A rubber tree transcription factor HbMAX2, cloning method and application
By cloning and verifying the rubber tree transcription factor HbMAX2 gene, constructing recombinant vectors and host bacteria, and improving the yeast's ability to resist oxidative stress, the impact of abiotic stress on rubber tree growth was resolved, providing a new method for stress resistance research and breeding.
Patent Information
- Application Number
- CN202410880502.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-02
- Publication Date
- 2025-10-03
- Estimated Expiration
- 2044-07-02
AI Technical Summary
Existing technologies have failed to effectively address the impact of abiotic stress on the growth and production of rubber trees, and lack the cloning and application of stress-resistant functional genes, which affects the comprehensive development and utilization of rubber trees.
The rubber tree transcription factor HbMAX2 gene was cloned and verified, and by constructing a recombinant vector and host bacteria, the yeast's antioxidant stress resistance was improved, demonstrating its regulatory function under abiotic stress.
The HbMAX2 gene significantly improved the ability to resist oxidative stress in yeast, provided a candidate gene for stress resistance research, and offered a new approach for genetic improvement and breeding of rubber trees, indicating its important role in the synthesis of rubber tree latex.
Smart Images

Figure CN118726394B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the biological field, and particularly relates to a rubber tree transcription factor HbMAX2, a cloning method and an application. Background Art
[0002] Natural rubber is an elastic material with excellent comprehensive properties. It has plasticity that resists bending, good insulation, airtightness that is water- and gas-proof, tensile strength, and tough wear resistance. It is widely used in industry, national defense, transportation, people's livelihood, medicine, health, and other fields. It is an important industrial raw material and strategic resource.
[0003] As the application of rubber becomes more and more extensive, its molecular biology research has also been continuously deepened and developed, and gene expression analysis has also been gradually applied to reveal the mechanism of gene expression and regulation in rubber trees. Therefore, the location, cloning, and function of important trait genes in rubber trees are of great significance for the comprehensive development and utilization of rubber trees. Abiotic stress seriously affects the normal growth and production of rubber trees and is a key issue that urgently needs to be addressed in the rubber tree industry.
[0004] Therefore, exploring rubber tree genes with stress resistance and further verifying their regulatory functions under abiotic stress are of great significance for in-depth research on rubber tree genetic improvement and breeding. Summary of the Invention
[0005] The purpose of the present invention is to overcome the deficiencies in the prior art and provide a rubber tree transcription factor HbMAX2, a cloning method and an application.
[0006] The first aspect of the present invention is to provide a rubber tree HbMAX2 gene, the nucleotide sequence of which is shown in SEQ ID NO: 1.
[0007] The second aspect of the present invention is to provide a rubber tree transcription factor HbMAX2, which is a protein encoded by the rubber tree HbMAX2 gene described in the first aspect of the present invention.
[0008] The third aspect of the present invention is to provide the use of the rubber tree HbMAX2 gene as described in the first aspect of the present invention, or the rubber tree transcription factor HbMAX2 as described in the second aspect of the present invention, in improving the ability of yeast to resist oxidative stress.
[0009] The fourth aspect of the present invention is to provide the use of the rubber tree HbMAX2 gene as described in the first aspect of the present invention, or the rubber tree transcription factor HbMAX2 as described in the second aspect of the present invention, in improving the ability of yeast to resist H2O2 stress.
[0010] The fifth aspect of the present invention is to provide a recombinant vector or host bacteria containing the rubber tree HbMAX2 gene coding region described in the first aspect of the present invention.
[0011] The original vector of the recombinant vector can be a vector commonly used in the field of gene recombination, such as a virus, a plasmid, etc. The present invention is not limited to this. In a specific embodiment of the present invention, the original vector adopts a vector plasmid such as 35S:GFP, pYES2, etc., but it should be understood that other plasmids or viruses can also be used in the present invention.
[0012] The sixth aspect of the present invention is to provide use of the recombinant vector or host bacteria according to the fifth aspect of the present invention in improving the ability of yeast to resist oxidative stress.
[0013] The seventh aspect of the present invention is to provide the use of the recombinant vector or host bacteria as described in the fifth aspect of the present invention in improving the ability of yeast to resist H2O2 stress.
[0014] The eighth aspect of the present invention is to provide a method for cloning the rubber tree HbMAX2 gene described in the first aspect of the present invention: extracting total RNA from rubber tree leaves, reverse transcribing it into cDNA, using the first chain of cDNA as a template, and using HbMAX2-F: ATGGCCGTTCCAACCACC; HbMAX2-R: TCAGTCGAGAATATGGCGGC as primers, performing PCR amplification, and recovering the amplified product to obtain.
[0015] The ninth aspect of the present invention is to provide a primer pair, wherein the primer pair is HbMAX2-F: ATGGCCGTTCCAACCACC; HbMAX2-R: TCAGTCGAGAATATGGCGGC; or the primer pair is qHbMAX2-F: TGGAGTCGCAGCTTGATGG; qHbMAX2-R: AGAGTCTTGTGAAGCAAACAAGCC; or the primer pair is HbMAX2-GFP-F: gtcgacggtatcgataagcttATGGCCGTTCCAACCACC; HbMAX2-GFP-R: tttactcatactagtggatccGTCGAGAATATGGCGGCTGT; the primer pair is HbMAX2-pYES2-F: actatagggaatattaagcttATGGCCGTTCCAACCACC; HbMAX2-pYES2-R: ccctctagatgcatgctcgagGTCGAGAATATGGCGGCTGT.
[0016] The present invention clones and obtains the rubber tree HbMAX2 gene from rubber tree for the first time. The gene subcellular localization is in the nucleus. It is expressed in all tissues of rubber tree. The expression levels in flowers and leaves are significantly higher than those in other tissues. Moreover, the expression level in high-yield germplasm of rubber tree is higher than that in low-yield germplasm. It is illustrated that HbMAX2 may be involved in the latex synthesis process of rubber tree. Further research shows that the gene can improve the viability of yeast under oxidative stress, and the regulatory function of the gene on abiotic stress has been illustrated. The present invention provides new candidate genes for improving the research on aspects such as yeast and plant stress resistance, which is of great significance to in-depth study of rubber tree genetic improvement breeding. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] Figure 1 This is the nucleotide sequence of the HbMAX2 gene of rubber tree.
[0018] Figure 2 The expression of HbMAX2 gene in high-yield and low-yield germplasm of rubber tree.
[0019] Figure 3 The expression of HbMAX2 gene in different tissues of rubber tree.
[0020] Figure 4 This is the subcellular localization result of HbMAX2 gene in rubber tree.
[0021] Figure 5 is the OD600 value of transgenic yeast under H2O2 stress.
[0022] Figure 6 This is the growth status of recombinant plasmid yeast under oxidative stress conditions. DETAILED DESCRIPTION
[0023] The present invention will be further described below with reference to the accompanying drawings and in conjunction with specific embodiments to better understand the present invention. Where specific techniques or conditions are not specified in the examples, the methods are based on those described in the literature in this field or on the product specifications. Where the manufacturer of the reagents or instruments is not specified, they are all commercially available conventional products.
[0024] Example 1: Cloning of the HbMAX2 gene sequence
[0025] use TRIeasy TM Total RNA was extracted from leaves of the main rubber tree cultivar '73397' using the Plus Total RNA Kit (Yisheng, Shanghai, China). The cDNA was reverse transcribed into cDNA using the 1st Strand cDNA Synthesis Kit (Yisheng, Shanghai, China). The first strand of cDNA was used as a template, HbMAX2-F: ATGGCCGTTCCAACCACC; HbMAX2-R: TCAGTCGAGAATATGGCGGC were used as primers, and Hieff Gene amplification was performed using AdvanceFast PCR Master Mix (Yisheng, Shanghai, China). The high-fidelity PCR system was as follows: AdvanceFast PCR Master Mix, 25 μL; HbMAX2-F, 2 μL; HbMAX2-R, 2 μL; cDNA, 1 μL; ddH2O, 20 μL. The PCR reaction procedure was as follows:
[0026]
[0027] After the PCR reaction, the target band was detected by 1.5% agarose gel electrophoresis and the The PCR Purification Kit (Yisheng, Shanghai, China) was used for purification and recovery. The recovered product and the intermediate cloning vector were selected from Hieff The cells were ligated and transformed into competent E. coli (Yisheng, Shanghai, China) using the Universal Zero TOPO TA / Blunt Cloning Kit (Yisheng, Shanghai, China). After 12 hours of inverted culture, single clones were picked for PCR detection. Positive clones were sent to Qingke Biotechnology Co., Ltd. for sequencing. Single clones with correct sequences were glycerol-filtrated and plasmids were extracted and labeled with HbMAX2-Blunt plasmids. The nucleotide sequence of the rubber tree HbMAX2 was obtained as SEQ ID NO: 1 and Figure 1 As shown, the full length of the sequence is 2106 bp.
[0028] Example 2: Expression patterns of HbMAX2 in different tissues and germplasms
[0029] Based on the HbMAX2 sequence, fluorescent quantitative primers qHbMAX2-F: TGGAGTCGCAGCTTGATGG; qHb MAX2-R: AGAGTCTTGTGAAGCAAACAAGCC were designed. Real-time fluorescent quantitative analysis of HbMAX2 expression in rubber tree latex, branches, flowers, leaves, stems, and roots, as well as in high- and low-yielding rubber tree germplasms '73397', 'PR107', and '72059', was performed. RNA extraction and reverse transcription were performed as in Example 1. Fluorescent quantitative reagents The qPCR SYBR Green Master Mix (Yisheng, Shanghai, China) reaction system is as follows:
[0030]
[0031] The configured system was operated on a CFX96 Touch (Bio-Rad, Germany) fluorescence quantitative PCR instrument according to the following procedures:
[0032]
[0033] HbActin (HQ260674.1) was set as the internal reference gene, and each experiment was repeated three times. The final results were referred to 2 -ΔΔCt The relative expression level of HbMAX2 gene was calculated by qHbActin-F: 5′-GATGTGGATATCAGGAAGGA-3′, qHbActin-R: 5′-CATACTGCTTGGAGCAAGA-3′. The results showed that the expression level of HbMAX2 in high-yield rubber tree germplasm was higher than that in low-yield rubber tree germplasm, indicating that HbMAX2 may be involved in the latex synthesis process of rubber tree ( Figure 2 Tissue localization results showed that HbMAX2 was expressed in all tissues, with the expression levels in flowers and leaves being significantly higher than those in other tissues ( Figure 3 ).
[0034] Example 3: Subcellular localization of HbMAX2
[0035] Using the HbMAX2-Blunt plasmid as a template, the homologous recombination primers HbMAX2-GFP-F: gtcgacggtatcgataagcttATGGCCGTTCCAACCACC; HbMAX2-GFP-R: tttactcatactagtggatccGTCGAGAATATGGCGGCTGT were designed according to the 35S:GFP vector sequence, and high-fidelity PCR amplification was performed using the same steps as in Example 1. The amplified and recovered products were combined with 35S:GFP using the homologous recombination enzyme Hieff Homologous recombination was performed using the Universal One Step Cloning Kit (Yisheng, Shanghai, China) to generate the recombinant plasmid HbMAX2-GFP. Competent Escherichia coli was transformed, and single clones were selected for PCR testing. Positive clones were selected for sequencing. Correctly sequenced single clones were stored in glycerol stock, and the recombinant plasmid HbMAX2-GFP was extracted and transformed into competent Agrobacterium GV3101. Approximately one month after the cultivation of Nicotiana benthamiana, healthy plants were selected and injected with HbMAX2-GFP Agrobacterium and empty control Agrobacterium into the epidermal cells. After 12 hours of dark treatment and 3 days of normal incubation, subcellular localization was observed under a laser confocal microscope (Zeiss, Germany). The results showed that HbMAX2 was localized in the cell nucleus ( Figure 4 ).
[0036] Example 4: HbMAX2 transfection in yeast for antioxidant stress verification
[0037] Using the HbMAX2-Blunt plasmid as a template, homologous recombination primers HbMAX2-pYES2-F: actatagggaatattaagcttATGGCCGTTCCAACCACC; HbMAX2-pYES2-R: ccctctagatgcatgctcgagGTCGAGAATATGGCGGCTGT were designed according to the pYES2 vector sequence, and PCR amplification was performed using the same method as in Example 1. The amplified and recovered products were then cleaved with the homologous recombination enzyme Hieff Universal One Step Cloning Kit (Yisun, Shanghai, China) was used for homologous recombination to obtain the HbMAX2-pYES2 recombinant plasmid. Two methods were used to analyze the resistance function of HbMAX2 to oxidative stress.
[0038] (1) The HbMAX2-pYES2 recombinant plasmid and the pYES2 empty vector plasmid were transformed into the yeast competent INSCV1 (Weidi, Shanghai, China). Single colonies were picked and cultured in liquid induction medium for 1 day. The cells were collected by centrifuge at 4000 rpm for 5 minutes. The supernatant was discarded and the cells were resuspended in liquid medium and liquid induction medium containing 3mM H2O2 to OD600 = 0.2. 10 ml of the bacterial solution was separated and placed in a 50 ml centrifuge tube. After further culture for 2 days, the OD600 value of each tube was measured. Each experiment was repeated three times. The experimental groups were as follows:
[0039] pYES2 group: yeast transformed with the pYES2 empty plasmid were cultured in normal liquid induction medium;
[0040] HbMAX2 group: yeast transformed with HbMAX2-pYES2 recombinant plasmid were cultured in normal induction liquid medium;
[0041] H2O2-pYES group: yeast transformed with the pYES2 empty plasmid were cultured in liquid induction medium containing 3 mM H2O2;
[0042] H2O2-HbMAX2 group: Yeast transformed with HbMAX2-pYES2 recombinant plasmid was cultured in liquid induction medium containing 3 mM H2O2.
[0043] The results showed that the OD600 values of the recombinant plasmid and the empty plasmid were consistent under no-stress conditions, while the OD600 value of the recombinant plasmid was higher than that of the empty plasmid under oxidative stress conditions, indicating that HbMAX2 has antioxidant function ( Figure 5 and Table 1 ).
[0044] Table 1
[0045] deal with Repeat 1 Repeat 2 Repeat 3 average value pYES2 1.503 1.479 1.518 1.500 HbMAX2 1.648 1.542 1.435 1.542 <![CDATA[H2O2-pYES2]]> 1.032 1.058 1.124 1.071 <![CDATA[H2O2-HbMAX2]]> 1.477 1.428 1.433 1.446
[0046] (2) The recombinant plasmids and empty plasmids transformed into competent yeast were selected and cultured in liquid selective medium for 1 day. The centrifuge was set at 4000 rpm for 5 minutes to collect the bacteria. The bacteria were reselected to OD600 = 0.5 using sterile ultrapure water and 3mM H2O2 solution. 1 ml was taken out and cultured for 1 day. After that, the OD600 of each tube was adjusted to 1. The original bacterial solution was used as the initial concentration for 5-fold dilution. 5 μl of each concentration gradient was aspirated and spotted on a yeast single-deficient culture plate. Each experiment was repeated three times. The experimental groups were as follows:
[0047] pYES2 group: yeast transformed with the pYES2 empty plasmid were cultured in normal liquid selection medium;
[0048] HbMAX2 group: yeast transformed with HbMAX2-pYES2 recombinant plasmid were cultured in normal selection liquid medium;
[0049] H2O2-pYES group: yeast transformed with the pYES2 empty plasmid were cultured in liquid selection medium containing 3 mM H2O2;
[0050] H2O2-HbMAX2 group: Yeast transformed with HbMAX2-pYES2 recombinant plasmid was cultured in liquid selection medium containing 3 mM H2O2.
[0051] After two days of inverted culture, the yeast growth was observed. The results showed that the growth of recombinant plasmid and empty plasmid yeast was the same under normal growth conditions, while the growth of recombinant plasmid yeast was better than that of empty plasmid yeast under oxidative stress conditions, which once again demonstrated that HbMAX2 has the function of resisting oxidative stress ( Figure 6 ).
[0052] The above detailed description of the specific embodiments of the present invention is intended only as an example, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions made to the practical embodiments are also within the scope of the present invention. Therefore, any equivalent changes and modifications made without departing from the spirit and scope of the present invention should be included within the scope of the present invention.
Claims
1. Application of the rubber tree HbMAX2 gene or the rubber tree transcription factor HbMAX2 in improving the ability of yeast to resist oxidative stress, wherein the nucleotide sequence of the rubber tree HbMAX2 gene is shown in SEQ ID NO: 1, and the rubber tree transcription factor HbMAX2 is a protein encoded by the rubber tree HbMAX2 gene.
2. Application of the rubber tree HbMAX2 gene or the rubber tree transcription factor HbMAX2 in improving the ability of yeast to resist H2O2 stress; the nucleotide sequence of the rubber tree HbMAX2 gene is shown in SEQ ID NO: 1, and the rubber tree transcription factor HbMAX2 is a protein encoded by the rubber tree HbMAX2 gene.
3. Use of a recombinant vector or host bacteria containing the coding region of the rubber tree HbMAX2 gene in improving the ability of yeast to resist oxidative stress, wherein the nucleotide sequence of the rubber tree HbMAX2 gene is shown in SEQ ID NO:
1.
4. Use of a recombinant vector or host bacteria containing the coding region of the rubber tree HbMAX2 gene in improving the ability of yeast to resist H2O2 stress, wherein the nucleotide sequence of the rubber tree HbMAX2 gene is shown in SEQ ID NO: 1.