A SNP molecular marker related to a chest width trait of sheep, a primer set, a kit and application thereof

By designing SNP molecular markers on chromosome 7 of the sheep genome, this technique solves the technical problem of identifying SNP molecular markers for the PPP2R5E gene in sheep breeding, thereby improving the efficiency of sheep breeding and addressing the issue of low breeding efficiency.

CN118726614BActive Publication Date: 2025-11-28INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411096636.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-08-12
Publication Date
2025-11-28
Estimated Expiration
2044-08-12

AI Technical Summary

Technical Problem

The specific role of the PPP2R5E gene in the chest width trait of sheep has not yet been discovered in the existing technology, resulting in low sheep breeding efficiency and low meat sheep production benefits.

Method used

A molecular marker for the SNP located at 73842000bp on chromosome 7 of the sheep genome was provided. Primers and kits were designed, and genotype prediction of the chest width trait in sheep was achieved through PCR amplification, digestion and extension reactions. Individuals with AA and AG genotypes were then screened for breeding.

Benefits of technology

It significantly improves the breeding efficiency of the chest width trait in sheep, enabling early prediction of chest width dominance in adult sheep and improving meat sheep production performance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118726614B_ABST
    Figure CN118726614B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of SNP molecular markers, and particularly relates to a SNP molecular marker related to a chest width trait of sheep, a primer set, a kit and application thereof. The SNP molecular marker is located at a 73842000bp site on a 7th chromosome of a sheep genome, and G / A base mutation exists in the SNP molecular marker. The SNP molecular marker has significant correlation with the chest width trait of the sheep, enriches a sheep chest width molecular marker database, and it is found through research that the chest width of adult sheep individuals with AA genotypes and AG genotypes is significantly higher than that of sheep individuals with a GG genotype. In the process of sheep breeding, the AA genotypes and AG genotypes of individuals with adult chest width advantages can be selected and reserved, and in particular, individuals with chest width advantages are selected and reserved in the lamb stage, which has potential application value for large-scale molecular breeding of sheep.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of SNP molecular markers, and particularly relates to a SNP molecular marker related to a chest width trait of sheep, a primer set, a kit and application thereof. BACKGROUND

[0002] The chest width is one of important indexes for evaluating the body type and production performance of sheep, and it is very important to identify and utilize the genes affecting the chest width trait of sheep in breeding work, which has important significance for improving breeding efficiency and improving sheep breeds. At present, most sheep breeds are small in size and slow in growth. In recent years, with the increasing demand for mutton in the market and the increasing demand for mutton by the public, the contradiction between the low efficiency of mutton production and the demand for mutton is increasingly prominent, and mutton enterprises use various methods to improve the production efficiency of mutton, among which the molecular marker assisted selection technology can effectively accelerate the genetic progress of sheep.

[0003] The PPP2R5E gene is located on chromosome 7 of sheep, contains 14 exons, the coding region has a total length of 1562 bp, and encodes a protein containing 467 amino acids. The gene is mainly expressed in the white blood cells, brain, colon, skeletal muscle and other tissues of animals, the B regulatory subunit of the PPP2R5E gene can regulate the selectivity and catalytic activity of the substrate, and plays an important role in the development of the digestive system and brain, but the specific role of the sequence polymorphism of the PPP2R5E gene in the chest width of sheep at home and abroad has not been reported, and no SNP site related to the chest width of sheep has been found in the PPP2R5E gene. SUMMARY

[0004] The application aims to provide a SNP molecular marker related to a chest width trait of sheep, a primer set, a kit and application thereof, the SNP molecular marker has significant correlation with the chest width trait of sheep, and enriches the molecular marker database of the chest width of sheep.

[0005] The application provides a SNP molecular marker related to a chest width trait of sheep, the SNP molecular marker is located at a 73842000 bp site on chromosome 7 of a sheep genome, and the SNP molecular marker has G / A base mutation.

[0006] The application further provides a primer set for detecting the SNP molecular marker in the above technical solution, the primer set comprises an upstream primer, a downstream primer and an extension primer; and the nucleotide sequences of the upstream primer, the downstream primer and the extension primer are respectively shown in SEQ ID NO. 3, SEQ ID NO. 4 and SEQ ID NO. 5.

[0007] The application further provides a kit, which comprises the primer set in the above technical solution and PCR amplification reagents.

[0008] Preferably, the PCR amplification reagent comprises dNTPs, Taq DNA polymerase, MgCl2, positive template DNA, shrimp alkaline phosphatase and iplex reaction reagent; the kit further comprises standard positive template DNA.

[0009] The application further provides application of the SNP molecular marker or the primer set or the kit in sheep chest width marker assisted breeding.

[0010] Preferably, the sheep chest width marker assisted breeding comprises prediction of chest width trait advantage of adult sheep.

[0011] The application further provides a method for predicting whether an adult sheep has chest width advantage, comprising the following steps:

[0012] Taking genomic DNA of the sheep to be tested as a template, performing PCR amplification reaction by using the upstream primer and the downstream primer in the primer set, and obtaining a PCR amplification product;

[0013] Performing digestion reaction on the PCR amplification product, and obtaining a digested PCR amplification product;

[0014] Taking the digested PCR amplification product as a template, performing extension reaction by using the extension primer in the primer set, and obtaining an extension product;

[0015] Performing genotyping on the extension product, and obtaining a genotype result;

[0016] According to the genotype result, predicting the adult chest width of the sheep to be tested: when the genotype of the sheep at the 73842000bp site on the 7th chromosome is AA genotype, the sheep to be tested is high chest width type after adulthood, and has chest width advantage;

[0017] When the genotype of the sheep at the 73842000bp site on the 7th chromosome is AG genotype, the sheep to be tested is medium chest width type after adulthood, and has chest width advantage;

[0018] When the genotype of the sheep at the 73842000bp site on the 7th chromosome is GG genotype, the sheep to be tested is low chest width type after adulthood, and does not have chest width advantage.

[0019] Preferably, the reaction system of the PCR amplification reaction is 5 μL, including the following components: 20-50 ng / μL genomic DNA 1 μL, PCR reaction buffer 0.5 μL, 25 mmol / L MgCl2 0.4 μL, 25 μmol / L dNTPs 0.1 μL, 0.5 μmol / L PCR primer mixture 1 μL, 5 U / μL Taq DNA polymerase 0.2 μL and deionized water 1.8 μL;

[0020] The program of the PCR amplification reaction is 95 ℃ pre-denaturation for 2 min; 95 ℃ denaturation for 30 s, 56 ℃ annealing for 30 s, 72 ℃ extension for 60 s, a total of 45 cycles; 72 ℃ for 5 min.

[0021] Preferably, the digestion system of the digestion reaction is 2 μL, including: shrimp alkaline phosphatase Buffer 0.17 μL, 1.7 U / μL shrimp alkaline phosphatase 0.3 μL and deionized water 1.53 μL;

[0022] The program of the digestion reaction is: 37 ℃ for 40 min, 85 ℃ for 5 min.

[0023] Preferably, the extension system of the extension reaction is 2 μL, including: iplex BufferPlus 0.2 μL, iplex Terminator 0.2 μL, extension primer 0.94 μL, iplex enzyme 0.041 μL and deionized water 0.619 μL;

[0024] The program of the extension reaction is: 94 ℃ for 30 s;

[0025] [94 ℃ 5 s, (52 ℃ 5 s, 80 ℃ 5 s)], wherein the (52 ℃ 5 s, 80 ℃ 5 s) is performed for 5 cycles, and the [94 ℃ 5 s, (52 ℃ 5 s, 80 ℃ 5 s)] is performed for 40 cycles; 72 ℃ for 3 min.

[0026] Beneficial effects:

[0027] The application provides a SNP molecular marker related to a chest width trait of sheep, the SNP molecular marker is located at a 73842000 bp site on a 7th chromosome of a sheep genome, and the SNP molecular marker has G / A base mutation. The SNP molecular marker has significant correlation with the chest width trait of sheep, and enriches a chest width molecular marker database of sheep. It is found through research that the chest width of sheep individuals with AA genotypes and AG genotypes is significantly higher than that of sheep individuals with a GG genotype, in the process of sheep breeding, the AA genotypes and AG genotypes with advantages in adult chest width can be selected and reserved, especially the individuals with advantages in chest width are selected and reserved in the lamb stage, and the method has potential application value in large-scale molecular breeding of sheep.

[0028] Based on the SNP molecular marker, a primer set for detecting the SNP molecular marker, a kit for detecting the SNP molecular marker, and a method for detecting the chest width trait of sheep are further provided. BRIEF DESCRIPTION OF DRAWINGS

[0029] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced.

[0030] Figure 1 Sequenom MassARRAY iPLEX platform in Example 1. SNP technology for genotyping results of three genotypes of SNP sites in 382 sheep individuals. DETAILED DESCRIPTION

[0031] The present application provides a SNP molecular marker related to the chest width trait of sheep, wherein the SNP molecular marker is located at the 73842000bp site on the 7th chromosome of the sheep genome, and the SNP molecular marker has a G / A base mutation.

[0032] The SNP molecular marker is located in the PPP2R5E gene of the sheep, and the version number of the sheep genome sequence information is preferably ARS-UI_Ramb_v2.0. The nucleotide sequence containing the SNP molecular marker is preferably as shown in SEQ ID NO. 1 or SEQ ID NO. 2, i.e. the base at the 201bp position of the nucleotide shown in SEQ ID NO. 1 or SEQ ID NO. 2 is A or G, and the specific position is as follows, wherein the bold italic underlined base position is the position of the SNP molecular marker.

[0033] SEQ ID NO. 1: 5'-CCACTGTCTCATTTTACAAATGAAAAAAAACCCAAA GAACATTAAGTGGCATGTTCCAGGTCATTCAACTGACTGATATACCAAGTGGTAGCCCCAGAACTTCTGGTTCCTAGCCTAGCATCTCTAGTGTCTTATCTGGTATTTCATAATCCCTCTTGAATGTCCTAATCTAGATGTGATTTGCATTTATGTTGACAATT GTTTTGACAAAGATAACTACTTTAAACAGACATTTCTCACGCTTCATTTTACTATCCTACAGATCATTTCAACTGAGCCTCAGAGTTTACCCATCTATGGAAGTGGTGGTGGTGGTGGTGGTGGTGGATATGCTTTTTGGGCACTGTGAATTTTTCTTATACGAACATATCTCCCCTTGGATTTTGGAAGTCTATGAAAAA-3';

[0034] SEQ ID NO. 2: 5'- CCACTGTCTCATTTTACAAATGAAAAAAAACCCAAA GAACATTAAGTGGCATGTTCCAGGTCATTCAACTGACTGATATACCAAGTGGTAGCCCCAGAACTTCTGGTTCCTAGCCTAGCATCTCTAGTGTCTTATCTGGTATTTCATAATCCCTCTTGAATGTCCTAATCTAGATGTGATTTGCATTTATGTTGACAATT A TTTTGACAAAGATAACTACTTTAAACAGACATTTCTCACGCTTCATTTTACTATCCTACAGATCATTTCAACTGAGCCTCAGAGTTTACCCATCTATGGAAGTGGTGGTGGTGGTGGTGGTGGTGGATATGCTTTTTGGGCACTGTGAATTTTTCTTATACGAACATATCTCCCCTTGGATTTTGGAAGTCTATGAAAAA-3'.

[0035] The SNP molecular marker has significant correlation with the chest width trait of sheep, and the chest width of adult sheep individuals with AA genotype and AG genotype is significantly higher than that of sheep individuals with GG genotype.

[0036] The application further provides a primer set for detecting the SNP molecular marker.

[0037] The nucleotide sequences of SEQ ID NO. 3, SEQ ID NO. 4 and SEQ ID NO. 5 are as follows:

[0038] SEQ ID NO. 3: 5'-ACGTTGGATGCCCTCTTGAATGTCCTAATC-3';

[0039] SEQ ID NO. 4: 5'-ACGTTGGATGGGATAGTAAAATGAAGCGTG-3';

[0040] SEQ ID NO. 5: 5'-AGTTATCTTTGTCAAAA-3'.

[0041] The application further provides a kit comprising the primer set and the PCR amplification reagent.

[0042] The PCR amplification reagent preferably comprises Sequenom MassARRAY SNP genotyping reagents, and further preferably comprises but is not limited to dNTPs, Taq DNA polymerase, MgCl2, PCR reaction buffer, shrimp alkaline phosphatase (SAP) and iplex reaction reagent. The application does not have special limitations on the dosage of each component in the PCR amplification reagent, and the combination can be carried out according to the needs. The use concentration of the upstream primer and the downstream primer is preferably independently 0.45-0.55 μmol / L, and more preferably independently 0.50 μmol / L; and the concentration of the extension primer in the primer set is preferably 0.6-1.3 μmol / L. The use concentration of the dNTPs is preferably 20-30 μmol / L, and more preferably 25 μmol / L; the use concentration of the Taq DNA polymerase is preferably 4-6 U / μL, and more preferably 5 U / μL; the use concentration of the MgCl2 is preferably 20-30 mmol / L, and more preferably 25 mmol / L; the PCR reaction buffer is preferably 10× PCR reaction buffer; and the enzyme activity of the shrimp alkaline phosphatase is preferably 1.7 U / μL. The iplex reaction reagent preferably comprises iplex BufferPlus, iplex Terminator and iplex enzyme. The kit preferably further comprises shrimp alkaline phosphatase Buffer. The kit preferably further comprises standard positive template DNA; the genotype of the standard positive template DNA is GG, and the standard positive template DNA serves as a positive control to increase the accuracy of SNP site detection.

[0043] The application further provides application of the SNP molecular marker, the primer set or the kit in sheep chest width marker assisted breeding.

[0044] Specifically, the application further provides a method for predicting whether an adult sheep has chest width advantage, comprising the following steps:

[0045] The genomic DNA of the sheep to be tested is used as a template, and the upstream primer and the downstream primer in the primer set are used for PCR amplification to obtain a PCR amplification product;

[0046] The PCR amplification product is subjected to a digestion reaction to obtain a digested PCR amplification product;

[0047] The digested PCR amplification product is used as a template, and the extension primer in the primer set is used for extension reaction to obtain an extension product;

[0048] The extension product is subjected to genotyping to obtain a genotype result;

[0049] The adult chest width of the sheep to be tested is predicted according to the genotype result: when the genotype of the sheep at the 73842000bp site on chromosome 7 is AA genotype, the sheep to be tested is high chest width type after adulthood and has chest width advantage;

[0050] When the genotype of the sheep at the 73842000bp site on chromosome 7 is AG genotype, the sheep to be tested is medium chest width type after adulthood and has chest width advantage;

[0051] When the genotype of the sheep at the 73842000bp site on chromosome 7 is GG genotype, the sheep to be tested is low chest width type after adulthood and has no chest width advantage.

[0052] The present application preferably extracts the genomic DNA of the sheep to be tested. The sheep to be tested according to the present application is preferably a lamb stage sheep. The present application does not have special requirements for the species of the sheep to be tested, and any species of sheep can be detected using the method of the present application. In an embodiment of the present application, Huameng mutton sheep are used. The present application does not have special limitations on the extraction method of the genomic DNA of the sheep to be tested, and the conventional animal cell genomic extraction method in the art can be used. In an embodiment of the present application, red blood cell lysate is used to lyse and remove red blood cells not containing DNA, cell nucleus lysate is used to lyse red blood cells to release genomic DNA, then protein lysate is used to selectively precipitate and remove proteins, finally isopropanol is used for precipitation, and the genomic DNA is dissolved in a DNA dissolving solution to obtain pure genomic DNA.

[0053] After obtaining the genomic DNA of the sheep to be tested, the genomic DNA of the sheep to be tested is used as a template, and the upstream primer and the downstream primer in the primer set according to the above technical solution are used for PCR amplification reaction to obtain a PCR amplification product. The reaction system of the PCR amplification reaction according to the present application is 5 μL, and preferably includes the following components: 20-50 ng / μL genomic DNA 1 μL, PCR reaction buffer 0.5 μL, 25 mmol / L MgCl2 0.4 μL, 25 μmol / L dNTPs 0.1 μL, 0.5 μmol / L PCR primer mixture 1 μL, 5 U / μL Taq DNA polymerase 0.2 μL, and deionized water 1.8 μL. The program of the PCR amplification reaction according to the present application is preferably: 95°C pre-denaturation for 2 min; 95°C denaturation for 30 s, 56°C annealing for 30 s, 72°C extension for 60 s, a total of 45 cycles; 72°C for 5 min. The present application preferably stores the obtained PCR amplification product at 4°C. After the PCR amplification reaction, the DNA fragment containing the SNP site is contained in the PCR amplification product.

[0054] After obtaining the PCR amplification product, shrimp alkaline phosphatase is used for digestion reaction of the PCR amplification product to obtain a digested PCR amplification product. The digestion system of the digestion reaction according to the present application is 2 μL, and preferably includes: shrimp alkaline phosphatase Buffer 0.17 μL, 1.7 U / μL shrimp alkaline phosphatase 0.3 μL, and deionized water 1.53 μL. The program of the digestion reaction according to the present application is preferably: 37°C for 40 min, 85°C for 5 min. The digested PCR amplification product according to the present application is preferably stored at 25°C. The digestion reaction according to the present application digests the primer sequence and the remaining dNTPs in the PCR amplification reaction system.

[0055] After obtaining the PCR amplification product after the digestion, the present application uses the PCR amplification product after the digestion as a template, and uses the extension primer in the primer set in the technical solution to perform an extension reaction to obtain an extension product. The extension system of the extension reaction in the present application preferably includes, in 2 μL: iplex Buffer Plus 0.2 μL, iplex Terminator 0.2 μL, extension primer 0.94 μL, iplex enzyme 0.041 μL, and deionized water 0.619 μL. The procedure of the extension reaction in the present application is preferably: 94°C for 30 s; [94°C for 5 s, (52°C for 5 s, 80°C for 5 s)], wherein the (52°C for 5 s, 80°C for 5 s) is performed for 5 cycles, and the [94°C for 5 s, (52°C for 5 s, 80°C for 5 s)] is performed for 40 cycles; 72°C for 3 min. The iplex Buffer Plus, iplex Terminator, and iplex enzyme in the extension system in the present application are preferably derived from the iplex Gold Reagent Set kit. Gold Reagent Set kit. In the process of the extension reaction in the present application, single-base extension is performed on the SNP site to be detected in the extension system, and the site-specific extension primer will be extended by one base at the mutation site and terminated. The extension primer will be connected with different ddNTPs according to the difference in the mutation type, to form a difference in molecular weight. After obtaining the extension product, the present application preferably performs resin purification on the extension product. The method of the resin purification in the present application is not particularly limited, and a conventional resin purification in the art can be used.

[0056] After obtaining the extension product, the present application performs genotyping on the extension product by using matrix-assisted laser desorption ionization time-of-flight mass spectrometry, to obtain a genotype result. The present application preferably spots the extension product on a target sheet, and uses a mass spectrometer to detect the difference in molecular weight of different extension products, and through data analysis, the specific genotype of the mutation site of each sample to be detected is obtained. Specifically, in the process of performing the genotyping by using the matrix-assisted laser desorption ionization time-of-flight mass spectrometry, the mass spectrometry spotting is preferably performed by using a MassARRAY Nanodispenser RS1000; and the mass spectrometry analysis is preferably performed by using a MassARRAY Compact System. After the mass spectrometry analysis, the present application preferably uses Typer 4.0 software to detect the mass spectrometry peaks, and judges the genotype of the target site of each sample according to the mass spectrometry peak graph.

[0057] The method in the present application is actually based on Sequenom SNP technology, and the Sequenom The basic principle of the SNP technology is as follows: first, the DNA fragment in which the target SNP site is located is amplified by using an upstream primer and a downstream primer, SAP enzyme is added to the amplification product to digest the primer sequence and residual dNTPs in the reaction system, then the target SNP site is subjected to single base extension by using an extension primer, and the site-specific extension primer will be extended by one base at the mutation site and terminated. The extension product will be connected with different ddNTPs according to the difference of the mutation type, and the molecular weight difference is formed. After the extension product is purified by resin, it is spotted on a target sheet, and the mass spectrometer is used to detect the molecular weight difference of different extension products, and through data analysis, the specific genotype of each mutation site can be obtained.

[0058] After obtaining the genotype result, the adult chest width of the sheep to be tested is judged according to the genotype result: when the genotype of the 73842000bp site on the 7th chromosome of the sheep genome is AA genotype, the sheep to be tested has high chest width type after adulthood, and has chest width advantage; when the genotype of the 73842000bp site on the 7th chromosome of the sheep genome is AG genotype, the sheep to be tested has medium chest width type, and has chest width advantage; when the genotype of the 73842000bp site on the 7th chromosome of the sheep genome is GG genotype, the sheep to be tested has low chest width type, and has no chest width advantage. The genotype with chest width advantage in the application is preferably AA genotype, that is, the sheep to be tested has high chest width type after adulthood, and has more chest width advantage.

[0059] That is, the method of the application uses Sequenom The SNP technology is used to screen the sheep with AA genotype and AG genotype of the SNP site for subsequent breeding. The method of the application can select and keep the individuals with AA and AG genotypes with chest width advantage, improve the production performance of sheep, and has great application value for large-scale molecular breeding of sheep.

[0060] In order to further illustrate the application, the technical solutions provided by the application are described in detail below in combination with the drawings and examples, but they should not be understood as limiting the scope of the application.

[0061] The following examples are used to illustrate the application, but not to limit the scope of the application. If not specifically indicated, the examples are carried out according to the conventional experimental conditions, such as Sambrook et al. Molecular Cloning Laboratory Manual (Sambrook J & Russell DW, Molecular Cloning: A Laboratory Manual, 2001), or according to the conditions suggested by the manufacturer's instructions.

[0062] Example 1

[0063] A method for detecting SNP at position 73842000 on chromosome 7 of sheep and predicting whether the chest width of the sheep after adulthood has an advantage by using Sequenom SNP technology

[0064] 1. Experimental materials

[0065] Select 382 Inner Mongolia Huameng mutton sheep with adult sheep chest width records.

[0066] 2. Reagents and instruments

[0067] Reagent: Complete Genotyping Reagent Kit for MassARRAY® System Compact 384; Gene amplification: ABI 9700 384 Dual;

[0068] Mass spectrometry spotting: MassARRAY Nanodispenser RS1000;

[0069] Mass spectrometry analysis: MassARRAY Compact System;

[0070] All reagents and instruments are purchased from Beijing Genenode Biotech Co., Ltd.

[0071] 3. Extraction of genomic DNA

[0072] 1 mL of blood was collected from the jugular vein of sheep at 1 month after birth and treated with EDTA anticoagulation. First, the red blood cells were lysed to remove DNA-free red blood cells, the red blood cells were lysed with a cell nucleus lysate to release genomic DNA, then the proteins were selectively precipitated to remove proteins, and finally the pure genomic DNA was precipitated by isopropanol and redissolved in DNA dissolution solution.

[0073] 4. Sequenom SNP technology for genotyping

[0074] For the 73842000 bp site (XM_004010710.5) on chromosome 7 of sheep, a primer combination was designed based on the sheep genome sequence information version number ARS-UI_Ramb_v2.0):

[0075] The nucleotide sequence of the PCR amplification primer is as follows:

[0076] Upstream primer F: 5'-ACGTTGGATGCCCTCTTGAATGTCCTAATC-3' (SEQ ID

[0077] ​No.3)

[0078] Downstream primer R: 5'-ACGTTGGATGGGATAGTAAAATGAAGCGTG-3' (SEQ ID

[0079] No.4)

[0080] The extension primer sequence and the extension product are shown in Table 1:

[0081] Table 1 Extension primer sequence and extension product

[0082]

[0083] The above primers are synthesized by JUNO DE Corporation.

[0084] The detection process is as follows:

[0085] 1. Extract the genomic DNA of the sheep to be tested;

[0086] 2. Use the genomic DNA of the sheep to be tested as a template, and use the upstream primer F and the downstream primer R to perform PCR amplification reaction; in addition, two standard positive templates DNA are added, and the genotype of the 73842000bp site on chromosome 7 (based on the sheep genome sequence information version number ARS-UI_Ramb_v2.0) is GG.

[0087] The reaction system of the PCR amplification reaction is 5μL: 20-50ng / μL genomic DNA 1μL, 10×PCR reaction buffer 0.5μL, 25mmol / L MgCl2 0.4μL, 25μmol / L dNTPs 0.1μL, PCR Primer mix 1μL, 5U / μL Taq DNA polymerase 0.2μL, and deionized water is added to 5μL;

[0088] The PCR amplification reaction program is: 95℃ 2min, 95℃ 30s, 56℃ 30s, 72℃ 60s, 45 cycles; 72℃ 5min.

[0089] 3. Digest the PCR amplification product with SAP enzyme; digest the PCR amplification product, mainly use SAP enzyme to remove the remaining primers and dNTPs in the reaction product. The SAP enzyme digestion system is 2μL: SAP Buffer 0.17μL, SAP Enzyme 0.3μL, and deionized water is added to 2μL; the reaction conditions are: 37℃ 40min, 85℃ 15min, 25℃ storage.

[0090] 4. Using the digestion PCR amplification product as a template, the extension primer S1 is used to perform an extension reaction; the extension reaction system is 2 μL: iplex Buffer 0.2 μL, Terminator mix 0.2 μL, extension primer 0.94 μL, iplex Enzyme 0.041 μL, and deionized water is added to 2 μL;

[0091] The extension reaction conditions are: [94℃ 5s, (52℃ 5s, 80℃ 5s)]; wherein the (52℃ 5s, 80℃ 5s) is performed for 5 cycles, and the [94℃ 5s, (52℃ 5s, 80℃ 5s)] is performed for 40 cycles.

[0092] 5. The extension product is analyzed, so as to identify the genotype of the sheep PPP2R5E gene.

[0093] The extension product after resin purification is moved to a 384-well SpectroCHIP (Sequenom) chip to perform a MALDI-TOF-MS (matrix-assisted laser desorption ionization time-of-flight mass spectrometry) reaction, and a Typer4.0 software is used to detect the mass spectrometry peak, and the genotypes of different sample target sites are determined according to the mass spectrometry peak graph.

[0094] The mass spectrometry detection result of the extension product is shown in Figure 1 , wherein the blue right triangle represents the GG genotype, the yellow inverted triangle represents the AA genotype, and the green square represents the AG genotype.

[0095] Statistical results: the statistical results of the correlation analysis of different genotypes of the sheep at the 73842000bp site on the 7th chromosome and the Hu Mutton sheep adult (2 years old) chest width are shown in Table 2.

[0096] Table 2 Correlation analysis of different genotypes of the sheep at the 73842000bp site on the 7th chromosome and the Hu Mutton sheep adult chest width

[0097]

[0098] The superscript different lowercase letters in the last column represent significant differences (P<0.05).

[0099] The results in Figure 1 and Table 2 show that the chest width of the adult sheep individuals with the AA genotype and the AG genotype is significantly higher than that of the sheep individuals with the GG genotype.

[0100] From the above examples, it can be concluded that the SNP molecular marker related to the chest width trait of sheep provided by the present application has significant correlation with the adult chest width trait of sheep, and the SNP site can be genotyped to predict whether the sheep has chest width advantage after adulthood at an early stage. The method in the present application can realize automatic detection of the SNP site, and in the process of sheep breeding, individuals with AA and AG genotypes having chest width advantage can be selected and retained, thereby improving the production performance of sheep, and having potential application value for large-scale molecular breeding of sheep.

[0101] Although the above examples have made a detailed description of the present application, it is only a part of the embodiments of the present application, but not all the embodiments, and other embodiments can be obtained according to the present embodiments without creativity, which all belong to the protection scope of the present application.

Claims

1. Application of a SNP molecular marker in marker-assisted breeding of adult chest width in Huameng meat sheep; The SNP molecular marker is located at position 73842000 bp on chromosome 7 of the sheep genome, and the SNP molecular marker has a G / A base mutation; the sheep genome sequence information version number is ARS-UI_Ramb_v2.

0.

2. Application of primer set for detecting SNP molecular markers in marker-assisted breeding of adult chest width in Huameng meat sheep; the primer set includes upstream primer, downstream primer and extension primer; the nucleotide sequences of the upstream primer, downstream primer and extension primer are shown in SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.5, respectively; The SNP molecular marker is located at position 73842000 bp on chromosome 7 of the sheep genome, and the SNP molecular marker has a G / A base mutation; the sheep genome sequence information version number is ARS-UI_Ramb_v2.

0.

3. Application of the SNP molecular marker detection kit in marker-assisted breeding of adult breast width sheep in Huameng meat sheep; the kit includes a primer set and PCR amplification reagents; the primer set includes an upstream primer, a downstream primer, and an extension primer; the nucleotide sequences of the upstream primer, downstream primer, and extension primer are shown in SEQ ID NO.3, SEQ ID NO.4, and SEQ ID NO.5, respectively; The SNP molecular marker is located at position 73842000 bp on chromosome 7 of the sheep genome, and the SNP molecular marker has a G / A base mutation; the sheep genome sequence information version number is ARS-UI_Ramb_v2.

0.

4. The application according to claim 3, characterized in that, The PCR amplification reagents include dNTPs, Taq DNA polymerase, MgCl2, PCR reaction buffer, shrimp alkaline phosphatase, and iplex reaction reagent; the kit also includes standard positive template DNA.

5. The application according to any one of claims 1 to 3, characterized in that, The marker-assisted breeding of adult chest width in Huameng mutton sheep includes the prediction of the dominant trait of chest width in adult Huameng mutton sheep.

6. A method for predicting whether adult chest width is advantageous in Huameng mutton sheep, characterized in that, Includes the following steps: Using the genomic DNA of the sheep to be tested as a template, PCR amplification was performed using the upstream and downstream primers in the primer set to obtain PCR amplification products; The PCR amplification product is digested to obtain the digested PCR amplification product; Using the digested PCR amplification product as a template, an extension reaction was carried out using the extension primers in the primer set to obtain the extension product; The extended product was genotyped to obtain genotype results; Based on the genotype results, the adult chest width of the sheep to be tested was predicted: when the genotype at the 73842000bp site on chromosome 7 of the sheep genome is AA, the adult sheep to be tested will be of the high chest width type and have a chest width advantage. When the genotype at the 73842000bp locus on chromosome 7 of the sheep genome is AG, the tested sheep will be of medium-wide chest type after adulthood, with a wide chest advantage. When the genotype at the 73842000bp locus on chromosome 7 of the sheep genome is GG, the tested sheep will be low-chest and wide-chest type after adulthood and will not have the advantage of chest width. The primer set includes an upstream primer, a downstream primer, and an extension primer; the nucleotide sequences of the upstream primer, the downstream primer, and the extension primer are shown in SEQ ID NO.3, SEQ ID NO.4, and SEQ ID NO.5, respectively; the sheep genome sequence information version number is ARS-UI_Ramb_v2.

0.

7. The method according to claim 6, characterized in that, The PCR amplification reaction system, in 5 µL increments, comprises the following components: 1 µL of 20–50 ng / µL genomic DNA, 0.5 µL of PCR reaction buffer, 0.4 µL of 25 mmol / L MgCl2, 0.1 µL of 25 μmol / L dNTPs, 1 µL of 0.5 μmol / L PCR primer mixture, 0.2 µL of 5 U / µL Taq DNA polymerase, and 1.8 µL of deionized water; The PCR amplification reaction program was as follows: pre-denaturation at 95℃ for 2 min; denaturation at 95℃ for 30 s; annealing at 56℃ for 30 s. Extend at 72℃ for 60 seconds, repeat for 45 cycles; hold at 72℃ for 5 minutes.

8. The method according to claim 6, characterized in that, The digestion system for the digestion reaction comprises, in 2 µL units: 0.17 µL of shrimp alkaline phosphatase buffer, 0.3 µL of 1.7 U / µL shrimp alkaline phosphatase, and 1.53 µL of deionized water; The digestion reaction procedure was as follows: 37℃ for 40 min, 85℃ for 5 min.

9. The method according to claim 6, characterized in that, The extension system for the extension reaction, in 2 µL increments, comprises: 0.2 µL of iplex Buffer Plus, 0.2 µL of iplex Terminator, 0.94 µL of extension primer, 0.041 µL of iplex enzyme, and 0.619 µL of deionized water. The procedure for the extended reaction is: 94℃ for 30s; [94℃ 5s, (52℃ 5s, 80℃ 5s)], wherein (52℃ 5s, 80℃ 5s) is performed for 5 cycles, and [94℃ 5s, (52℃ 5s, 80℃ 5s)] is performed for 40 cycles; 72℃ 3min.