A SNP molecular marker related to a sheep chest circumference trait, a primer set, a kit and application thereof

Abstract

The application belongs to the technical field of SNP molecular markers, and particularly relates to a SNP molecular marker related to a sheep chest circumference trait, a primer group, a kit and application thereof. The SNP molecular marker is located at a 61469200bp site on a 3rd chromosome of a sheep genome, and the SNP molecular marker has a C / T base mutation. The SNP molecular marker has significant correlation with the sheep chest circumference trait, enriches a sheep chest circumference molecular marker database, and it is found through research that the chest circumference of an adult sheep individual with a CC genotype is significantly higher than that of a sheep individual with a CT genotype. In the process of sheep breeding, the CC homozygous individual with an adult chest circumference advantage can be selected and reserved, and in particular, the individual with an advantage in chest circumference at the lamb stage is selected and reserved, which has potential application value for large-scale sheep molecular breeding.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of SNP molecular markers, and particularly relates to a SNP molecular marker related to a sheep chest circumference trait, a primer set, a kit and application thereof. BACKGROUND

[0002] The chest circumference of sheep not only reflects the size of its body type, but also reflects its growth potential and meat value to a certain extent. At the same time, the measurement of the chest circumference of sheep is an important monitoring index in livestock management. By regularly measuring and analyzing the changes in the chest circumference of sheep, breeders can evaluate the production status of sheep and timely adjust the feeding management strategy to ensure that the sheep can achieve the best meat performance.

[0003] In recent years, the production efficiency of mutton sheep is low, which cannot meet the gradually increasing demand of people. In order to solve this problem, mutton sheep enterprises and breeders use various methods to improve the production benefit of mutton sheep. Among them, the molecular marker assisted selection technology can effectively accelerate the genetic progress of sheep. However, as an important index affecting the growth of mutton sheep, there is no report on the correlation between the chest circumference trait and the molecular marker described in the application. SUMMARY

[0004] The purpose of the application is to provide a SNP molecular marker related to a sheep chest circumference trait, a primer set, a kit and application thereof. The SNP molecular marker has significant correlation with the chest circumference trait of sheep, and enriches the molecular marker database of the chest circumference of sheep.

[0005] The application provides a SNP molecular marker related to a sheep chest circumference trait. The SNP molecular marker is located at a 61469200bp site on chromosome 3 of a sheep genome. The SNP molecular marker has a C / T base mutation.

[0006] The application also provides a primer set for detecting the SNP molecular marker described in the above technical solution. The primer set includes an upstream primer, a downstream primer and an extension primer. The nucleotide sequences of the upstream primer, the downstream primer and the extension primer are respectively shown in SEQ ID NO. 3, SEQ ID NO. 4 and SEQ ID NO. 5.

[0007] The application also provides a kit. The kit includes the primer set described in the above technical solution and PCR amplification reagents.

[0008] Preferably, the PCR amplification reagents include dNTPs, Taq DNA polymerase, MgCl2, PCR reaction buffer, shrimp alkaline phosphatase and iplex reaction reagents. The kit also includes a standard positive template DNA.

[0009] The application further provides application of the SNP molecular marker or the primer set or the kit in sheep chest circumference marker-assisted breeding.

[0010] Preferably, the sheep chest circumference marker-assisted breeding comprises prediction of advantages of adult sheep chest circumference traits.

[0011] The application further provides a method for predicting whether an adult sheep chest circumference has an advantage, comprising the following steps:

[0012] The genomic DNA of the sheep to be tested is used as a template, and upstream primers and downstream primers in the primer set are used for PCR amplification reaction to obtain a PCR amplification product.

[0013] The PCR amplification product is subjected to a digestion reaction to obtain a digested PCR amplification product.

[0014] The digested PCR amplification product is used as a template, and extension primers in the primer set are used for extension reaction to obtain an extension product.

[0015] The extension product is subjected to genotyping to obtain a genotype result.

[0016] The adult chest circumference of the sheep to be tested is predicted according to the genotype result: when the genotype of the sheep at the 61469200bp site on the 3rd chromosome is CC genotype, the sheep to be tested has a large chest circumference after adulthood and has a chest circumference advantage.

[0017] When the genotype of the sheep at the 61469200bp site on the 3rd chromosome is CT genotype, the sheep to be tested has a small chest circumference after adulthood and does not have a chest circumference advantage.

[0018] Preferably, the reaction system of the PCR amplification reaction is 5μL, and comprises the following components: 20-50ng / μL genomic DNA 1μL, PCR reaction buffer 0.5μL, 25mmol / L MgCl20.4μL, 25μmol / L dNTPs 0.1μL, 0.5μmol / L PCR primer mixture 1μL, 5U / μL Taq DNA polymerase 0.2μL and deionized water 1.8μL.

[0019] The PCR amplification reaction program is 95℃ pre-denaturation for 2min; 95℃ denaturation for 30s, 56℃ annealing for 30s, 72℃ extension for 60s, a total of 45 cycles; and 72℃ for 5min.

[0020] Preferably, the digestion system of the digestion reaction comprises 0.17 μL of shrimp alkaline phosphatase Buffer, 0.3 μL of 1.7 U / μL shrimp alkaline phosphatase, and 1.53 μL of deionized water, in a total of 2 μL;

[0021] The procedure of the digestion reaction is 37℃ for 40 min, and 85℃ for 5 min.

[0022] Preferably, the extension system of the extension reaction comprises 0.2 μL of iplex Buffer Plus, 0.2 μL of iplex Terminator, 0.94 μL of extension primer, 0.041 μL of iplex enzyme, and 0.619 μL of deionized water, in a total of 2 μL;

[0023] The procedure of the extension reaction is 94℃ for 30 s;

[0024] [94℃ 5 s, (52℃ 5 s, 80℃ 5 s)], wherein the (52℃ 5 s, 80℃ 5 s) is performed for 5 cycles, and the [94℃ 5 s, (52℃ 5 s, 80℃ 5 s)] is performed for 40 cycles; 72℃ for 3 min.

[0025] Advantages:

[0026] The present application provides a SNP molecular marker related to the chest circumference trait of sheep, which is located at the 61469200 bp site on the 3rd chromosome of the sheep genome, and a C / T base mutation exists in the SNP molecular marker. The SNP molecular marker has a significant correlation with the chest circumference trait of sheep, enriches the database of chest circumference molecular markers of sheep, and research shows that the chest circumference of a sheep individual with a CC genotype is significantly higher than that of a sheep individual with a CT genotype. In the process of sheep breeding, the CC homozygous individual with an advantage in adult chest circumference can be selected and kept, especially the individual with an advantage in chest circumference at the lamb stage, which has potential application value for large-scale molecular breeding of sheep.

[0027] On this basis, the present application also provides a primer set and a kit for detecting the SNP molecular marker, and a method for detecting and / or the chest circumference trait of sheep. Based on the SNP site typing of the primer set or the kit, the adult chest circumference trait of the sheep to be tested can be predicted. The method has high accuracy, cost performance and sensitivity, can realize automatic detection of the SNP site, can simultaneously detect tens to hundreds of SNP sites in hundreds to thousands of samples, and provides technical support for molecular assisted breeding of the chest circumference of sheep. BRIEF DESCRIPTION OF DRAWINGS

[0028] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced below.

[0029] Figure 1 For the genotyping results of SNP loci in 380 sheep individuals by Sequenom SNP technology in Example 1. DETAILED DESCRIPTION

[0030] The present application provides a SNP molecular marker related to the chest circumference trait of sheep, which is located at the 61469200bp site on chromosome 3 of the sheep genome, and the SNP molecular marker has a C / T base mutation.

[0031] The version number of the sheep genome sequence information in the present application is preferably ARS-UI_Ramb_v2.0. The nucleotide sequence containing the SNP molecular marker in the present application is preferably as shown in SEQ ID NO. 1 or SEQ ID NO. 2, that is, the base at the 201bp position of the nucleotide shown in SEQ ID NO. 1 or SEQ ID NO. 2 is C or T, and specifically as follows, wherein the bold italic underlined base position is the position of the SNP molecular marker.

[0032] SEQ ID NO. 1: 5'-TCTCAACACATTTAATACTTTTCAGCACAACAGAGAATTTCCATGTTTGTTTATTTCACAAAATTTGGGAAGAACTGTACTATCCTTATCTGTCTCTGTTATTTATCTATTATGTGCACACATGTGCAGTGGCCATGGCATTGTAGGATGTTAGTAAAAGCAATTTCATCAGATATAGATGTCTTGAGTTACAGATGA C GGAGTCAAGTGGTTGTTTTTTTTTTTAACTGAAGTATAATTAATTT GTGTGTGTGTGTGTGTGTGTGTGTGTGTATTAGCTGCTGAGTCATGTCTGACTCTTTTAGACCCCAAGAACTGTGGCCCACCAGGTTCCTCTGTCCATGGGATTCTCCAGGCAAGAATACTGAAGTGGGCAGCCATTTCCTTCTCCAGGGGA-3';

[0033] SEQ ID NO. 2: 5'-TCTCAACACATTTAATACTTTTCAGCACAACAGAGAATATTTCCATGTTTGTTTATTTCACAAAATTTGGGAAGAACTGTACTATCCTTATCTGTCTCTGTTATTTATCTATTATGTGCACACATGTGCAGTGGCCATGGCATTGTAGGATGTTAGTAAAAGCAATTTCATCAGATATAGATGTCTTGAGTTACAGATGA-3'. T GGAGTCAAGTGGTTGTTTTTTTTTTTAACTGAAGTATAATTAATTTGTGTGTGTGTGTGTGTGTGTGTGTGTGTATTAGCTGCTGAGTCATGTCTGACTCTTTTAGACCCCAAGAACTGTGGCCCACCAGGTTCCTCTGTCCATGGGATTCTCCAGGCAAGAATACTGAAGTGGGCAGCCATTTCCTTCTCCAGGGGA-3'.

[0034] The SNP marker described in the present application has a significant correlation with the chest circumference trait of sheep, and the chest circumference of an individual with a CC genotype is significantly higher than that of an individual with a CT genotype.

[0035] The present application also provides a primer set for detecting the SNP molecular marker described in the above technical solution, wherein the primer set comprises an upstream primer, a downstream primer and an extension primer; the nucleotide sequences of the upstream primer, the downstream primer and the extension primer are respectively shown in SEQ ID NO. 3, SEQ ID NO. 4 and SEQ ID NO. 5.

[0036] The nucleotide sequences shown in SEQ ID NO. 3, SEQ ID NO. 4 and SEQ ID NO. 5 described in the present application are as follows:

[0037] SEQ ID NO. 3: 5'-ACGTTGGATGGTCAGACATGACTCAGCAG-3';

[0038] SEQ ID NO. 4: 5'-ACGTTGGATGCAGATATAGATGTCTTGAG-3';

[0039] SEQ ID NO. 5: 5'-TTGAGTTACAGATGA-3'.

[0040] The application further provides a kit comprising the primer set and the PCR amplification reagent.

[0041] The PCR amplification reagent preferably comprises Sequenom MassARRAY SNP genotyping reagents, and further preferably comprises but is not limited to dNTPs, Taq DNA polymerase, MgCl2, a PCR reaction buffer, shrimp alkaline phosphatase (SAP) and iplex reaction reagents. The application does not have a special limitation on the dosage of each component in the PCR amplification reagent, and the components can be combined as required. The use concentration of the upstream primer and the downstream primer is preferably independently 0.45-0.55 μmol / L, and more preferably independently 0.50 μmol / L; and the concentration of the extension primer in the primer set is preferably 0.6-1.3 μmol / L. The use concentration of the dNTPs is preferably 20-30 μmol / L, and more preferably 25 μmol / L; the use concentration of the Taq DNA polymerase is preferably 4-6 U / μL, and more preferably 5 U / μL; the use concentration of the MgCl2 is preferably 20-30 mmol / L, and more preferably 25 mmol / L; the PCR reaction buffer is preferably a 10× PCR reaction buffer; and the enzyme activity of the shrimp alkaline phosphatase is preferably 1.7 U / μL. The iplex reaction reagent preferably comprises iplex BufferPlus, iplex Terminator and iplex enzyme. The kit preferably further comprises shrimp alkaline phosphatase Buffer. The kit preferably further comprises a standard positive template DNA; the genotype of the standard positive template DNA is preferably CC, and the standard positive template DNA serves as a positive control to increase the accuracy of SNP site detection.

[0042] The application further provides an application of the SNP molecular marker or the primer set or the kit in sheep chest circumference marker-assisted breeding. The sheep chest circumference marker-assisted breeding preferably comprises adult sheep chest circumference trait prediction, and more preferably prediction of whether a lamb stage adult sheep chest circumference trait has an advantage. The application preferably screens sheep with the SNP molecular marker site of CC genotype for subsequent breeding, so as to retain the chest circumference advantage and production performance of the sheep.

[0043] Specifically, the application further provides a method for predicting whether an adult sheep chest circumference has an advantage, comprising the following steps:

[0044] The genomic DNA of the sheep to be tested is used as a template, and the upstream primer and the downstream primer in the primer set are used for PCR amplification reaction to obtain a PCR amplification product.

[0045] The PCR amplification product is subjected to a digestion reaction to obtain a digested PCR amplification product;

[0046] The digested PCR amplification product is used as a template, and the extension primer in the primer set in the technical solution is used for an extension reaction to obtain an extension product;

[0047] The extension product is subjected to genotyping to obtain a genotype result;

[0048] According to the genotype result, the adult chest circumference of the sheep to be tested is predicted: when the genotype of the 61469200bp site on the 3rd chromosome of the sheep genome is the CC genotype, the sheep to be tested has a large chest circumference after adulthood, and has a chest circumference advantage;

[0049] When the genotype of the 61469200bp site on the 3rd chromosome of the sheep genome is the CT genotype, the sheep to be tested has a small chest circumference after adulthood, and does not have a chest circumference advantage.

[0050] The application preferably extracts the genomic DNA of the sheep to be tested. The sheep to be tested in the application is preferably a lamb stage sheep. The application does not have special requirements for the type of sheep to be tested, and any type of sheep can be detected using the method of the application. In an embodiment of the application, Huameng mutton sheep is used. The application does not have special limitations on the extraction method of the sheep genome to be tested, and the conventional animal cell genomic extraction method in the art can be used. In an embodiment of the application, red blood cell lysis solution is used to lyse and remove red blood cells not containing DNA, cell nucleus lysis solution is used to lyse red blood cells to release genomic DNA, protein solution is used to selectively precipitate and remove protein, and finally isopropanol is used for precipitation and redissolved in a DNA dissolving solution to obtain pure genomic DNA.

[0051] After obtaining the genomic DNA of the sheep to be tested, the genomic DNA of the sheep to be tested is used as a template, and the upstream primer and the downstream primer in the primer set in the technical solution are used for PCR amplification reaction to obtain a PCR amplification product. The reaction system of the PCR amplification reaction is 5 μL, and preferably includes the following components: 20-50 ng / μL genomic DNA 1 μL, PCR reaction buffer 0.5 μL, 25 mmol / L MgCl2 0.4 μL, 25 μmol / L dNTPs 0.1 μL, 0.5 μmol / L PCR primer mixture 1 μL, 5 U / μL Taq DNA polymerase 0.2 μL, and deionized water 1.8 μL. The program of the PCR amplification reaction is preferably as follows: 95°C pre-denaturation for 2 min; 95°C denaturation for 30 s, 56°C annealing for 30 s, 72°C extension for 60 s, a total of 45 cycles; and 72°C for 5 min. The PCR amplification product obtained is preferably stored at 4°C. After the PCR amplification reaction, the DNA fragment containing the SNP site is contained in the PCR amplification product.

[0052] After obtaining the PCR amplification product, the shrimp alkaline phosphatase is used for digestion reaction on the PCR amplification product to obtain a digested PCR amplification product. The digestion system of the digestion reaction is 2 μL, and preferably includes the following components: shrimp alkaline phosphatase Buffer 0.17 μL, 1.7 U / μL shrimp alkaline phosphatase 0.3 μL, and deionized water 1.53 μL. The program of the digestion reaction is preferably as follows: 37°C for 40 min, and 85°C for 5 min. The digested PCR amplification product is preferably stored at 25°C. The digestion reaction has the effect of digesting the primer sequence and the remaining dNTPs in the PCR amplification reaction system.

[0053] After obtaining the digested PCR amplification product, the digested PCR amplification product is used as a template, and the extension primer in the primer set in the technical solution is used for extension reaction to obtain an extension product. The extension system of the extension reaction is 2 μL, and preferably includes the following components: iplex Buffer Plus 0.2 μL, iplex Terminator 0.2 μL, extension primer 0.94 μL, iplex enzyme 0.041 μL, and deionized water 0.619 μL. The program of the extension reaction is preferably as follows: 94°C for 30 s; [94°C for 5 s, (52°C for 5 s, 80°C for 5 s)], wherein the (52°C for 5 s, 80°C for 5 s) is performed for 5 cycles, and the [94°C for 5 s, (52°C for 5 s, 80°C for 5 s)] is performed for 40 cycles; and 72°C for 3 min. The iplex Buffer Plus, the iplex Terminator, and the iplex enzyme in the extension system are preferably derived from Gold Reagent Set kit. In the process of the extension reaction described in the present application, single base extension is performed on the SNP site to be detected in the extension system, and the site-specific extension primer will be extended by one base at the mutation site and terminated. The extension primer will be connected with different ddNTPs according to the difference of the mutation type, forming a difference in molecular weight. After obtaining the extension product, the present application preferably performs resin purification on the extension product. The method of resin purification in the present application is not particularly limited, and conventional resin purification in the art can be used.

[0054] After obtaining the extension product, the present application performs genotyping on the extension product by matrix-assisted laser desorption ionization time-of-flight mass spectrometry to obtain the genotype result. The present application preferably spots the extension product on a target sheet and uses a mass spectrometer to detect the molecular weight difference of different extension products. Through data analysis, the specific genotype of each mutation site of the sample to be detected is obtained. Specifically, in the process of genotyping by the matrix-assisted laser desorption ionization time-of-flight mass spectrometry in the present application, mass spectrometry spotting is preferably performed by MassARRAY Nanodispenser RS1000; mass spectrometry analysis is preferably performed by MassARRAY Compact System. After mass spectrometry analysis, the present application preferably detects mass spectrometry peaks by Typer 4.0 software and judges the genotype of the target site of each sample according to the mass spectrometry peak graph.

[0055] The method described in the present application is actually based on Sequenom SNP technology. The basic principle of the Sequenom SNP technology is as follows: first, an upstream primer and a downstream primer are used to amplify the DNA fragment in which the target SNP site is located, and SAP enzyme is added to the amplification product to digest the primer sequence and residual dNTPs in the reaction system. Then, single base extension is performed on the SNP site to be detected by using an extension primer, and the site-specific extension primer will be extended by one base at the mutation site and terminated. The extension product will be connected with different ddNTPs according to the difference of the mutation type, forming a difference in molecular weight. After resin purification of the extension product, the extension product is spotted on a target sheet, and a mass spectrometer is used to detect the molecular weight difference of different extension products. Through data analysis, the specific genotype of each mutation site can be obtained.

[0056] After obtaining the genotype result, the present application judges the adult chest circumference of the sheep to be tested according to the genotype result: when the genotype of the sheep genome at the site of 61469200bp on chromosome 3 is CC genotype, the sheep to be tested has large chest circumference type after adulthood, and has chest circumference advantage; when the genotype of the sheep genome at the site of 61469200bp on chromosome 3 is CT genotype, the sheep to be tested has small chest circumference type after adulthood, and does not have chest circumference advantage.

[0057] That is, the present application uses Sequenom SNP technology as the basis, and screens the sheep with CC genotype at the SNP site for subsequent breeding. The method of the present application can select and keep the genotype CC homozygous individuals with chest circumference advantage, improve the production performance of sheep, and has very great application value for large-scale molecular breeding of sheep.

[0058] In order to further illustrate the present application, the technical solutions provided by the present application are described in detail below in combination with the drawings and examples, but they should not be understood as limiting the scope of protection of the present application.

[0059] The following examples are used to illustrate the present application, but are not used to limit the scope of the present application. If not specifically indicated, the examples are carried out according to the conventional experimental conditions, such as Sambrook et al. Molecular Cloning Laboratory Manual (Sambrook J & Russell DW, Molecular Cloning: A Laboratory Manual, 2001), or according to the conditions suggested by the manufacturer's instructions.

[0060] Example 1

[0061] A method for detecting the genotype of sheep Chr3: 61469200 site by Sequenom SNP technology and predicting adult chest circumference of sheep individuals with advantage

[0062] 1. Experimental materials

[0063] 380 Huameng mutton sheep with adult sheep chest circumference records were selected as the detection object.

[0064] 2. Reagents and instruments

[0065] Reagent: Complete Genotyping Reagent Kit for Compact 384; Gene amplification: ABI 9700 384 Dual;

[0066] Mass spectrometry spotting: MassARRAY Nanodispenser RS1000;

[0067] MassARRAY Compact System;

[0068] All reagents and instruments were purchased from Beijing Genenode Biotech Co., Ltd.

[0069] 3. Extraction of genomic DNA

[0070] 1 mL blood was collected from the jugular vein of sheep at 1 month of age and treated with EDTA anticoagulation. First, the red blood cells were lysed to remove DNA-free red blood cells, the red blood cells were lysed with a cell nucleus lysing solution to release genomic DNA, then the proteins were selectively precipitated to remove proteins with a protein precipitation solution, and finally the pure genomic DNA was precipitated by isopropanol and redissolved in a DNA dissolving solution.

[0071] 4. Sequenom SNP technology for genotyping

[0072] A primer combination was designed for the 61469200 bp site on the 3rd chromosome of sheep (NC_056056.1, based on the sheep genome sequence information version number ARS-UI_Ramb_v2.0):

[0073] The nucleotide sequence of the PCR amplification primer is as follows:

[0074] Upstream primer F: 5'-ACGTTGGATGGTCAGACATGACTCAGCAG-3' (SEQ ID

[0075] No. 3)

[0076] Downstream primer R: 5'-ACGTTGGATGCAGATATAGATGTCTTGAG-3' (SEQ ID

[0077] No. 4)

[0078] The extension primer sequence and extension product are shown in Table 1:

[0079] Table 1. Extension primer sequence and extension product

[0080]

[0081]

[0082] The above primers were synthesized by Genenode.

[0083] The detection process is as follows:

[0084] 1. Extracting genomic DNA of the sheep to be tested;

[0085] 2. Using the genomic DNA of the sheep to be tested as a template, performing PCR amplification reaction with the upstream primer F and the downstream primer R; in addition, adding two standard positive templates DNA, the genotype of the 61469200bp site on the 3rd chromosome (based on the sheep genomic sequence information version number ARS-UI_Ramb_v2.0) is CC.

[0086] The reaction system of the PCR amplification reaction is 5μL: 20-50ng / μL genomic DNA 1μL, 10×PCR reaction buffer 0.5μL, 25mmol / L MgCl2 0.4μL, 25μmol / L dNTPs 0.1μL, PCR Primer mix 1μL, 5U / μL Taq DNA polymerase 0.2μL, and deionized water is supplemented to 5μL;

[0087] The program of the PCR amplification reaction is: 95℃ 2min, 95℃ 30s, 56℃ 30s, 72℃ 60s, 45 cycles; 72℃ 5min.

[0088] 3. Digesting the PCR amplification product with SAP enzyme; the PCR amplification product is digested, mainly using SAP enzyme to remove the remaining primers and dNTPs in the reaction product. The SAP enzyme digestion system is 2μL: SAP Buffer 0.17μL, SAP Enzyme 0.3μL, and deionized water is supplemented to 2μL; the reaction conditions are: 37℃ 40min, 85℃ 15min, and 25℃ storage.

[0089] 4. Using the digested PCR amplification product as a template, performing extension reaction with the extension primer S1; the extension reaction system is 2μL: iplex Buffer 0.2μL, Terminator mix 0.2μL, extension primer 0.94μL, iplex Enzyme 0.041μL, and deionized water is supplemented to 2μL;

[0090] The extension reaction conditions are: [94℃ 5s, (52℃ 5s, 80℃ 5s)]; wherein the (52℃ 5s, 80℃ 5s) is performed for 5 cycles, and the [94℃ 5s, (52℃ 5s, 80℃ 5s)] is performed for 40 cycles.

[0091] 5. Analyzing the extension product, thereby identifying the genotype of the sheep Chr3: 61469200 site.

[0092] The extension products after purification of the resin were moved to 384-well SpectroCHIP (Sequenom) chips for MALDI-TOF-MS (matrix-assisted laser desorption ionization time-of-flight mass spectrometry) reaction, and the mass spectrometry peaks were detected by using Typer 4.0 software, and the genotypes of different samples at the target sites were determined according to the mass spectrometry peak graphs.

[0093] The mass spectrometry detection results of the extension products are shown in Figure 1 , wherein the blue equilateral triangle represents the CC genotype, and the green square represents the CT genotype.

[0094] Statistical results: the statistical results of the correlation analysis between different genotypes at the 61469200bp site on the 3rd chromosome of the sheep to be tested and the chest circumference of Huameng mutton sheep at adulthood (2 years old) are shown in Table 2.

[0095] Table 2 Correlation analysis between different genotypes at the 61469200bp site on the 3rd chromosome of the sheep to be tested and the chest circumference of Huameng mutton sheep at adulthood

[0096]

[0097] The superscript different lowercase letters in the last column represent significant differences (P<0.05).

[0098] The results in Figure 1 and Table 2 show that the chest circumference of the adult sheep of the CC type is significantly higher than that of the CT genotype.

[0099] From the above examples, it can be concluded that the SNP molecular marker related to the chest circumference trait of sheep provided by the present application has a significant correlation with the adult chest circumference trait of sheep, and the SNP site can be genotyped to predict whether the sheep has a chest circumference advantage after adulthood at an early stage. The method in the present application can realize automatic detection of the SNP site, and in the process of sheep breeding, the CC homozygous individuals with chest circumference advantage can be selected and retained, thereby improving the production performance of sheep, and having potential application value for large-scale molecular breeding of sheep.

[0100] Although the above examples have made a detailed description of the present application, it is only a part of the embodiments of the present application, but not all the embodiments, and other embodiments can be obtained according to the present embodiments without creativity, which all belong to the protection scope of the present application.

Claims

1. Application of a SNP molecular marker in Huameng mutton sheep adult chest circumference marker assisted selection; the SNP molecular marker is located at a 61469200 bp site on a chromosome 3 of a sheep genome, the SNP molecular marker has a C / T base mutation, and a version number of the sheep genome sequence information is ARS-UI_Ramb_v2.

0.

2. Application of a primer group for detecting a SNP molecular marker in Huameng mutton sheep adult chest circumference marker assisted selection; the primer group comprises an upstream primer, a downstream primer and an extension primer; nucleotide sequences of the upstream primer, the downstream primer and the extension primer are respectively shown as SEQ ID NO. 3, SEQ ID NO. 4 and SEQ ID NO. 5; the SNP molecular marker is located at the 61469200 bp site on the chromosome 3 of the sheep genome, the SNP molecular marker has the C / T base mutation, and the version number of the sheep genome sequence information is ARS-UI_Ramb_v2.

0.

3. Application of a kit for detecting a SNP molecular marker in Huameng mutton sheep adult chest circumference marker assisted selection; the kit comprises a primer group and PCR amplification reagents, the primer group comprises an upstream primer, a downstream primer and an extension primer; nucleotide sequences of the upstream primer, the downstream primer and the extension primer are respectively shown as SEQ ID NO. 3, SEQ ID NO. 4 and SEQ ID NO. 5; the SNP molecular marker is located at the 61469200 bp site on the chromosome 3 of the sheep genome, the SNP molecular marker has the C / T base mutation, and the version number of the sheep genome sequence information is ARS-UI_Ramb_v2.

0. The PCR amplification reagents comprise dNTPs, Taq DNA polymerase, MgCl2, a PCR reaction buffer, shrimp alkaline phosphatase and iplex reaction reagents; the kit further comprises a standard positive template DNA. The Huameng mutton sheep adult chest circumference marker assisted selection comprises prediction of Huameng mutton sheep adult chest circumference trait advantage.

4. Use according to claim 3, characterized in that, The method comprises the following steps:

5. The use according to any one of claims 1 to 3, characterized in that, genomic DNA of a sheep to be tested is used as a template, an upstream primer and a downstream primer in a primer group are used to perform a PCR amplification reaction, and a PCR amplification product is obtained; 6. A method of predicting whether a Huamón sheep adult chest girth is advantageous, characterized by, the PCR amplification product is subjected to a digestion reaction, and a digested PCR amplification product is obtained; the digested PCR amplification product is used as a template, an extension primer in the primer group is used to perform an extension reaction, and an extension product is obtained; the extension product is subjected to genotyping, and a genotype result is obtained; the genotype result is used to predict an adult chest circumference trait of the sheep to be tested: when a genotype of the 61469200 bp site on a chromosome 3 of the sheep genome is a CC genotype, the sheep to be tested is a large chest circumference type after adulthood, and has a chest circumference advantage; when the genotype of the 61469200 bp site on the chromosome 3 of the sheep genome is a CT genotype, the sheep to be tested is a small chest circumference type after adulthood, and does not have the chest circumference advantage. ​ ​ The primer set comprises an upstream primer, a downstream primer and an extension primer; the nucleotide sequences of the upstream primer, the downstream primer and the extension primer are respectively shown as SEQ ID NO. 3, SEQ ID NO. 4 and SEQ ID NO. 5; The version number of the sheep genome sequence information is ARS-UI_Ramb_v2.

0.

7. The method of claim 6, wherein, The reaction system of the PCR amplification reaction is 5 µL, including the following components: 20-50 ng / µL genomic DNA 1 µL, PCR reaction buffer 0.5 µL, 25 mmol / L MgCl2 0.4 µL, 25 µmol / L dNTPs 0.1 µL, 0.5 µmol / L PCR primer mixture 1 µL, 5 U / µL Taq DNA polymerase 0.2 µL and deionized water 1.8 µL; The program of the PCR amplification reaction is 95 ℃ pre-denaturation for 2 min; 95 ℃ denaturation for 30 s, 56 ℃ annealing for 30 s, 72 ℃ extension for 60 s, a total of 45 cycles; 72 ℃ for 5 min.

8. The method of claim 6, wherein, The digestion system of the digestion reaction is 2 µL, including: shrimp alkaline phosphatase Buffer 0.17 µL, 1.7 U / µL shrimp alkaline phosphatase 0.3 µL and deionized water 1.53 µL; The program of the digestion reaction is: 37 ℃ for 40 min, 85 ℃ for 5 min.

9. The method of claim 6, wherein, The extension system of the extension reaction is 2 µL, including: iplex Buffer Plus 0.2 µL, iplex Terminator 0.2 µL, extension primer 0.94 µL, iplex enzyme 0.041 µL and deionized water 0.619 µL; The program of the extension reaction is: 94 ℃ for 30 s; [94 ℃ for 5 s, (52 ℃ for 5 s, 80 ℃ for 5 s)], wherein the (52 ℃ for 5 s, 80 ℃ for 5 s) is performed for 5 cycles, and the [94 ℃ for 5 s, (52 ℃ for 5 s, 80 ℃ for 5 s)] is performed for 40 cycles; 72 ℃ for 3 min.

Images