificity, and can be effectively used for the treatment of tumors containing the KIT D816V mutation. Attached Figure Description

[0047] Figure 1 Detection and isolation of KIT D816V mutation-derived neoantigen-specific T cells;

[0048] Figure 2 Schematic diagram of the original KIT D816V mutation-derived neoantigen-specific TCR sequence;

[0049] Figure 3 The transduction efficiency of T cells modified with the KIT D816V mutation-derived neoantigen-specific TCR gene;

[0050] Figure 4 Validation of in vitro activation of KIT D816V mutation-derived neoantigen-specific TCR-T cells;

[0051] Figure 5 KIT D816V mutation-derived neoantigen-specific TCR-T cell in vitro killing activity;

[0052] Figure 6 KIT D816V mutation-derived neoantigen-specific TCR-T cell line for in vitro recognition of tumor cell lines;

[0053] Figure 7KIT D816V mutation-derived neoantigen-specific TCR-T cell line for in vitro tumor killing;

[0054] Figure 8 KIT D816V mutation-derived neoantigen-specific TCR-T cells recognize AML primitive cells in vitro;

[0055] Figure 9 KIT D816V mutation-derived neoantigen-specific TCR-T cells kill AML progenitor cells in vitro. Detailed Implementation

[0056] To better understand the technical content of the present invention, specific embodiments are described below in conjunction with the accompanying drawings.

[0057] Various aspects of the invention are described in this disclosure with reference to the accompanying drawings, in which numerous illustrative embodiments are shown. The embodiments of this disclosure are not necessarily intended to encompass all aspects of the invention. It should be understood that the various concepts and embodiments described above, as well as those described below in more detail, can be implemented in any of a number of ways.

[0058] Example 1. In vitro induction of KIT D816V mutant-derived neoantigen-specific T cells

[0059] Venous blood was collected from HLA-A*02:01 positive healthy volunteers, and PBMCs were separated and purified using Ficoll density gradient centrifugation. CD8+ was separated using Dynabeads magnetic beads. + Cells and CD14 + Cells. CD14+ cells were resuspended in RPMI-1640 medium containing 10% FBS, 1000 U / mL IL-4, and 1000 U / mL GM-CSF, and cultured for 3 days to induce dendritic cells (DCs). DCs were reselected in fresh medium containing 800 IU / mL GM-CSF, 1000 IU / mL IL-4, 10 ng / mL TNF-α, 10 ng / mL IL-1β, 1000 IU / mL IL-6, and 1 μg / mL PGE2 to induce DC maturation. Mature DCs were recovered, resuspended in serum-free RPMI-1640 medium, and incubated with KIT D816V mutant-derived neoantigen peptide (KICDFGLARV; 10 μg / mL) for 2-4 hours at 37°C. DCs stimulated with neoantigen peptide pulses were collected, inactivated at 37°C with 30 μg / mL mitomycin C for 30 min, and resuspended in RPMI-1640 medium containing 10% FBS (containing IL-2 50 U / mL, IL-7 5 ng / mL, and IL-15 5 ng / mL). They were then reacted with CD8+. +Cells were co-incubated, with half the medium changed every 2-3 days, for 10-20 days. Cells were collected, stained with PE-labeled neoantigen peptide-HLA-A*02:01-Tetramer and APC-labeled CD8 antibody, and analyzed by flow cytometry.

[0060] Results: After stimulation with a KIT D816V mutation-derived neoantigen, CD8 in healthy donors... + / Tetramer + The proportion of T cells increased from 0.044% to 0.4%. Figure 1 This indicates that the KIT D816V mutation-derived neoantigen induces T cell-specific expansion in vitro.

[0061] Example 2. TCR sequencing to obtain HLA-A*02:01 restriction KIT D816V mutation-derived neoantigen-specific TCR

[0062] CD8 sorting by flow cytometry + / Tetramer + Total RNA was extracted from cells using the RNeasy Plus Mini Kit (Qiagen).

[0063] The TCR analysis system synthesizes cDNA with a 5' race conjugate from total RNA, introducing a unique molecular marker (UMI) to control bottleneck effects and eliminate PCR and sequencing errors. Sequencing is performed in Illumina. The system is running in PE150 mode. CD8 is retrieved respectively. + / Tetramer + The TCRα and TCRβ chain sequences of the cells. Sequencing result analysis was performed using a method we independently developed (National Invention Patent Application No.: CN202210939709.2). The most frequently occurring TCRα and TCRβ sequences were considered to be the master clone sequences of T cells, i.e., specific TCR sequences.

[0064] The amino acid sequence of the variable region of the TCRα chain is SEQ ID NO:1.

[0065] The amino acid sequences of the three complementarity-determining regions of the TCRα chain variable region are as follows:

[0066] αCDR1: DSAIYN (SEQ ID NO: 5),

[0067] αCDR2: IQSSQRE (SEQ ID NO:6),

[0068] αCDR3: CAVEGSWDNQGGKLIF (SEQ ID NO:7).

[0069] The nucleotide sequence of the variable region of the TCRα chain is SEQ ID NO.3.

[0070] The nucleotide sequences of the three complementarity-determining regions of the TCRα chain variable region are as follows:

[0071] αCDR1: GATAGCGCTATTTACAAC (SEQ ID NO: 11),

[0072] αCDR2: ATTCAGTCAAGTCAGAGAGAG (SEQ ID NO: 12),

[0073] αCDR3: TGTGCTGTAGAGGGGAGTTGGGATAACCAGGGAGGAAAGCTTATCTTC (SEQ ID NO: 13).

[0074] The amino acid sequence of the variable region of the TCRβ chain is SEQ ID NO:2.

[0075] The amino acid sequences of the three complementarity-determining regions of the TCRβ chain variable region are as follows:

[0076] βCDR1:DFQATT(SEQ ID NO:8),

[0077] βCDR2: SNEGSKA (SEQ ID NO:9),

[0078] βCDR3: CSATLGQGSTDTQYF (SEQ ID NO: 10).

[0079] The nucleotide sequence of the variable region of the TCRβ chain is SEQ ID NO:4.

[0080] The nucleotide sequences of the three complementarity-determining regions of the TCRβ chain variable region are as follows:

[0081] βCDR1: GACTTTCAGGCCACAACT (SEQ ID NO:14),

[0082] βCDR2: TCCAATGAGGGCTCCAAGGCC (SEQ ID NO: 15),

[0083] βCDR3: TGCAGTCCACCCTCGGACAGGGTTCCAGATACGCAGTATTTT (SEQ ID NO: 16).

[0084] The TCR sequences obtained by sequencing were optimized for the most frequent TCRα and TCRβ sequences. Their constant regions were modified and replaced with optimized mouse constant regions to avoid mismatches between exogenous TCR and endogenous TCR in T cells. The expression sequences were codon optimized to increase protein expression levels. P2A and Furin-cleavage were used to enable simultaneous expression of TCRα and TCRβ in a single expression vector.

[0085] Construct a lentiviral expression vector by inserting the aforementioned TCRα and TCRβ sequences into the same lentiviral expression vector. The original TCR sequence is as follows: Figure 2 As shown, virus packaging was performed using 293T cells to produce KIT D816V mutant-derived neoantigen-specific TCR-specific lentiviral particles.

[0086] Example 3. Construction of specific TCR-T cells targeting the KIT D816V mutation

[0087] Peripheral blood was collected from healthy volunteers. PBMCs were isolated and purified using Ficoll density gradient centrifugation and resuspended in AIM-V medium containing 5% FBS. Anti-CD3 antibody (OTK3, 50 ng / mL), IL-2 (300 IU / mL), IL-7 (30 ng / mL), IL-12 (15 ng / mL), and TGF-β (5 ng / mL) were added, and the cells were activated at 37°C for 48 h. Activated T cells were infected with TCR lentiviral particles, with the addition of IL-2 (300 IU / mL) and protamine sulfate (8 μg / mL), and centrifuged at 800 × g for 90 min. TCR-transfected T cells were further cultured in AIM-V medium containing 10% FBS, IL-7 (5 ng / mL), IL-15 (5 ng / mL), and IL-2 (1000 IU / mL) for 72 h.

[0088] TCR-T cells were collected, washed twice with FACS buffer, and then stained with PE-mTCRβ flow cytometry antibody, PE neoantigen peptide-HLA-A*02:01-Tetramer and APC-CD3 flow cytometry antibody, respectively. The cells were then detected by flow cytometry.

[0089] The results are as follows Figure 3 As shown: TCR transduction efficiency (CD3) + / mTCRβ + The efficiency was 77.5%, of which the efficiency of expressing heterodimeric TCR (CD3) was 77.5%. + / Tetramer + The percentage was 35.7%, indicating that TCR-T cells were successfully constructed.

[0090] Example 4. Verification of the in vitro activation function of KIT D816V mutation-derived neoantigen-specific TCR-T cells.

[0091] To detect the ability of TCR-T cells to target the KIT D816V mutation, the activation level of TCR-T cells was determined by enzyme-linked immunosorbent assay (ELISA) using IFN-γ and Granzyme B. The specific steps are as follows:

[0092] TCR-T cells transfected with lentivirus at a rate of 1×10 6 TCR-T cells were seeded at a density of 10 ng / mL in 24-well plates. On Day 1, IL-7 (10 ng / mL) and IL-15 (10 ng / mL) were added. On Day 2, T2 cells loaded with neoantigen peptides were co-incubated with TCR-T cells at a ratio of 1:10 to achieve secondary antigen stimulation, and IL-21 (30 ng / mL) was added. On Day 3, IL-7 (10 ng / mL) and IL-15 (10 ng / mL) were added for further culture. TCR-T cells were collected as effector cells.

[0093] With different loading concentrations (10 1 10 0 10 -1 10 -2 10 -3 10 -4 T2 cells loaded with a novel KIT D816V mutant peptide (μM) were used as target cells in the experimental group, while T2 cells loaded with the corresponding concentration of wild-type KIT peptide were used as target cells in the control group. The target cells were 1×10⁻⁶ cells per cell. 5 Seed 100 μl / well in a 96-well plate, and add TCR-T cells (2 × 10⁶ cells / well). 5 Incubate at 37℃ for 18-24 hours (100 μl / well). Centrifuge the plates, add 100 μl of supernatant to each well of an ELISA strip pre-coated with IFN-γ or Granzyme B antibody, and perform color development according to the instructions. Read the plates using a microplate reader. Calculate a standard curve based on the absorbance values ​​of the standards, and calculate the IFN-γ or Granzyme B secretion level per well accordingly. For each concentration in each group, set at least 3 replicates, and repeat each experiment 3 times.

[0094] The results are as follows Figure 4 As shown, TCR-T cells significantly secreted IFN-γ and Granzyme B upon stimulation with T2 cells loaded with the KIT D816V mutant-derived neoantigen, but had no effect on T2 cells loaded with wild-type antigen peptides. This indicates that TCR-T cell activation is KIT D816V specific.

[0095] Example 5. Verification of the in vitro killing function of KIT D816V mutation-derived neoantigen-specific TCR-T cells.

[0096] To verify the ability of TCR-T cells to target the KIT D816V mutation, the killing capacity of TCR-T cells was assessed by quantitatively detecting lactate dehydrogenase (LDH) released during cell lysis. The specific steps are as follows:

[0097] TCR-T cells transfected and expanded in Example 4 were collected as effector cells; T2 cells loaded with KIT D816V mutant-derived neoantigen peptide (10 μg / mL) were used as target cells in the experimental group, and T2 cells loaded with the corresponding concentration of KIT wild-type antigen peptide (10 μg / mL) were used as target cells in the control group. TCR-T cells and target cells were seeded in 96-well plates at effector-to-target ratios of 40:1, 20:1, 10:1, and 5:1, respectively. Promega CytoTox was used as the treatment. The Non-Radioactive Cytotoxicity Assay kit instructions include additional wells for spontaneous target cell release, maximum target cell release, culture baseline control, and volume correction control. The 96-well plate was incubated at 37°C for 4 hours. After centrifugation, 50 μl of supernatant was added to each well to a fresh 96-well plate. Color development was performed according to the instructions, and the plate was read using a microplate reader. The cytotoxicity percentage (%) at different effector-to-target ratios was calculated to assess the ability of TCR-T cells to specifically kill T2 cells loaded with the KIT D816V mutant-derived neoantigen. Each well was set to 3 replicates, and the experiment was repeated 3 times.

[0098] The results are as follows Figure 5 As shown, TCR-T cells significantly killed T2 cells loaded with the KIT D816V mutant-derived neoantigen, but had no effect on T2 cells loaded with the KIT wild-type antigen peptide, indicating that TCR-T cells have targeted killing function.

[0099] Example 6. KIT D816V mutation-derived neoantigen-specific TCR-T cell line for in vitro recognition of tumor cell lines

[0100] To verify the function of TCR-T cells in recognizing tumor cell lines that endogenously present KIT D816V mutation-derived neoantigens, the activation capacity of TCR-T cells was measured using IFN-γ and Granzyme B-ELISA. The specific steps are as follows:

[0101] The TCR-T cells transfected and expanded in Example 4 were collected as effector cells; HLA-A*02:01 positive OCI-AML3 cells transfected with the KIT D816V mutation were used. D816V Cells were used as target cells, with primitive OCI-AML3 cells used as control target cells. Target cells were administered at doses of 2 × 10⁻⁶.4 TCR-T cells were seeded at 100 μl / well in 96-well plates at effector-to-target ratios of 20:1, 10:1, 5:1, and 2.5:1. The cells were co-incubated at 37°C for 18–24 h. IFN-γ and Granzyme B secretion levels were assessed as described in Example 4 to evaluate the TCR-T cells' ability to specifically recognize AML cell lines. Each concentration in each group was set up in at least three replicates, and each experiment was repeated three times.

[0102] The results are as follows Figure 6 As shown: In OCI-AML3 D816V Upon stimulation, TCR-T cells significantly secreted IFN-γ and Granzyme B, but had no effect on OCI-AML3 cells. This indicates that TCR-T cells specifically recognize endogenously presented HLA-A*02:01, a neoantigen derived from the KIT D816V mutation. + Tumor cell lines.

[0103] Example 7: KIT D816V mutation-derived neoantigen-specific TCR-T cell line for in vitro tumor killing

[0104] To verify the ability of TCR-T cells to target tumor cell lines that endogenously present KIT D816V mutant-derived neoantigens, the killing capacity of TCR-T cells was determined using the LDH release assay. The specific steps are as follows:

[0105] The TCR-T cells transfected and expanded in Example 4 were collected as effector cells; OCI-AML3 cells from Example 6 were collected. D816V OCI-AML3 cells were used as the experimental and control groups, respectively, as target cells. TCR-T cells and target cells were added at effector-to-target ratios of 40:1, 20:1, 10:1, and 5:1, and co-incubated at 37°C for 4 hours. Supernatant was collected, staining was performed, and the plates were read according to the manufacturer's instructions. Cell lysis rate was calculated using the formula to assess the ability of TCR-T cells to specifically kill AML cell lines. Each concentration in each group was set up in at least 3 replicates, and each experiment was repeated 3 times.

[0106] The results are as follows Figure 7 As shown: TCR-T cells significantly kill OCI-AML3 D816V The TCR-T cells showed no effect on endogenously presenting HLA-A*02:01, a novel KIT D816V mutant-derived neoantigen. This indicates that TCR-T cells specifically kill endogenously presenting KIT D816V mutant-derived neoantigens. + Tumor cell lines.

[0107] Example 8: KIT D816V mutation-derived neoantigen-specific TCR-T cells recognize tumor blast cells in vitro.

[0108] To verify the function of TCR-T cells in recognizing tumor blast cells that endogenously present a KIT D816V mutation-derived neoantigen, the activation capacity of TCR-T cells was measured using IFN-γ and Granzyme B-ELISA. Taking acute myeloid leukemia (AML) as an example, the specific steps are as follows:

[0109] The TCR-T cells transfected and expanded in Example 4 were collected as effector cells; HLA-A*02:01 were collected. + / KIT D816V+ Bone marrow blast cells from AML patients were used as target cells in the experimental group, and HLA-A*02:01 were collected. – / KIT D816V+ HLA-A*02:01 + / KIT D816V– and HLA-A*02:01 – / KIT D816V– Bone marrow blast cells from AML patients were used as target cells in the control group. Target cells were administered at doses of 2 × 10⁻⁶. 4 TCR-T cells were seeded at 100 μl / well in 96-well plates at effector-to-target ratios of 20:1, 10:1, 5:1, and 2.5:1. The plates were co-incubated at 37°C for 18–24 h. IFN-γ and Granzyme B secretion levels were assessed as described in Example 4 to evaluate the TCR-T cells' ability to specifically recognize AML progenitor cells. At least three replicates were set for each concentration in each group, and each experiment was repeated three times.

[0110] The results are as follows Figure 8 As shown: In HLA-A*02:01 + / KIT D816V+ Upon stimulation by AML blast cells, TCR-T cells significantly secrete IFN-γ and Granzyme B. This indicates that TCR-T cells specifically recognize AML blast cells that endogenously present KIT D816V.

[0111] Example 9: KIT D816V mutant-derived neoantigen-specific TCR-T cells kill tumor progenitor cells in vitro.

[0112] To verify the function of TCR-T cells in targeting tumor blast cells that endogenously present KIT D816V mutation-derived neoantigens, the killing ability of TCR-T cells was determined by the LDH release assay. Taking AML as an example, the specific steps are as follows:

[0113] The TCR-T cells transfected and expanded in Example 4 were collected as effector cells; HLA-A*02:01 were collected. + / KIT D816V+ Bone marrow blast cells from AML patients were used as target cells in the experimental group, and HLA-A*02:01 were collected.– / KITD816V + HLA-A*02:01 + / KIT D816V– and HLA-A*02:01 – / KIT D816V– Bone marrow blast cells from AML patients served as target cells in the control group. TCR-T cells and target cells were added at effector-to-target ratios of 20:1, 10:1, and 5:1, respectively, and co-incubated at 37°C for 4 hours. Supernatant was collected, staining was performed, and the plates were read according to the manufacturer's instructions. Cell lysis rate was calculated using the formula to assess the ability of TCR-T cells to specifically kill AML blast cells. Each concentration in each group was set up in at least three replicates, and each experiment was repeated three times.

[0114] The results are as follows Figure 9 As shown: TCR-T cells significantly kill HLA-A*02:01 + / KIT D816V+ AML blast cells, demonstrating the targeting effect of TCR-T cells on KIT D816V mutation-positive AML blast cells.

[0115] This embodiment may also provide, based on a TCR targeting a KIT D816V-derived neoantigen, a nucleic acid molecule comprising a nucleotide sequence encoding the TCR or its complementary sequence, a vector containing the nucleic acid molecule, a cell transducing the nucleic acid molecule or the vector, a pharmaceutical composition comprising the TCR, the nucleic acid molecule, the vector, or the cell as an active ingredient, and the use of the TCR, the nucleic acid molecule, the vector, the cell, and the pharmaceutical composition in the detection, prevention, and / or treatment of cancers associated with NPM1c gene mutation-derived neoantigens.

[0116] While the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the invention. Those skilled in the art can make various modifications and refinements without departing from the spirit and scope of the invention. Therefore, the scope of protection of the present invention shall be determined by the claims.

Claims

1. A TCR targeting a neoantigen derived from the KIT D816V mutation, characterized in that, The TCR can recognize the KICDFGLARV-HLA-A*02:01 complex, and the TCR contains a TCRα chain variable region and a TCRβ chain variable region: the CDR3 amino acid sequence of the TCRα chain variable region is as follows: CAVEGSWDNQGGKLIF(SEQ ID NO:7) The CDR3 amino acid sequence of the variable region of the TCRβ chain is as follows: CSATLGQGSTDTQYF(SEQ ID NO:10); The variable region of the TCRα chain also includes αCDR1 and αCDR2 complementarity-determining regions, whose amino acid sequences are as follows: αCDR1: DSAIYN (SEQ ID NO:5) αCDR2: IQSSQRE (SEQ ID NO: 6); The TCRβ chain variable region also includes βCDR1 and βCDR2 complementarity-determining regions, whose amino acid sequences are as follows: βCDR1:DFQATT(SEQ ID NO:8), βCDR2: SNEGSKA (SEQ ID NO:9).

2. The TCR targeting the KIT D816V mutation-derived neoantigen according to claim 1, characterized in that: The amino acid sequence of the variable region of the TCRα chain is an amino acid sequence with at least 90% sequence identity with SEQ ID NO:1; the amino acid sequence of the variable region of the TCRβ chain is an amino acid sequence with at least 90% sequence identity with SEQ ID NO:

2.

3. The TCR targeting the KIT D816V mutation-derived neoantigen according to claim 1, characterized in that: The TCR contains the α-chain amino acid sequence SEQ ID NO:

17.

4. The TCR targeting the KIT D816V mutation-derived neoantigen according to claim 1, characterized in that: The TCR contains the β-chain amino acid sequence SEQ ID NO:

18.

5. The TCR targeting the KIT D816V mutation-derived neoantigen according to claim 1, characterized in that: TCR is an αβ heterodimer, with artificial interchain disulfide bonds between the α and β chains.

6. The TCR targeting the KIT D816V mutation-derived neoantigen according to claim 1, characterized in that: The amino acid sequence of the TCR is shown in SEQ ID NO:

21.

7. A nucleic acid molecule, characterized in that: The nucleic acid molecule encodes the TCR as described in any one of claims 1 to 6.

8. The nucleic acid molecule according to claim 7, characterized in that: The nucleotide sequence encoding the variable region of the TCRα chain is SEQ ID NO:

3.

9. The nucleic acid molecule according to claim 7, characterized in that: The nucleotide sequence encoding the TCRα chain is SEQ ID NO:

19.

10. The nucleic acid molecule according to claim 7, characterized in that: The nucleotide sequence encoding the variable region of the TCRβ chain is SEQ ID NO:

4.

11. The nucleic acid molecule according to claim 7, characterized in that: The nucleotide sequence encoding the TCRβ chain is SEQ ID NO:

20.

12. The nucleic acid molecule according to claim 7, characterized in that: The nucleotide sequence encoding the TCR is SEQ ID NO:

22.

13. A carrier, characterized in that: The vector contains the nucleic acid molecule as described in any one of claims 7 to 12.

14. The carrier according to claim 13, characterized in that: The vector is a viral vector.

15. An isolated host cell, characterized in that: The host cell contains the vector or genome of claim 13 or 14, which integrates an exogenous nucleic acid molecule of any one of claims 7 to 12.

16. A cell, characterized in that: The cells express a TCR targeting the KITD816V mutation-derived neoantigen as described in any one of claims 1 to 6, or carry a nucleic acid molecule as described in any one of claims 7 to 12, or contain a vector as described in claim 13 or 14.

17. The cell according to claim 16, characterized in that: The cells are T cells, peripheral blood mononuclear cells (PBMCs), or stem cells.

18. A medicament for treating tumors, the medicament comprising a TCR targeting a KITD816V mutation-derived neoantigen as described in any one of claims 1 to 6, or a nucleic acid molecule as described in any one of claims 7 to 12, or a vector as described in claim 13 or 14, or an isolated host cell as described in claim 15, or a cell as described in claim 16 or 17.

19. Use of the TCR according to any one of claims 1 to 6, or the nucleic acid molecule according to any one of claims 7 to 12, or the vector according to claim 13 or 14, or the isolated host cell according to claim 15, or the cell according to claim 16 or 17, characterized in that: The intended use is for preparing a drug to treat acute myeloid leukemia (AML).

Images