A phenolic acid decarboxylase mutant and its preparation and application

Abstract

The present invention discloses a phenolic acid decarboxylase mutant, its preparation, and use. The mutant comprises at least one amino acid mutation at positions 40, 92, and 131 of the amino acid sequence shown in SEQ ID No. 1: the isoleucine Ile at position 40 is mutated to valine Val; the isoleucine Ile at position 92 is mutated to either threonine Thr or valine Val; and the valine Val at position 131 is mutated to leucine Leu. The phenolic acid decarboxylase mutant is modified by site-directed mutagenesis to alter the amino acid sequence, thereby changing the protein structure and function, improving enzyme activity, and significantly improving the catalytic activity for ferulic acid compared to the original enzyme.

Description

Technical Field

[0001] The present invention relates to the technical fields of enzyme engineering and genetic engineering, and in particular to a phenolic acid decarboxylase mutant and its preparation and application. Background Art

[0002] 4-Vinylguaiacol (4VG), chemically known as 2-methoxy-4-vinylphenol, is volatile, has a distinctive fermented aroma, and is highly recognizable by olfactory recognition. It is a key flavoring agent in soy sauce, liquor, wine, and beer. GB 2760-1996 stipulates that 4VG is permitted for use as a food flavoring. Natural 4VG is also used as an intermediate in the production of natural vanillin.

[0003] Existing methods for producing 4-vinylguaiacol include chemical methods and bioconversion methods. For example, Chinese patent publication number CN101885669A discloses a "method for preparing 4-vinylguaiacol." The method involves reacting quinoline and ferulic acid at high temperature in the presence of the blocking agent p-diphenol. The product is then repeatedly washed with hydrochloric acid and benzene, and finally refined to volatilize the benzene. This chemical method is complex and involves numerous organic solvents. Furthermore, the 4-vinylguaiacol produced by this method cannot be used in the production of downstream high-value-added natural fragrances. For example, Chinese patent publication number CN110184315B discloses a "method for preparing high-concentration 2-methoxy-4-vinylphenol." Recombinant Escherichia coli containing the phenolic acid decarboxylase BaPAD, derived from Bacillus atrophaeus, is used as a catalyst to convert ferulic acid to 4-vinylphenol via non-oxidative decarboxylation in the presence of water / n-octanol. This method addresses the issue of low activity of phenolic acid decarboxylase in the presence of high concentrations of 4-vinylguaiacol. This bioconversion method for producing 4-vinylguaiacol requires large amounts of organic solvent for extraction, increasing production costs and generating significant amounts of wastewater during production and product purification.

[0004] Natural 4-vinylguaiacol is a precursor for the production of the high-value-added natural compound vanillin. Therefore, it is necessary to increase the yield of natural 4-vinylguaiacol produced by conventional aqueous bioprocesses to meet industrial production requirements. Low enzyme activity and conversion rates under conventional reaction conditions are major limitations to natural 4-vinylguaiacol production. Summary of the Invention

[0005] Objectives of the invention: The first objective of the present invention is to provide a phenolic acid decarboxylase mutant, which improves the catalytic activity of the phenolic acid decarboxylase through site-directed mutagenesis to meet the industrial production needs of 4-vinylguaiacol under conventional reaction conditions; the second objective of the present invention is to provide a method for preparing the phenolic acid decarboxylase mutant; and the third objective of the present invention is to provide the use of the phenolic acid decarboxylase mutant in the catalytic preparation of 4-vinylguaiacol.

[0006] Technical solution: The phenolic acid decarboxylase mutant of the present invention comprises a mutant in which at least one amino acid is substituted at positions 40, 92, and 131 of the amino acid sequence shown in SEQ ID No. 1; the isoleucine Ile at position 40 is mutated to valine Val; the isoleucine Ile at position 92 is mutated to any one of threonine Thr and valine Val; and the valine Val at position 131 is mutated to leucine Leu.

[0007] The invention recombinantly constructs a phenolic acid decarboxylase mutant with high activity by performing site-directed mutagenesis on amino acids in the active center of phenolic acid decarboxylase derived from "Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)".

[0008] Preferably, the mutant amino acid sequence is any one of the sequences shown in SEQ ID No. 2 to 5.

[0009] The gene encoding the phenolic acid decarboxylase mutant protein of the present invention.

[0010] Preferably, the gene encoding the phenolic acid decarboxylase mutant protein has a nucleotide sequence as shown in SEQ ID Nos. 7 to 10.

[0011] The cloning vector or expression vector containing the above gene of the present invention.

[0012] The present invention also relates to a recombinant vector encoding the phenolic acid decarboxylase mutant gene and a recombinant genetically engineered bacterium prepared by transformation with the recombinant vector. The recombinant vector of the present invention is not limited, as long as it can maintain replication or autonomous replication in various prokaryotic and / or eukaryotic host cells. The vector can be any conventional vector in the art, such as various plasmids, phages, or viral vectors. Preferably, the pET22b(+) plasmid is used as the expression vector, and Escherichia coli (E. coli C43 cells or E. coli BL21) is used as the expression host.

[0013] The method for preparing the phenolic acid decarboxylase mutant of the present invention comprises the following steps:

[0014] (1) Designing point mutation primers, using the plasmid carrying the wild-type gene of phenolic acid decarboxylase as a template, and performing PCR reactions using the point mutation primers, and obtaining the mutant gene fragment and linearized plasmid after purification;

[0015] (2) Connecting the mutant gene fragment to the linearized plasmid to construct an expression vector, which is then transferred into the host bacteria for induction of expression;

[0016] (3) Collecting the host bacteria expressing the phenolic acid decarboxylase mutant, resuspending the bacteria and breaking the cells, and centrifuging and collecting the supernatant to obtain the crude enzyme solution containing the phenolic acid decarboxylase mutant.

[0017] Preferably, the point mutation primers are:

[0018]

[0019] Preferably, the PCR reaction system is:

[0020]

[0021] The invention relates to an application of the phenolic acid decarboxylase mutant in the catalytic preparation of 4-vinylguaiacol.

[0022] The present invention also provides a method for using the phenolic acid decarboxylase mutant in catalyzing the synthesis of 4-vinylguaiacol from ferulic acid. Preferably, the method comprises: using wet cells of a recombinant engineered bacterium containing a gene encoding the phenolic acid decarboxylase mutant after induction of expression as a catalyst, reacting at 300-500 rpm (preferably 400 rpm) and 15-20° C. for at least 8 hours in a reaction system consisting of a potassium phosphate buffer solution with a pH of 5.8-6.8 (preferably 6.75) using ferulic acid as a substrate, and obtaining a reaction solution containing 4-vinylguaiacol after completion of the reaction; and separating and purifying the reaction solution to obtain 4-vinylguaiacol.

[0023] The potassium phosphate buffer solution system is a 7.5 aqueous solution composed of 1M dimethyl phosphate and potassium dihydrogen phosphate. After adding the substrate, the pH is 6.75 at a ratio of substrate concentration to buffer solution concentration of 3 / 5. The pH of the reaction system of the present invention can be controlled at 6.75 using the buffer solution, or by continuously adjusting the pH to stabilize the reaction system at 6.75.

[0024] Preferably, the catalyst is used in an amount such that the OD600 of the wet bacteria in the reaction solution is 20, and the initial concentration of the substrate is 400-800 mM (preferably 600 mM).

[0025] Preferably, the wet cells are prepared as follows: a recombinant engineered bacterium containing a gene encoding a mutant of phenolic acid decarboxylase is inoculated into a liquid LB medium containing ampicillin sodium at a final concentration of 100 ug / mL, and cultured at 37°C for 8 hours to obtain a seed solution; the seed solution is inoculated into a sterilized TB medium containing ampicillin at a final concentration of 100 ug / L at an inoculum concentration of 2% by volume, and cultured at 37°C for about 8-12 hours. When the OD600 of the cells reaches 0.6, isopropylthio-β-D-galactoside (IPTG) is added to the culture medium at a final concentration of 0.1-1.0 mM (preferably 0.5 mM), and expression is induced at 18°C ​​for 16-24 hours, followed by centrifugation at 4°C and 4000 rpm for 10-20 minutes, and the wet cells are resuspended in a reaction buffer;

[0026] The phenolic acid decarboxylase mutants described herein can be used for catalysis in the form of whole cells, as a crude enzyme solution obtained by cell disruption, or as pure, completely disrupted enzyme. Furthermore, the phenolic acid decarboxylase can be prepared as an immobilized enzyme or as immobilized cells using specific immobilization techniques.

[0027] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: (1) the phenolic acid decarboxylase mutant is modified by site-directed mutagenesis based on the phenolic acid decarboxylase amino acid shown in SEQ ID NO.1, thereby changing the amino acid sequence and realizing changes in protein structure and function, and obtaining a phenolic acid decarboxylase mutant with the above mutation, the enzyme activity is improved, and the catalytic activity for ferulic acid is greatly improved compared with the original enzyme; (2) the mutant I40V / I92T / V131L, the obtained phenolic acid decarboxylase mutant can catalyze the substrate ferulic acid under normal temperature conditions in an aqueous phase, and the yield reaches 69.4% after 10 hours of reaction under the conditions of OD600=20 and substrate concentration of 600mM, which is 5.61 times that of the parent enzyme; (3) the phenolic acid decarboxylase mutant has high enzyme activity and is used to catalyze the synthesis of 4-vinylguaiacol from ferulic acid, the production process is simple, the reaction conditions are mild, and the production process is environmentally friendly, which is more conducive to industrial production. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 OD at different temperatures 600 =20 for the conversion of 600 mM ferulic acid by the whole-cell catalyst of mutant I40V / I92T / V131L of Example 3;

[0029] Figure 2 OD at different pH 600 =20 for the conversion of 600 mM ferulic acid by the whole-cell catalyst of mutant I40V / I92T / V131L of Example 3;

[0030] Figure 3 For OD600 =20, the original 2GC9 strain, Example 1 mutant I40V, Example 2 mutant I40V / I92T, Example 3 mutant I40V / I92V, Example 4 mutant I40V / I92T / V131L whole cell catalyst conversion of 600 mM ferulic acid. DETAILED DESCRIPTION

[0031] The technical solution of the present invention will be further described below in conjunction with embodiments.

[0032] Example 1

[0033] The phenolic acid decarboxylase mutant of the present invention is the phenolic acid decarboxylase mutant I40V of the sequence shown in SEQ ID No. 2, wherein the isoleucine at position 40 of the original phenolic acid decarboxylase sequence shown in SEQ ID No. 1 is mutated to valine (I40V);

[0034] The preparation method of mutant I40V is as follows:

[0035] 1. Construction of recombinant plasmid

[0036] Plasmids pET-22b(+) and E. coli BL21(DE3) were both deposited by the applicant and obtained from commercial sources. The wild-type gene of phenolic acid decarboxylase from Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1) was synthesized by Jinweizhi (Suzhou) Co., Ltd. Site-directed mutagenesis of this enzyme was performed by PCR and constructed by the applicant. The primers used to introduce the mutation sites are shown in Table 1. The template for the point mutation PCR was the pET-22b(+) plasmid containing the wild-type gene sequence of phenolic acid decarboxylase.

[0037] Table 1 Primers for mutant gene fragments and linearized plasmids

[0038]

[0039]

[0040] Note: The underlined markers in the primers are mutation sites, “F” represents the upstream primer, and “R” represents the downstream primer.

[0041] Table 2 PCR reaction system

[0042]

[0043] Table 3 PCR reaction conditions

[0044]

[0045] After verification by nucleic acid electrophoresis, the PCR product was purified using a DNA gel recovery kit. A reaction system was prepared as shown in Table 4, where the mutant gene fragment was a gene fragment in which the isoleucine at position 40 was mutated to valine, and the linearized plasmid was a linearized plasmid containing the gene fragment in which the isoleucine at position 40 was mutated to valine. The reaction was incubated at 37°C for 1 hour for one-step cloning to construct an expression plasmid for the mutant enzyme. The gene sequence of the mutant enzyme is shown in SEQ ID No. 2.

[0046] Table 4 One-step cloning system

[0047]

[0048] 2. Construction of recombinant strains and preparation of crude enzyme solution

[0049] The recombinant plasmid was transformed into E. coli DH5α competent cells, plated onto the surface of LB solid medium containing 100 μg / mL ampicillin, and incubated at 37°C for 12 hours. Any single colonies growing on the surface of the plate were scraped into a test tube containing 5 mL of LB liquid medium containing 100 μg / mL ampicillin and incubated at 37°C with shaking at 200 rpm for 12 hours. The plasmid was extracted using a plasmid extraction kit and stored at -20°C. The gene sequence of the mutant is shown in SEQ ID No. 7.

[0050] The recombinant plasmid was transformed into the E. coli BL21(DE3) host strain and spread onto the surface of LB solid medium containing 100 μg / mL ampicillin and incubated at 37°C for 8 hours. A single E. coli colony was selected and inoculated into 3 mL of LB liquid medium containing 100 μg / mL ampicillin and incubated overnight at 37°C to serve as the seed solution. The seed solution was inoculated at a 5% inoculum into a 250 mL Erlenmeyer flask containing 50 mL of TB medium and incubated at 37°C and 200 rpm. TB liquid medium consisted of 12 g / L yeast extract, 12 g / L tryptone, 4 ml / L glycerol, 12.5 g / L potassium dihydrogen phosphate, and 2.3 g / L potassium dihydrogen phosphate. After 8 hours of incubation, IPTG was added to a final concentration of 0.5 mM, the incubation temperature was set to 18°C, and incubation continued for 16 hours. The fermentation broth was centrifuged, the bacterial cells were collected, and resuspended in 1 M phosphate buffer at pH 7.5 to serve as the whole-cell catalyst of mutant I40V.

[0051] Example 2

[0052] The phenolic acid decarboxylase mutant of the present invention is the phenolic acid decarboxylase mutant I40V / I92T of the sequence shown in SEQ ID No. 3. In this mutant, the isoleucine at position 40 of the original phenolic acid decarboxylase sequence shown in SEQ ID No. 1 is mutated to valine (I40V) and the isoleucine at position 92 is mutated to threonine (I92T).

[0053] The preparation method of the mutant I40V / I92T is as follows:

[0054] The rest is the same as Example 1, except that the PCR template is the mutant of I40V in Example 1, and the mutant gene primers are as follows:

[0055] Table 5 Primers for mutant gene fragments and linearized plasmids

[0056]

[0057] Example 3

[0058] The phenolic acid decarboxylase mutant of the present invention is a phenolic acid decarboxylase mutant I40V / I92V having a sequence as shown in SEQ ID No. 4. In this mutant, the isoleucine at position 40 of the original phenolic acid decarboxylase sequence as shown in SEQ ID No. 1 is mutated to valine (I40V) and the isoleucine at position 92 is mutated to valine (I92V).

[0059] The preparation method of mutant I40V / I92V is as follows:

[0060] The rest is the same as Example 1, except that the PCR template is the mutant of I40V in Example 1, and the mutant gene primers are as follows:

[0061] Table 6 Mutant gene fragment primers and linearized plasmid primers

[0062]

[0063]

[0064] Example 4

[0065] The phenolic acid decarboxylase mutant of the present invention is, for example, the phenolic acid decarboxylase mutant I40V / I92T / V131L of the sequence shown in SEQ ID No. 5. In this mutant, the isoleucine at position 40 of the amino acid sequence shown in SEQ ID. 1 is mutated to valine (I40V), the isoleucine at position 92 is mutated to threonine (I92T), and the valine at position 131 is mutated to leucine (V131L).

[0066] The preparation method of the mutant I40V / I92T / V131L is as follows:

[0067] The rest is the same as Example 1, except that the PCR template is the I40V / I92T mutant of Example 2, and the mutant gene primers are as follows:

[0068] Table 7 Mutant gene fragment primers and linearized plasmid primers

[0069]

[0070] The recombinant engineered bacteria containing the gene encoding the phenolic acid decarboxylase I40V / I92T / V131L mutant were inoculated into liquid LB medium containing ampicillin sodium at a final concentration of 100 μg / mL and cultured at 37°C for 8 hours to obtain a seed solution. The seed solution was inoculated into sterilized TB medium containing ampicillin at a final concentration of 100 μg / L at an inoculum concentration of 2% by volume and cultured at 37°C for 12 hours. When the OD600 of the bacteria reached 0.6, isopropylthio-β-D-galactopyranoside (IPTG) was added to the culture medium at a final concentration of 0.5 mM. After inducing expression at 18°C ​​for 16 hours, the culture was centrifuged at 4°C and 4000 rpm for 10 minutes, and the wet bacteria were resuspended in the reaction buffer to prepare a whole-cell catalyst.

[0071] Example 5 Catalytic Performance Test

[0072] 1. Catalytic performance test of the phenolic acid decarboxylase mutant enzyme I40V / I92T / V131L prepared in Example 4

[0073] The phenolic acid decarboxylase mutant enzyme I40V / I92T / V131L whole cell catalyst prepared in Example 4 was used to determine the yield of the phenolic acid decarboxylase at different temperatures.

[0074] The recombinant wet bacteria containing the phenolic acid decarboxylase mutant I40V / I92T / V131L encoding gene obtained in Example 4 were used as catalysts. 600 = 20, the substrate ferulic acid concentration was 600 mM, and the reaction system consisted of potassium phosphate buffer solution with a pH of 6.75. The reaction was carried out at 400 rpm at 10°C, 15°C, 20°C, 25°C, 30°C, and 35°C overnight (>8 h). After the reaction, a reaction solution containing 4-vinylguaiacol was obtained. After the reaction, 500 μL of the reaction solution was extracted with 500 μL of ethyl acetate, followed by centrifugation at 1,2000 rpm for 1 min. 300 μL of the supernatant was collected and analyzed by gas chromatography.

[0075] Gas chromatography conditions: Agilent HP-5 column, GC program: 60°C for 2 min, 55°C / min to 250°C, 45°C / min to 300°C for 2 min. 4-Vinylguaiacol retention time = 3.40 min.

[0076] The test results are as follows Figure 1 As shown, the enzyme has good catalytic efficiency in the range of 15-20℃.

[0077] 2. Determination of the enzyme activity of the phenolic acid decarboxylase mutant prepared in Example 4 under different pH conditions

[0078] The recombinant wet bacteria containing the phenolic acid decarboxylase mutant I40V / I92T / V131L encoding gene obtained in Example 4 were used as catalysts. 600 = 20, the substrate ferulic acid concentration was 600 mM, and the reaction system consisted of potassium phosphate buffer solutions with pH values ​​of 5.25, 5.75, 6.25, 6.75, and 7.75, respectively. The reaction was carried out at 400 rpm at 15°C overnight (>8 h). After the reaction, a reaction solution containing 4-vinylguaiacol was obtained. After the reaction, 500 μL of the reaction solution was extracted with 500 μL of ethyl acetate and then centrifuged at 1,2000 rpm for 1 min. 300 μL of the supernatant was collected and analyzed by gas chromatography under the same gas chromatography detection conditions as above.

[0079] The test results are as follows Figure 2 The enzyme has a better catalytic efficiency in the pH range of 5.75 to 6.75.

[0080] 3. Phenolic acid decarboxylase mutant enzyme performance test

[0081] The original enzyme 2GC9 strain of phenolic acid decarboxylase and the mutant I40V of Example 1, the mutant I40V / I92T of Example 2, the mutant I40V / I92V of Example 3, and the mutant I40V / I92T / V131L of Example 4 were catalyzed under whole cell conditions. 600 =20, substrate concentration of 600mM, Ph of 6.75, and temperature of 15°C were used to test and compare the catalytic efficiency of ferulic acid.

[0082] The results showed that the catalytic efficiency of the mutant I40V / I92T / V131L was 4 to 5 times higher than that of the original strain. Under the condition of 600 mM substrate, it could catalyze the production of 425 mM vanillin, and has extremely high industrial application prospects.

Claims

1. A phenolic acid decarboxylase mutant, characterized in that: The amino acid sequence of the mutant is any one of the sequences shown in SEQ ID No. 2 to 5.

2. A gene encoding the phenolic acid decarboxylase mutant according to claim 1.

3. The gene encoding a phenolic acid decarboxylase mutant according to claim 2, characterized in that: The nucleotide sequence of the gene is any one of the sequences shown in SEQ ID No. 7 to 10.

4. A cloning vector containing the gene according to claim 2.

5. An expression vector containing the gene according to claim 2.

6. The method for preparing a phenolic acid decarboxylase mutant according to claim 1, wherein: The steps include: (1) Designing point mutation primers, using the plasmid carrying the wild-type gene of phenolic acid decarboxylase SEQ ID No. 6 as a template, and using the point mutation primers to perform PCR reactions, respectively. After purification, the mutant gene fragment and the linearized plasmid were obtained; (2) Connect the mutant gene fragment to the linearized plasmid to construct an expression vector, and then transfer the expression vector into the host bacteria for induced expression; (3) Collecting the host bacteria expressing the phenolic acid decarboxylase mutant, resuspending the bacteria and breaking the cells, and centrifuging and collecting the supernatant to obtain the crude enzyme solution containing the phenolic acid decarboxylase mutant; The point mutation primers are: I40V_F gattatcgc GTT catggcggcatggtggcgggccgc; I40V_R gccgccatg AAC gcgataatccacggtatgatcgtttttc; I92T_F CATGGCACC ACT TTTTTTCCG; <h2 style=";text-align:left;direction:ltr">I92T_R CGGAAAAAA<h2 style=";text-align:left;direction:ltr"> AGT <h2 style=";text-align:left;direction:ltr"> GGTGCCATG; V131L_F GAAACTGGTG CTG CCGGAATTTG; V131L_R CAAATTCCGG CAG CACCAGTTTC; I92V_F ctgcatggcacc GTT ttttttccgaaatgggtggaagaacatc; I92V_R ggaaaaaa AAC ggtgccatgcagttttttttcgttcggcataaaatc。 7. The method for preparing a phenolic acid decarboxylase mutant according to claim 6, wherein: The PCR reaction system was as follows: 10× Buffer for KOD-Plus- 2.5 μL, 2 mM dNTP 2.5 μL, 25 mM MgSO4 1.5 μL, DMSO 1 μL, 10 pmol / μL Forward Primer 0.75 μL, 10 pmol / μL Reverse Primer 0.75 μL, DNA template 50-100 ng, KOD-Plus- 1 μL, and ddH2O up to 25 μL.

8. Use of the phenolic acid decarboxylase mutant according to claim 1 in catalyzing the preparation of 4-vinylguaiacol.

9. The use according to claim 8, characterized in that The application method comprises the following steps: using wet cells of recombinant engineering bacteria containing a gene encoding a phenolic acid decarboxylase mutant after induction as a catalyst, reacting at 15-20° C. for at least 8 hours in a reaction system consisting of a potassium phosphate buffer solution with a pH of 5.8-6.8 and using ferulic acid as a substrate; obtaining a reaction solution containing 4-vinylguaiacol after the reaction is completed; and separating and purifying the reaction solution to obtain 4-vinylguaiacol.

Images