GhFAR3 Gene and Its Application in Regulating Verticillium Wilt Resistance of Cotton
By silencing the cotton GhFAR3 gene to regulate its resistance to verticillin wort, the problem of slow progress in cotton disease resistance breeding was solved, and the effect of rapid screening of high disease resistance cotton strains was achieved.
Patent Information
- Application Number
- CN202411061467.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-05
- Publication Date
- 2025-08-05
- Estimated Expiration
- 2044-08-05
AI Technical Summary
In the prior art, cotton resistant verinary wilt breeding progresses slowly, lacks effective disease-resistant gene resources and traditional breeding methods for a long period of time, making it difficult to quickly cultivate disease-resistant cotton varieties with excellent agronomic traits.
The GhFAR3 gene in cotton was silenced by VIGS method, and it was found that it positively regulates the resistance of cotton to verticillium wort. By regulating the expression level of the GhFAR3 gene, cotton strains with high disease resistance were screened.
It significantly improves the resistance of cotton to verticillium wort, provides theoretical support and methods for cotton disease-resistant breeding, and can quickly screen out high disease-resistant cotton strains.
Smart Images

Figure CN118726414B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of agricultural biotechnology, and particularly relates to the GhFAR3 gene and its application in regulating cotton resistance to Verticillium wilt. Background Art
[0002] At present, the most serious disease threatening cotton production in China is cotton Verticillium wilt caused by the soil filamentous fungus Verticillium dahliae, which is also known as the "cancer" of cotton. Breeding and popularizing new disease-resistant varieties is the most economical and effective measure to control cotton Verticillium wilt. Although breeders have selected a number of cotton varieties with strong resistance to Verticillium wilt and excellent comprehensive traits through conventional breeding methods, due to the lack of Verticillium wilt resistance sources, the rapid variation of Verticillium dahliae, and the long cycle of traditional breeding methods, the progress of cotton breeding for Verticillium wilt resistance has been slow. Using genetic engineering technology to improve crop varieties can quickly cultivate new varieties with excellent agronomic traits. With the rapid development of cotton molecular biology and biotechnology, the conditions for carrying out cotton disease-resistant molecular breeding using modern genetic engineering technology have become mature. Therefore, conducting research on the molecular mechanism of cotton resistance to Verticillium wilt and excavating and identifying key disease-resistant genes are of great significance for improving the resistance of upland cotton to Verticillium wilt by means of genetic engineering.
[0003] Fatty acyl-CoA reductase (FAR) genes usually exist in the form of gene families. Currently, 8 members of the FAR family have been identified in Arabidopsis thaliana. Among them, AtFAR1, AtFAR4, and AtFAR5 are highly expressed in the root endodermal cells, and their expression patterns induced by wounding and stress are highly consistent with the deposition of suberin. Mutant experiments have found that AtFAR1, AtFAR4, and AtFAR5 are respectively involved in the synthesis of C22, C20, and C18 fatty alcohols in the roots of Arabidopsis thaliana (Domergue et al. 2010). Other FAR family members do not participate in suberin synthesis. For example, AtFAR2 (AtMS2) is an important gene controlling the synthesis of the pollen exine, located in the plastid, and participates in the formation of the pollen wall tapetum by catalyzing the conversion of C16:0-ACP to C16:0 fatty alcohol; the deletion of this gene will cause abnormal development of the pollen wall, resulting in a sterile phenotype in Arabidopsis thaliana (Chen et al. 2011). AtFAR3 mainly participates in the biosynthesis of C24 and C26 primary fatty alcohols in Saccharomyces cerevisiae (Rowland and Domergue 2012). In wheat, the functional research on FAR genes mainly focuses on wax synthesis, because epidermal wax is an important trait for wheat stress resistance selection. Wang et al. (2016a) identified 32 FAR genes in wheat, among which 9 were highly expressed in seedling leaves; 9 were highly expressed in flag leaves; 14 were highly expressed in both seedling leaves and flag leaves.
[0004] That is, the functions of FAR family genes vary greatly. It is necessary to further explore and study the FAR genes in cotton to deepen the understanding of the resistance mechanism of cotton to Verticillium wilt, so as to breed new disease-resistant varieties. Summary of the Invention
[0005] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a gene GhFAR3 that positively regulates cotton resistance to Verticillium wilt and its application. The inventors creatively found that when the GhFAR3 gene in cotton is silenced by the VIGS (virus-induced gene-silencing) method, cotton becomes more sensitive to viruses such as Verticillium wilt, that is, the GhFAR3 gene positively regulates cotton resistance to Verticillium wilt pathogens, providing potential applications of the GhFAR3 gene in cotton disease-resistant breeding; at the same time, the GhFAR3 gene can be used to infer the disease resistance of cotton lines, so as to screen cotton lines with high disease resistance.
[0006] The technical solution adopted by the present invention is:
[0007] A cotton gene GhFAR3 resistant to Verticillium wilt, the nucleotide sequence of the cotton gene GhFAR3 is as shown in SEQ ID NO:1.
[0008] An anti-verticillium wilt cotton regulatory protein GhFAR3, the amino acid sequence of the cotton regulatory protein GhFAR3 is shown in SEQ ID NO: 2.
[0009] Application of the GhFAR3 gene in regulating cotton resistance to verticillium wilt, the nucleotide sequence of the GhFAR3 gene is shown in SEQ ID NO: 1.
[0010] Application of the GhFAR3 protein in regulating cotton resistance to verticillium wilt, the amino acid sequence of the GhFAR3 protein is shown in SEQ ID NO: 2.
[0011] The meaning of "regulation" is low expression, non-expression or overexpression. Those skilled in the art can implement it according to needs by using the methods of modern genetic engineering technology to obtain different transgenic cottons to meet various commercial demands.
[0012] A method for preparing transgenic cotton, the method includes: making the expression level of the GhFAR3 gene or its active fragment in the target cotton show a difference from that of the wild type of the cotton to obtain the transgenic cotton.
[0013] Preferably, the method includes: making the GhFAR3 gene or its active fragment be lowly expressed or not expressed in the target cotton.
[0014] Preferably, the method includes: making the GhFAR3 gene or its active fragment be overexpressed in the target cotton.
[0015] A breeding method for anti-verticillium wilt cotton, the breeding method includes making the expression of the GhFAR3 gene in cotton show a difference to obtain anti-verticillium wilt cotton.
[0016] A transgenic cotton, the expression level of the GhFAR3 gene or its active fragment in the transgenic cotton is different from that of the wild type of the cotton.
[0017] A method for detecting cotton disease resistance, the detection method is to detect the expression level of the GhFAR3 gene in the target cotton.
[0018] Preferably, the detection method includes amplifying the GhFAR3 gene in the target cotton by using the method of PCR (Polymerase Chain Reaction, Chinese name is polymerase chain reaction).
[0019] Preferably, the primers used in PCR include the primers shown in SEQ ID NO: 3 and / or SEQ ID NO: 4.
[0020] Those skilled in the art can also design other primers by themselves to amplify the GhFAR3 gene, and detect the expression level of the obtained GhFAR3 gene. By comparing the data with that of the disease-susceptible cotton variety, its disease resistance can be speculated, and / or, cotton lines with high disease resistance can be screened.
[0021] The beneficial effects of the present invention are as follows:
[0022] The present invention discovers that the treatment with Verticillium dahliae can induce the significant expression of the GhFAR3 gene in disease-resistant cotton varieties, while the up-regulation of the gene expression lags or has no obvious change in disease-susceptible cotton varieties. Subsequent experiments confirm that the GhFAR3 gene plays a positive regulatory role in the process of resistance to Verticillium wilt, and the resistance to Verticillium wilt in the plants with the GhFAR3 gene silenced is significantly reduced, and the suberin content is significantly reduced. Therefore, the present invention not only provides important theoretical support for cotton disease-resistant breeding, but also provides a use of the GhFAR3 gene or its active fragment in the field of cotton resistance to Verticillium wilt.
[0023] Meanwhile, the GhFAR3 gene can be applied to speculate the disease resistance of cotton lines, so as to screen cotton lines with high disease resistance. BRIEF DESCRIPTION OF THE DRAWINGS
[0024] Figure 1 Phylogenetic tree analysis diagram of the GhFAR3 gene.
[0025] Figure 2 Multiple sequence alignment analysis of GhFAR3, and the red box is the conserved NAD domain. The result shows that GhFAR3 contains a typical NAD domain.
[0026] Figure 3 Analysis of the expression patterns of the FAR3 gene in roots, stems and leaves of different resistant and susceptible varieties of Gossypium barbadense and Gossypium hirsutum.
[0027] HR, HS, BR and BS respectively represent Zhongzhimian 2, a disease-resistant variety of Gossypium hirsutum, Junmian 1, a disease-susceptible variety of Gossypium hirsutum, Xinhai 45, a disease-resistant variety of Gossypium barbadense, and Q67, a disease-susceptible variety of Gossypium barbadense.
[0028] Figure 4 Analysis of the expression patterns of FAR3 in resistant and susceptible varieties of Gossypium barbadense and Gossypium hirsutum after inoculation with Verticillium dahliae. A is the analysis of the expression pattern of GhFAR3 in disease-resistant and disease-susceptible varieties of Gossypium hirsutum. B is the analysis of the expression pattern of GbFAR3 in disease-resistant and disease-susceptible varieties of Gossypium barbadense. HR, HS, BR and BS respectively represent Zhongzhimian 2, a disease-resistant variety of Gossypium hirsutum, Junmian 1, a disease-susceptible variety of Gossypium hirsutum, Xinhai 45, a disease-resistant variety of Gossypium barbadense, and Q67, a disease-susceptible variety of Gossypium barbadense.
[0029] Figure 5Etiolation phenotype after silencing of the GhCHLI gene in the disease-resistant upland cotton line Shidalukang-1.
[0030] Figure 6 Figure 3: FAR3 gene silencing reduces Verticillium wilt resistance in cotton (the resistant upland cotton line Shidalukang-1). Figure A shows phenotypic analysis of TRV:GhFAR3 and TRV:00 21 days after inoculation with Verticillium dahlia; Figure B shows the efficiency of GhFAR3 silencing in TRV:GhFAR; Figure C shows the incidence of Verticillium dahlia in the resistant upland cotton line Shidalukang-1 14 and 21 days after inoculation.
[0031] Figure 7 Figure 3: FAR3 gene silencing reduces Verticillium wilt resistance in cotton (the disease-resistant Sea Island cotton variety Xinhai 45). Figure A shows phenotypic analysis of TRV:GhFAR3 and TRV:00 21 days after inoculation with Verticillium dahliae; Figure B shows the silencing efficiency of GbFAR3 in TRV:GbFAR3; and Figure C shows the incidence of the disease-resistant Sea Island cotton variety Xinhai 45 on days 14 and 21 after inoculation with Verticillium dahliae.
[0032] Figure 8 GhFAR3 gene silencing significantly reduced the suberin content. DETAILED DESCRIPTION
[0033] Experimental procedures in the following examples, where specific conditions are not specified, generally followed conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer's recommendations. All commonly used chemical reagents used in the examples were commercially available.
[0034] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention.
[0035] The terms "comprise," "comprising," and "having," and any variations thereof, are intended to cover non-exclusive inclusions. For example, a process, method, apparatus, product, or device comprising a series of steps is not limited to the listed steps or modules but may optionally include steps not listed, or other steps inherent to the process, method, product, or device.
[0036] As mentioned in the present invention, "a plurality of" means two or more. "And / or" describes the relationship between associated objects and indicates that there can be three relationships. For example, A and / or B can represent three situations: A exists alone, A and B exist simultaneously, and B exists alone. The character " / " generally indicates that the associated objects before and after are in an "or" relationship.
[0037] The following will explain the embodiments of the present invention in detail with reference to the accompanying drawings: These embodiments are implemented on the premise of the technical solution of the present invention, and detailed implementation manners and processes are given, aiming to explain the present invention, but the embodiments do not constitute a limitation to the present invention.
[0038] In this article, when expressing amino acids, a single letter is used for representation, and those skilled in the art can also use three letters for representation.
[0039] The applicant cloned a GhFAR3 gene that positively regulates Verticillium wilt of cotton. Its nucleotide sequence is shown in SEQ ID NO:1.
[0040] The sequence shown in SEQ ID NO:1 is as follows:
[0041] atggaattag ggagtgctct tcatttcctt gataacaagt ccattttagt cactggtgctgctgggtttt tggcaaaaat ttttgtggagaaaatactaa gggttcaacc aaatgtgaag aagttttatcttcttttacg tgctgcggat cataaatccg ctatacaccg tttgcacaatgagattatag gaaaagatttattcaaagtt ctgaaagaaa aatgcgggaa aaatttcagt ttatttatat ccgaaaaaattacactaattcctggagata tatctcatga agatttgggc attaaagatt gtactttagt gcaagagatgttgaatgaag ttgatgttgt ggttaaccttgctgcaacaa ccaactttga cgaaagatat gatgtggcacttggtctcaa tacatttgga gctaaatttg ttgcaaattt cgccaagaaatgtgtgaaac taaaagttttggttcatgta tccacagctt atgtgtcagg agaaaagaca gggcttatac ttgaaaattcatacaggatgggagaaaccc ttaatggtgt ttcaggctta gacattaatt ttgagaaaaa aattattgaacaaaaattga atgaactgag attgctaggtgcttcagaca aggatattac tcaagccatg aaagatttgggcattcaaag ggcaagattt tatggatggc caaatacata tgtatttacaaaggcaatgg gagaaatgctagtgggggaa ttcaaagcaa atatggctac aatcatatta agacctacta tcataaccagcactttcaaagagccatttc ctggttgggc tgaaggtgtt agaaccatcg atagccttgc aataggttatgctaagggga aattgacttt cttcctcggtgatgtggact cagttgttga cctgataccagctgacatggtggtgaatgc catcatcata gccatggtag cccatgcatc gaaccaaccatcggagacga tctaccaagtgggttcgtcg atgaggaacc cggtcaagta ccataacctc caagactttg gctaccgatacttctccaagaaaccttgga tcaacaaaga tgggaaggct gttattgttg gcaaaattcg tgtcatggatagcatggcca gcttccatag atacatggctcttcgatacc tgctcccttt gaagggactg gaatttgcaaatacagcatt ttgccatttc tttcaaggtg tttgcagtga tctcaataggaaaatcagct tcgtgactcggttgatagac atttacagac cctacttgtt cttcgatgca atatttgatg atataaacaccgagaagctacgaatgtcgg cgagatcgag cctagcagag aacgatatgt tctatttcga ccctaaatgcatcaactggg atgattattt catgaacactcatattcctg ggatcgtaaa atacattttc aaatga。
[0042] The protein sequence encoded by the above GhFAR3 gene is shown in SEQ ID NO:2.
[0043] The sequence shown in SEQ ID NO:2 is as follows:
[0044] MELGSALHFLDNKSILVTGAAGFLAKIFVEKILRVQPNVKKFYLLLRAADHKSAIHRLHNEIIGKDLFKVLKEKCGKNFSLFISEKITLIPGDISHEDLGIKDCTLVQEMLNEVDVVVNLAATTNFDERYDVALGLNTFGAKFVANFAKKCVKLKVLVHVSTAYVSGEKTGLILENSYRMGETLNGVSGLDINFEKKIIEQKLNELRLLGASDKDITQAMKDLGIQRARFYGWPNTYVFTKAMGEMLVGEFKANMATIILRPTIITSTFKEPFPGWAEGVRTIDSLAIGYAKGKLTFFLGDVDSVVDLIPADMVVNAIIIAMVAHASNQPSETIYQVGSSMRNPVKYHNLQDFGYRYFSKKPWINKDGKAVIVGKIRVMDSMASFHRYMALRYLLPLKGLEFANTAFCHFFQGVCSDLNRKISFVTRLIDIYRPYLFFDAIFDDINTEKLRMSARSSLAENDMFYFDPKCINWDDYFMNTHIPGIVKYIFK。
[0045] Eight known FAR genes of Arabidopsis thaliana were selected for phylogenetic tree and multiple sequence alignment analysis. The phylogenetic tree was constructed using the NJ method (Neighbor-Joining) in MEGA7. The results showed that the protein sequence of this gene had the highest homology with AtFAR3 in Arabidopsis thaliana. Therefore, the applicant named it GhFAR3( Figure 1 ). Multiple sequence alignment was performed using MultipleSequence Alignment in DANMAN. The results showed that both the GhFAR3 protein and the FAR proteins of Arabidopsis thaliana contained a typical NAD domain( Figure 2 ).
[0046] Analysis of the tissue expression pattern of GhFAR3 revealed that the GhFAR3 gene was predominantly expressed in the roots of disease-resistant varieties( Figure 3 ). After treatment with Verticillium dahliae, GhFAR3 was rapidly up-regulated in disease-resistant varieties of Gossypium hirsutum, but the induction time and degree were significantly lagged behind those in disease-resistant varieties of Gossypium hirsutum in disease-susceptible varieties( Figure 4In the resistant varieties of sea island cotton, GhFAR3 was induced by Verticillium dahliae and significantly upregulated 12 and 48 hours after inoculation; however, in the susceptible varieties of sea island cotton, GhFAR3 had no significant differential expression at 12, 24, and 48 hours after Verticillium dahliae treatment. The expression level of FAR3 in the resistant varieties of upland cotton and sea island cotton was significantly higher than that in the susceptible varieties ( Figure 4 ).
[0047] The GhFAR3 gene was silenced using the virus-induced gene silencing (VIGS) method. The VIGS experimental materials were the disease-resistant upland cotton line Shidalukang-1 and the disease-resistant sea island cotton variety Xinhai 45. In the upland cotton line Shidalukang-1, TRV:00-injected plants served as controls. Fourteen days after VIGS injection, the TRV:GhCHLI plants showed a distinct yellowing phenotype in their true leaves ( Figure 5 ), the expression of GhFAR3 in TRV:GhFAR3 was significantly lower than that in TRV:00( Figure 6 B). Root irrigation was used to inoculate the TRV:00 and TRV:GhFAR3 cotton plants 14 days after the VIGS experiment. The incidence statistics showed that the incidence of TRV:GhFAR3 was significantly higher than that of TRV:00 plants ( Figure 6 C). Similarly, after silencing GbFAR3 in sea island cotton, the resistance of the disease-resistant sea island cotton variety Xinhai 45 to Verticillium wilt was significantly reduced ( Figure 7 C). The results showed that the FAR gene positively regulates Verticillium wilt resistance in both sea island and upland cotton.
[0048] GhFAR3 gene silencing was performed using VIGS in the disease-resistant upland cotton line Shidalukang-1. Fourteen days after VIGS injection, the contents of six suberin monomers (C16:0, C16:1, C16:2, C18:0, C18:1, and C18:2) were analyzed. Compared to TRV:00, the contents of all six suberin monomers were significantly reduced in TRV:GhFAR3 cotton plants.
[0049] The following describes the method in conjunction with specific embodiments.
[0050] Example 1: GhFAR3 gene cloning
[0051] The upland cotton variety "Zhongzhimian No. 2" resistant to Verticillium wilt was used as the experimental material. The delinted seeds were soaked in warm water at 37°C for 1 hour, neatly placed in a germination box covered with gauze, and incubated in the dark in an incubator at 28°C for 24 hours. Then, seeds with uniform germination were selected for sowing.
[0052] When the cotton seedlings grow to the two-leaf and one-heart stage, collect the tissue samples of cotton roots, stems and leaves respectively, and extract RNA. After the extraction is completed, detect the integrity of RNA by 1.2% agarose gel electrophoresis analysis. The RNA concentration and purity are detected by Nanodrop ND-2000 micro-spectrophotometer. Reverse transcribe the RNA into cDNA. Using this cDNA as a template, design primers according to the CDS sequence of GhFAR3, and clone the cDNA sequence of GhFAR3.
[0053] The primers required for cloning are as follows:
[0054] GhFAR3-F: ATGGCAAGTGATGATACCTTTGA (SEQ ID NO:3);
[0055] GhFAR3-R: TCATAAAGTGAGATCTAGAGTATTTGC (SEQ ID NO:4).
[0056] After ligating the amplified sequence to the PMDT-19 vector, screen out the positive clones and send them to Shanghai Sangon Biological Engineering Co., Ltd. for sequencing. Its nucleotide sequence is shown in SEQ ID NO:1, and the corresponding protein sequence is shown in SEQ ID NO:2.
[0057] Perform phylogenetic tree analysis on GhFAR3 and 8 known FAR genes in Arabidopsis thaliana. According to Figure 1 the results, this sequence shows the highest homology with AtFAR3 in Arabidopsis thaliana, so the applicant named it GhFAR3. In addition to GhFAR3, we also selected the amino acid sequences of 8 FAR genes and performed multiple sequence alignment analysis by DANMAN software. The results are as Figure 2 shown, GhFAR3 contains the typical NAD domain unique to FAR proteins.
[0058] Example 2: Analysis of FAR3 expression pattern
[0059] Using the land cotton Verticillium wilt-resistant variety Zhongzhimian 2, the land cotton Verticillium wilt-susceptible variety Junmian 1, the sea island cotton Verticillium wilt-resistant variety Xinhai 45, and the sea island cotton Verticillium wilt-susceptible variety Q67 as experimental materials, the total RNA of roots, stems and leaf tissues of cotton varieties with different resistances at the two-leaf and one-heart stage was extracted using a plant RNA rapid extraction kit, and the RNA was reverse transcribed using a reverse transcription kit from TransGen Biotech Co., Ltd. in Beijing. Specific primers were designed using the online website qPrimerDB (https: / / biodb.swu.edu.cn / qprimerdb / ), with GhUBQ7 as the internal reference gene, and the RT-qPCR method was used to analyze the expression specificity of the gene in the roots, stems and leaves of different cotton varieties. The relative quantification method for the expression level of the target gene was calculated according to 2 -△△CT Method calculation.
[0060] The RT-qPCR primer sequences of GhFAR3 are as follows:
[0061] GhFAR3-qF: TCGATACCTGCTCCCTTTGAAG (SEQ ID NO:5);
[0062] GhFAR3-qR: CGAGTCACGAAGCTGATTTTCC (SEQ ID NO:6).
[0063] The sequence of GhUBQ7 is:
[0064] GhUBQ7-F: GAAGGCATTCCACCTGACCAAC (SEQ ID NO:7)
[0065] GhUBQ7-R: CTTGACCTTCTTCTTCTTGTGCTTG (SEQ ID NO:8)
[0066] Because Verticillium wilt is a root disease, genes with high expression in roots are preferably studied. The gene expression levels of the GhFAR3 gene in the root, stem and leaf tissues of different materials are as Figure 3 shown. FAR is predominantly expressed in the roots of all materials, and the expression level in the roots is significantly higher than that in the leaves and stems. The expression levels of the FAR3 gene in disease-resistant varieties of upland cotton and sea island cotton are significantly higher than those in disease-susceptible varieties.
[0067] The spore solution of the highly virulent Verticillium dahliae strain "V592" was smeared on a solid PDA medium and activated at 25°C. After 7 days of dark culture, an appropriate amount of mycelial blocks were selected and inoculated into Czapek's medium, and then the medium was placed on a shaker at 150 r / min. It was cultured in the dark at 25°C for 5 - 7 days. Then the spore concentration was adjusted to 10 6 cells / ml for use.
[0068] PDA solid medium formula:
[0069] Chop 200 g of fresh peeled potatoes, add 500 mL of ddH2O, and boil it in a microwave oven at high heat for 10 min. After boiling, filter it with gauze, add 15 g of glucose and 20 g of agar powder to the filtrate, and make up the volume to 1 L with ddH2O. After sterilization, dispense it into petri dishes.
[0070] Czapek’s medium formula:
[0071] 30 g of sucrose, 3 g of sodium nitrate, 1 g of magnesium sulfate, 1 g of potassium chloride, 1 g of potassium dihydrogen phosphate, and 0.02 g of ferrous sulfate, make up the volume to 1 L with ddH2O, adjust the pH to 6.0, and keep it for use after sterilization.
[0072] The cotton seedlings were inoculated by the root-injuring method, and the prepared spore solution was used to irrigate the roots of the cotton seedlings, 20 mL per plant. The culture conditions after inoculation were 16 h light / 8 h dark, and the day and night temperatures were 25°C and 23°C respectively. In the control group, the spore solution was replaced with distilled water, and the inoculation method was the same as above.
[0073] The root tissues of different cotton varieties at 0, 12, 24, and 48 h after inoculation with Verticillium dahliae were taken respectively for RNA extraction and analysis of the expression of GhFAR3 gene after Verticillium dahliae infection. The method for analyzing the expression level of the target gene was the same as above.
[0074] The results are as Figure 4 shown. GhFAR3 was significantly up-regulated by Verticillium dahliae induction in disease-resistant varieties of upland cotton and sea-island cotton, while it was up-regulated only in the susceptible materials of upland cotton inoculated with Verticillium dahliae for 48 h. The up-regulation of GhFAR3 is related to the disease resistance of cotton to Verticillium wilt.
[0075] Example 3: Identification of the function of GhFAR3 in cotton resistance to Verticillium wilt by VIGS technology
[0076] Design silencing vector primers according to the coding sequence of GhFAR3 gene:
[0077] GhFAR3-VIGS-F: CGGAATTCACAACAACAACAACACACCACC (SEQ ID NO:9);
[0078] GhFAR3-VIGS-R: GGGGTACCGTTGTCATCGGGTGGAAGGT (SEQ ID NO:10).
[0079] The target fragment of the GhFAR3 gene was amplified and ligated into the pTRV2 vector, and then transferred into Agrobacterium tumefaciens GV3101 by electroporation. Taking cotton magnesium chelatase protein (GhCHLI) as the positive control, after mixing TRV:00, TRV:GhCHLI, TRV:GhFAR3 and pTRV1 in equal volumes and standing for 3 h, the bacterial solution was injected into different cotton materials (Gossypium hirsutum disease-resistant line Shidalukang-1 and Gossypium barbadense disease-resistant variety Xinhai 45) with a 1-ml syringe without a needle tip.
[0080] In the Gossypium hirsutum disease-resistant line Shidalukang-1, 14 days after VIGS injection, obvious chlorosis phenotypes appeared in the true leaves of TRV:GhGHLI plants, indicating that the VIGS system was successfully constructed ( Figure 5 ). RT-qPCR was used to detect the expression of GhFAR3 in TRV:00 and TRV:GhFAR3. The results are as Figure 6 shown in B. Two weeks after VIGS injection, the expression of GhFAR3 in TRV:GhFAR3 was significantly lower than that in TRV:00, indicating that the expression of GhFAR3 in TRV:GhFAR3 was significantly inhibited. The root-injuring method was used to inoculate Verticillium dahliae on the cotton plants of TRV:00 and TRV:GhFAR3 at the two-leaf and one-heart stage, and 30 cotton plants were inoculated for each material. The results are as Figure 6 shown in A and 6C.
[0081] Figure 6 A is the phenotypic analysis of TRV:GhFAR3 and TRV:00 21 days after inoculation with Verticillium dahliae, and B is the detection of the silencing efficiency of GhFAR3 in TRV:GhFAR3; Figure 6 C is the statistical analysis of the incidence rates of the Gossypium hirsutum disease-resistant line Shidalukang-1 at 14 days and 21 days after inoculation with Verticillium dahliae. The results showed that 21 days after inoculation with Verticillium dahliae, the incidence rate of TRV:00 plants was 30%, while the incidence rate of TRV:GhFAR3-silenced plants reached 45% (P = 0.002).
[0082] Similarly, after silencing GbFAR3 in the Gossypium barbadense disease-resistant variety Xinhai 45, the incidence rates of the TRV:GhFAR3 cotton plants at 14 days and 21 days after inoculation with Verticillium dahliae were 31% and 56% respectively, which were significantly higher than 24% and 32% of TRV:00 (P = 0.023 and 0.003) ( Figure 7 C).
[0083] Example 4: Analysis of the molecular mechanism of FAR3 regulating cotton disease resistance
[0084] The extraction of suberin from cotton roots includes processes such as defatting, depolymerization, and derivatization. Add 25 μL of C17:0ME standard (1 mg / mL) as an internal standard (for subsequent quantitative calculation) to a test tube containing the dried defatted sample; then sequentially add 0.9 mL of methyl acetate, 1.5 mL of sodium methoxide, and 3.6 mL of methanol; place the test tube in a metal bath at 60 °C for 2 h; after cooling, add 10 mL of dichloromethane and 10 mL of glacial acetic acid respectively to adjust the pH of the mixture to 4 - 5; then add 6 mL of 0.5 mol / L NaCl solution and shake well; centrifuge at 2000 r / min for 5 mins after shaking evenly; take out the organic phase and transfer it to a new test tube; add 0.5 mol / L NaCl solution to the new test tube, shake well for washing, and centrifuge at 2000 r / min for 10 mins (this washing step is repeated 2 times); discard the upper layer of the liquid, add 6 g of anhydrous sodium sulfate and shake well (to absorb the residual water in the organic phase), and centrifuge at 2000 r / min for 5 mins; transfer the liquid to a reaction flask, dry it with nitrogen, add 100 μL of pyridine and 100 μL of acetic anhydride respectively, and place it in a metal bath at 60 °C for 2 h; after cooling, dry the liquid with nitrogen, redissolve the reaction product with a toluene - heptane (volume ratio 1:1) mixture, and transfer it to a sample vial for GC (Gas Chromatography) detection.
[0085] The program conditions set for the GC gas chromatograph are: the injection volume is 1 μL; the split ratio is set to 1:10; the temperatures of the injection port and the detector are both set to 320 °C; the initial temperature of the column oven is 80 °C, first heat it to 200 °C at a rate of 15 °C / min, then heat it to 230 °C at a rate of 1.5 °C / min, and then heat it to 300 °C at a rate of 5 °C / min. The gas chromatography column used is a 30 m × 0.25 mm HP - 5MS capillary column, and nitrogen is used as the carrier gas.
[0086] The contents of 6 related suberin monomers (C16:0, C16:1, C16:2, C18:0, C18:1, and C18:2) were analyzed, and the results are as Figure 8 shown. Compared with TRV:00, the suberin content of TRV:GhFAR3 was significantly reduced, indicating that the silencing of the GhFAR3 gene significantly reduced the suberin content.
[0087] Among them, suberin (suberin) is a substance that plays a protective role in the plant cell wall, especially in the roots and the outer protective layer. For cotton, the possible disadvantages of a reduced suberin content are:
[0088] Disease resistance: Suberin plays a defensive role in plants. Reducing its content may weaken the resistance of cotton to pathogens and environmental stresses. For example, suberin can form a physical barrier to prevent the invasion of pathogenic bacteria. Therefore, a decrease in suberin content may make cotton more susceptible to diseases and other environmental stresses.
[0089] Drought resistance: Suberin helps reduce water loss, thereby enhancing the drought resistance of plants. A decrease in suberin content may cause cotton to be more prone to dehydration and wilting under drought conditions.
[0090] Therefore, those skilled in the art can use genetic engineering techniques to regulate the expression level of the GhFAR3 gene in cotton, such that the expression level of the GhFAR3 gene or its active fragment in the target cotton shows a difference from that of the wild type of the cotton, in order to obtain different transgenic cottons to meet various commercial demands.
[0091] In addition, those skilled in the art can also screen cotton lines with high disease resistance by detecting the GhFAR3 gene or its active fragment in cotton.
[0092] The above is a further detailed description of the present invention and should not be regarded as a limitation on the specific implementation of the present invention. For those of ordinary skill in the technical field to which the present invention pertains, simple deductions or substitutions without departing from the concept of the present invention are within the protection scope of the present invention.
Claims
1. A method for detecting cotton resistance to Verticillium wilt, characterized in that: The detection method is to detect the target cotton GhFAR3 The expression level of genes, GhFAR3 The gene is shown in SEQ ID NO: 1; the Verticillium wilt disease is caused by Verticillium dahliae.