A wild-type-mutant Π protein switching expression system for improving the preparation efficiency of plasmid without screening tags

Abstract

Provided is a precursor plasmid that can be used to prepare a plasmid without a screening tag, which includes: 1) a conditional replication origin site, whose plasmid replication initiation ability depends on a regulatory protein, having a first replication initiation state in the presence of a first regulatory protein and a second replication initiation state in the presence of a second regulatory protein, and having a stronger ability to initiate plasmid replication when the conditional replication origin site is in the second replication initiation state than when it is in the first replication initiation state; 2) a first regulatory protein expression cassette for expressing the first regulatory protein; 3) a coding sequence of a repressor protein; 4) a screening tag gene; 5) a target gene, or a cloning site for inserting a target gene; and 6) a pair of recombination sites. Also provided are host cells suitable for recombination of the precursor plasmid therein to produce a plasmid without a screening tag, and a method for large-scale production of a plasmid without a screening tag.

Description

[0001] Cross - Reference to Related Applications

[0002] This application claims the priority of a Chinese application with the application number CN202210664659.1 filed on June 13, 2022, the entire content of which is incorporated herein by reference. Technical Field

[0003] This article relates to methods and kits for preparing plasmids without selection tags, in particular to methods and kits for using wild-type and mutant Π proteins to orderly control plasmid replication, thereby enabling the large-scale preparation of plasmids without selection tags. Background Art

[0004] In recent years, gene and cell therapy technologies have gradually become new important methods for treating human diseases. Safe and efficient DNA delivery vectors can enable gene and cell therapy to play a greater role in the prevention and treatment of future human diseases. In the past two decades, non-viral delivery systems based on plasmid vectors and plasmid-based viral packaging / delivery systems have received extensive attention in gene defect repair, disease treatment and prevention. Improving the safety, stability and yield of plasmids and reducing cytotoxicity have always been the key research directions of plasmids in the field of gene and cell therapy.

[0005] Plasmid DNA molecules for gene therapy usually have a modular structure, including a eukaryotic transcription unit and a prokaryotic replication unit. In addition to the sequences required for DNA replication, conventional plasmids usually carry at least one antibiotic drug resistance gene to ensure convenient positive clone screening and stable inheritance during the cloning process. Commonly used selection tags include ampicillin, kanamycin, chloramphenicol, neomycin, tetracycline, etc. (Davies, J and Smith, D I (1978). Plasmid-Determined Resistance to Antimicrobial Agents. Annual Review of Microbiology, 32(1), 469–508). However, when applied to gene therapy, plasmid DNA may be absorbed by bacteria present on the surface of the respiratory or digestive tract, and the antibiotic resistance genes carried on the plasmid may cause side effects such as antibiotic resistance in patients, thus promoting the development of plasmids without antibiotic resistance tags.

[0006] Currently, widely used plasmids without antibiotic resistance tags, including Minicircles and plasmids screened based on RNA-OUT, have deleted the antibiotic screening tags, greatly reducing the proportion of bacterial-derived sequences and reducing the toxicity of plasmid vectors to host cells. With the wide application in the field of gene therapy, there is an urgent need to develop methods for producing high-yield and high-purity plasmids without antibiotic resistance tags. SUMMARY OF THE INVENTION

[0007] In one aspect, provided herein are precursor plasmids, comprising:

[0008] 1) a conditional replication origin site, whose plasmid replication initiation ability depends on a regulatory protein, having a first replication initiation state in the presence of a first regulatory protein and a second replication initiation state in the presence of a second regulatory protein, the conditional replication origin site having a stronger ability to initiate plasmid replication when in the second replication initiation state than when in the first replication initiation state;

[0009] 2) a first regulatory protein expression cassette for expressing the first regulatory protein;

[0010] 3) a coding sequence of a repressor protein;

[0011] 4) a selection tag gene;

[0012] 5) a gene of interest, or a cloning site for inserting the gene of interest; and

[0013] 6) a pair of recombination sites,

[0014] wherein the pair of recombination sites can cause the precursor plasmid to undergo self-recombination in the presence of a recombinase to form a daughter plasmid and a circular double-stranded DNA;

[0015] the daughter plasmid comprises the conditional replication origin site and the cloning site, or comprises the conditional replication origin site and the gene of interest;

[0016] the circular double-stranded DNA comprises the selection tag gene, the first regulatory protein expression cassette, and the coding sequence of the repressor protein.

[0017] In some embodiments, when the precursor plasmid is introduced into a host cell expressing the second regulatory protein, the presence of the repressor protein can inhibit the expression of the second regulatory protein in the host cell.

[0018] In some embodiments, the host cell comprises a second regulatory protein expression cassette for expressing the second regulatory protein, the second regulatory protein expression cassette comprising an expression regulatory sequence, and the repressor protein inhibits the expression of the second regulatory protein when binding to the expression regulatory sequence.

[0019] In some embodiments, the repressor protein coding sequence is located in the first regulatory protein expression cassette such that the repressor protein is expressed in tandem with the first regulatory protein.

[0020] In some embodiments, the conditional replication origin site is ori R6Kγ replication origin site.

[0021] In some embodiments, the first regulatory protein is a wild-type Π protein, and the second regulatory protein is a mutant of the wild-type Π protein.

[0022] In some embodiments, the second regulatory protein is the pir-116 encoding gene product.

[0023] In some embodiments, the pir-116 encoding gene comprises the sequence shown in SEQ ID NO: 2.

[0024] In some embodiments, the conditional replication origin comprises the sequence shown in SEQ ID NO: 8, or a nucleotide sequence having at least 80% identity with the sequence shown in SEQ ID NO: 8 and capable of functioning as a replication origin.

[0025] In some embodiments, the sequences of the paired recombination sites are in the same orientation.

[0026] In some embodiments, the paired recombination sites are directly repeated loxP sequences, and the recombinase is Cre recombinase; the paired recombination sites are directly repeated FRT sequences, and the recombinase is Flp recombinase; or the paired recombination sites are directly repeated attB / attP sequences, and the recombinase is PhiC31 recombinase.

[0027] In some embodiments, the paired recombination sites are directly repeated lox71 sequences and lox66 sequences.

[0028] In some embodiments, the repressor protein is LacI protein.

[0029] In some embodiments, the expression regulatory sequence comprises a lacO operator sequence.

[0030] In some embodiments, the lacO operator sequence comprises the sequence shown in SEQ ID NO: 1.

[0031] In some embodiments, the promoter of the first regulatory protein expression cassette is the P lacI q promoter. Preferably, the P lacI q promoter comprises the sequence shown in SEQ ID NO: 20.

[0032] In some embodiments, the selection tag gene is an antibiotic resistance gene.

[0033] On the other hand, the present disclosure provides a host cell, which comprises:

[0034] 1) a recombinase expression cassette expressing a recombinase; and

[0035] 2) A second regulatory protein expression cassette for expressing a second regulatory protein,

[0036] wherein the second regulatory protein expression cassette includes an expression regulatory sequence, and inhibits the expression of the second regulatory protein when a repressor binds to the expression regulatory sequence.

[0037] In some embodiments, the recombinase is Cre recombinase, Flp recombinase or PhiC31 recombinase.

[0038] In some embodiments, the recombinase expression cassette is an inducible recombinase expression cassette; preferably an arabinose-inducible expression cassette.

[0039] In some embodiments, the second regulatory protein is the gene product encoded by pir-116. Preferably, the pir-116 encoding gene includes the sequence shown in SEQ ID NO: 2.

[0040] In some embodiments, the repressor is LacI protein.

[0041] In some embodiments, the expression regulatory sequence includes a lacO operator sequence. Preferably, the lacO operator sequence includes the sequence shown in SEQ ID NO: 1.

[0042] In some embodiments, the recombinase expression cassette and / or the second regulatory protein expression cassette are integrated into the genome of the host cell.

[0043] In some embodiments, the host cell is Escherichia coli.

[0044] On the other hand, the present invention provides a method for preparing a plasmid without a selection tag gene, comprising:

[0045] I) Preparing a precursor plasmid, the precursor plasmid including

[0046] 1) A conditional replication origin, the plasmid replication initiation ability of which depends on a regulatory protein, wherein it has a first replication initiation state in the presence of a first regulatory protein and a second replication initiation state in the presence of a second regulatory protein, and the conditional replication origin has a stronger ability to initiate plasmid replication when in the second replication initiation state than when in the first replication initiation state;

[0047] 2) A first regulatory protein expression cassette for expressing the first regulatory protein;

[0048] 3) The coding sequence of a repressor;

[0049] 4) A selection tag gene;

[0050] 5) A target gene, or a cloning site for inserting the target gene; and

[0051] 6) A pair of recombination sites,

[0052] wherein the pair of recombination sites can cause the precursor plasmid to undergo self - recombination in the presence of a recombinase to form a daughter plasmid and a circular double - stranded DNA; the daughter plasmid includes the conditional replication origin and the cloning site, or includes the conditional replication origin and the target gene; the circular double - stranded DNA includes the screening tag gene, the first regulatory protein expression cassette, and the coding sequence of the repressor protein;

[0053] II) Introducing the precursor plasmid into a host cell, wherein the host cell includes:

[0054] 1) A recombinase expression cassette for expressing the recombinase; and

[0055] 2) A second regulatory protein expression cassette for expressing the second regulatory protein,

[0056] wherein the second regulatory protein expression cassette includes an expression regulatory sequence, and the expression of the second regulatory protein is inhibited when the repressor protein binds to the expression regulatory sequence;

[0057] III) Screening out the host cells expressing the screening tag gene;

[0058] IV) Culturing the host cells screened out in step III), allowing the recombinase to be expressed in the host cells, continuously culturing the host cells and screening out the host cells that do not express the screening tag gene; and

[0059] V) Culturing the host cells screened out in step IV) and extracting the plasmid.

[0060] In some embodiments, when introducing the precursor plasmid into the host cell, the presence of the repressor protein can inhibit the expression of the second regulatory protein in the host cell.

[0061] In some embodiments, the coding sequence of the repressor protein is located in the first regulatory protein expression cassette, such that the repressor protein is expressed in tandem with the first regulatory protein.

[0062] In some embodiments, the conditional replication origin is ori R6Kγ replication origin.

[0063] In some embodiments, the first regulatory protein is wild - type Π protein, and the second regulatory protein is a mutant of wild - type Π protein.

[0064] In some embodiments, the second regulatory protein is the product of the pir-116 encoding gene.

[0065] In some embodiments, the sequences of the paired recombination sites are in the same orientation.

[0066] In some embodiments, the paired recombination sites are directly repeated loxP sequences, and the recombinase is Cre recombinase; the paired recombination sites are directly repeated FRT sequences, and the recombinase is Flp recombinase; or the paired recombination sites are directly repeated attB / attP sequences, and the recombinase is PhiC31 recombinase.

[0067] In some embodiments, the paired recombination sites are directly repeated lox71 sequence and lox66 sequence.

[0068] In some embodiments, the repressor protein is LacI protein, and the expression regulatory sequence includes the lacO operator sequence.

[0069] In some embodiments, the selection tag gene is an antibiotic resistance gene.

[0070] In some embodiments, the recombinase expression cassette is an inducible recombinase expression cassette; preferably an arabinose-inducible expression cassette.

[0071] In some embodiments, the recombinase expression cassette and / or the second regulatory protein expression cassette are integrated into the genome of the host cell.

[0072] In some embodiments, the host cell is Escherichia coli.

[0073] In some embodiments, allowing the recombinase to be expressed in the host cell in step IV) is achieved by adding an inducer corresponding to the inducible recombinase expression cassette to the host cell.

[0074] On the other hand, the present disclosure provides the use of the above-mentioned precursor plasmid or host cell in the preparation of a plasmid without a selection tag gene.

[0075] On the other hand, the present disclosure provides a kit for preparing a plasmid without a selection tag gene, which includes the above-mentioned precursor plasmid and / or host cell.

[0076] In some embodiments, the sub-plasmid can replicate in a host cell. Among them, the host cell can be Escherichia coli. For example, the host cell can be Escherichia coli JM108, TOP10, DH5α, GT115, pir1, pir2, etc., and other modified strains derived from related background strains. The sub-plasmid is fermented and cultured in the host cell and then obtained by plasmid extraction.

[0077] The precursor plasmid, host cell, and / or the above method provided herein can be used for large-scale production of sub-plasmids (plasmids without selection tags) to meet production requirements. Brief Description of the Drawings

[0078] Figure 1 Schematic diagram of the structure of the precursor plasmid provided herein, where R6Kγori: replication origin; Lox71 and Lox66: recombination sites; Redundant backbone include Kan R Gene: backbone sequence containing an antibiotic resistance gene; MSC: multiple cloning site; pirWT-lacI: wild-type Π protein coding gene - operator repressor tandem expression cassette.

[0079] Figure 2 It is an electrophoresis diagram showing the amplification results of pKD46 plasmid fragments, Lac, and pir116 fragments.

[0080] Figure 3 It shows the sanger sequencing results of the constructed pKD46-Lac-pir116 plasmid.

[0081] Figure 4 It is an electrophoresis diagram showing the PCR verification results of the JM108-cre-pir116 engineered strain.

[0082] Figure 5 It shows the sanger sequencing results of the genes of the JM108-cre-pir116 engineered bacteria prepared herein.

[0083] Figure 6 It is an electrophoresis diagram showing the amplification results of pMF5 fragments, lacI fragments, and pirWT-loxp empty plasmid fragments.

[0084] Figure 7 It shows the sanger sequencing results of the constructed pMF5-lacI-pirWT-loxp empty plasmid.

[0085] Figure 8 It is an electrophoresis diagram showing the amplification results of fragments with different sequence lengths.

[0086] Figure 9 It is an electrophoresis diagram showing the verification results after 1 hour of induced recombination.

[0087] Figure 10 It shows the results of screening for clones with lost resistance on the resistance plate.

[0088] Figure 11This is an electrophoresis diagram showing the verification results of the purified plasmid on the resistance plate.

[0089] Figure 12 This is an electrophoresis diagram showing the verification results of the large-scale plasmid extraction. Detailed implementation manners

[0090] Unless otherwise specified, all technical and scientific terms used herein have the meanings commonly understood by those of ordinary skill in the art. For the purpose of facilitating the understanding of the technical solutions provided herein, some technical terms are briefly described below.

[0091] "Plasmid" or "plasmid vector" are used interchangeably herein and refer to a circular DNA molecule with an origin of replication (or a DNA replication element) and thus has the ability to replicate autonomously in a host cell. The plasmid can be a natural plasmid or a modified plasmid. The plasmid can include a selection tag gene, such as an antibiotic resistance gene, so that the host cell containing the plasmid can grow under specific culture conditions, while the host cell without the plasmid cannot grow normally under the specific culture conditions. For example, when a host cell (such as Escherichia coli) contains a plasmid with a tetracycline resistance gene, it can grow in a medium containing tetracycline. When the host cell does not contain or has lost this plasmid, it can no longer grow or its growth is inhibited in a medium containing tetracycline. Therefore, by using the selection tag gene, technicians can know which host cells contain the desired plasmid and complete the screening function. The plasmid can also include or be modified to include a cloning site to facilitate the insertion of a target gene. After the target gene is inserted into the plasmid through the cloning site, it can be replicated together with the plasmid to achieve the amplification of the target gene; or, when the plasmid is constructed into an expression plasmid, it can be used for the expression of the target gene in the host cell. The cloning site can be a single cloning site or a multiple cloning site. For the convenience of experimental operation, a multiple cloning site is usually preferred. A multiple cloning site herein refers to a DNA segment containing multiple sites recognized by a restriction endonuclease or other endonucleases (such as a homing endonuclease). The restriction endonuclease can be, for example, Ahd I, AclI, HindIII, SspI, MluCI, Tsp509I, PciI, AgeI, BspMI, BfuAI, SexAI, MluI, BceAI, Nde I or EcoR I.

[0092] "Precursor plasmid" herein refers to the mother plasmid used to generate the target plasmid / sub-plasmid (such as a plasmid without a selection tag gene). To generate a plasmid without a selection tag gene, usually the selection tag gene is placed between the paired recombination sites (see Figure 1). In this way, when a recombination reaction occurs, one precursor plasmid molecule will form two circular DNA molecules, one of which contains a replication initiation site and a target gene or a cloning site, but does not contain a screening tag gene; correspondingly, the other circular DNA molecule contains a screening tag gene, but does not contain a replication initiation site and a cloning site. The former is also referred to herein as a daughter plasmid or a target plasmid, i.e., a plasmid that does not contain a screening tag gene. For the purposes of the present invention, when referring to a cloning site, it encompasses the cloning site itself, or a cloning site into which a target gene has been inserted. Alternatively, a precursor plasmid (or "platform plasmid") that does not contain a target gene at a cloning site can be considered to be a parent plasmid of a precursor plasmid that contains a target gene at a cloning site, and they are all included in the meaning of "precursor plasmid" herein.

[0093] "Daughter plasmid" is also referred to as "mini plasmid" or "target plasmid" herein, and refers to a sequence containing a replication origin site and a cloning site and / or a target gene generated after a precursor plasmid containing a recombination site (such as a trans-LoxP sequence) undergoes a recombination reaction in the presence of a recombinase (such as Cre recombinase). In some embodiments herein, the daughter plasmid contains a replication origin site and a cloning site and / or a target gene sequence, but does not contain a screening tag gene.

[0094] "Recombination site" refers to a nucleotide sequence that can be specifically recognized by the corresponding recombinase in this article. When the precursor plasmid contains paired recombination sites in the same direction, under the action of the corresponding recombinase, a recombination reaction occurs between the recombination sites in the precursor plasmid, resulting in the generation of a daughter plasmid and a daughter circular DNA. In some embodiments, the recombination site is a loxP sequence, and the corresponding recombinase is a Cre recombinase; in other embodiments, the recombination site is a FRT sequence, and the corresponding recombinase is a Flp recombinase. It can be understood by those skilled in the art that the recombination sites used in the precursor plasmid can cause the sequences between them (including the screening tag gene) to be removed from the precursor plasmid when the recombination reaction occurs, and the remaining sequences form daughter plasmids. Therefore, these recombination sites are not limited to the specific sequences mentioned in this article, but can also be their variants, or other recombination sites. For example, the recombination site LoxP mutant can be lox75, lox44, lox76, lox43, lox72, lox78, lox65, lox511, lox5171 or lox2272. The recombination site FRT can be wild type or mutant, such as FRT3, FRT5. In a specific embodiment of the present invention, the recombination site loxP is lox71 and lox66 sequences, and the nucleotide sequences are shown in SEQ ID NO: 10 and 11 respectively.

[0095] "Host cell" as used herein refers to a cell in which a plasmid can be maintained and / or replicated, including prokaryotic cells and eukaryotic cells, such as bacteria (e.g., Escherichia coli), fungi (yeast), insect cells, and mammalian cells. In the method for preparing a plasmid without a selection tag gene provided herein, the host cell provides the necessary components (e.g., various enzymes and nucleotide monomer molecules, etc.) for plasmid replication and also provides the recombinase required for the recombination reaction. The expression of the recombinase in the host cell is preferably controlled or inducible expression. In some embodiments, the recombinase-encoding gene is integrated into the genome of the host cell. In other embodiments, the recombinase-encoding gene is placed in another expression vector, which can be introduced into the host cell together with the precursor plasmid, before the precursor plasmid, or after the precursor plasmid. In either case, it is preferred to place the recombinase gene under the control of an inducible promoter so that those skilled in the art can control the timing of the recombination reaction.

[0096] "Conditional replication origin" as used herein refers to a replication origin whose initiation of plasmid replication depends on the presence of other factors. In one example, the conditional replication origin is ori R6Kγ , and its initiation of plasmid replication requires the presence of the Π protein.

[0097] "Replication initiation state" as used herein refers to the ability of a replication origin to initiate plasmid replication. Different replication initiation states can be confirmed by detecting the copy number of the plasmid containing the replication origin or its change in the same host cell. The replication origin contained in the precursor plasmid has at least two replication initiation states: a first replication initiation state and a second replication initiation state, wherein the ability of the replication origin to initiate plasmid replication in the first replication initiation state is lower than that in the second replication state. For example, when the replication origin in the plasmid is in the first replication state, the copy number of the plasmid in the host cell is not higher than 15, such as a single-copy plasmid; while when the replication origin is in the second replication state, the copy number of the plasmid in the host cell is significantly higher, such as 50 or more (e.g., 75, 100, 150, 200, or 250). In some embodiments, the first replication initiation state and the second replication initiation state of the replication origin can be controlled or maintained by the presence or absence of a first regulatory protein and a second regulatory protein, respectively, in the host cell. For example, for ori R6KγThe replication origin site, the first regulatory protein can be the wild-type Π protein, and the second regulatory protein can be a mutant of the wild-type Π protein. In a specific example, the mutant of the wild-type Π protein is mutant pir-116 (proline is replaced by leucine at position 106 relative to the wild-type). In some other examples, the mutant of the wild-type Π protein is a mutant different from pir-116, such as pir-42, pir-108, and pir-113, etc. Miron, A et al. have conducted detailed studies on the mechanism of action of different mutants of the Π protein on the ori R6Kγ replication origin site, and have described the methods for obtaining these mutants. See, for example, Miron, A et al., EMBO J., 1992(11):1205-1216, and Miron, A et al., PNAS USA, 1994(91):6438-6442, which are hereby incorporated herein by reference in their entireties.

[0098] In the plasmid recombination and antibiotic-free tag screening stages before large-scale plasmid preparation, it is desired that the plasmid copy number in the host cell is low (such as single copy). Therefore, the replication origin site on the plasmid should be in the first replication initiation state (i.e., the first regulatory protein is present in the host cell). In the large-scale plasmid preparation stage, it is desired that the precursor plasmid copy number in the host cell is high. At this time, the replication origin site on the plasmid should be in the second replication initiation state (i.e., the second regulatory protein is present in the host cell).

[0099] ori R6Kγ is a conditional replication origin site, and replication initiation depends on the Π protein encoded and expressed by the pir gene. To maintain the conditional replication of a plasmid containing ori R6Kγ but lacking the pir gene, the Π protein is expressed by the pir gene located on a compatible plasmid in a trans-regulatory manner, or is expressed by the pir gene inserted into the host chromosome through homologous recombination. Generally, some mutations in the pir gene can change the R6K plasmid copy number, and the mutant pir-116 has been determined to be able to increase the plasmid copy number. An ori R6Kγ plasmid remains at 15 copies or less per cell in a wild-type pir + host, depending on the size of the ori R6Kγ plasmid; the mutant pir-116 is obtained by replacing proline with leucine at the 106th position starting from the start codon of the pir gene, and the ori R6Kγ plasmid remains at 250 copies per cell in the mutant. ori R6Kγ While minimizing the DNA delivery vector, it can largely avoid the uncontrolled overexpression of the delivered plasmid in vivo, which is the preferred goal of the DNA delivery vector.

[0100] In the international patent application PCT / CN2021 / 133141 "plasmid system without selectable markers and production method thereof" submitted by the inventor in the early stage of research, a safe and efficient DNA delivery vector was developed and produced. Compared with the existing Minicircles and plasmid delivery vectors based on RNA-OUT screening, this plasmid vector only carries one DNA replication element, such as ori puc 、ori R6Kγ , while reducing the proportion of bacterial source sequences, it can also meet the needs of plasmid autonomous replication, simple production process, and scalable production. R6Kγ Minimization of DNA delivery vectors can be achieved.

[0101] In order to further optimize the non-selective tag plasmid system and production method, and to reduce the proportion of bacterial-derived sequences in the produced plasmid while increasing the plasmid yield, the present application provides a wild-type-mutant II protein switching expression system that can improve the efficiency of non-selective tag plasmid preparation. In this system, pir + The (wild type) and pir-116 genes are located on the precursor plasmid and the E. coli chromosome, respectively, and are expressed sequentially during gene expression without the need for an additional induction process. During the small-volume culture stage, the expression of the pir-116 gene is repressed and replicated at a low copy rate, controlling the precursor plasmid to complete recombination and screening of plasmids without screening tags in a haploid form; during the large-scale preparation stage, pir + The gene is lost after recombination, and the pir-116 gene starts to express, replicates in high copies, increases plasmid yield, and completes large-scale production of non-selective label plasmids. This recombination system successfully achieves the goal of simultaneously reducing the proportion of bacterial-derived sequences in the produced plasmid and increasing plasmid yield.

[0102] In some embodiments, the method for preparing a non-selectable tag plasmid provided herein comprises:

[0103] (1) Based on the constructed JM108-araBAD-cre Escherichia coli engineering strain, a mutant II protein manipulation expression system was further constructed, and the mutant II protein was encoded by the pir-116 gene;

[0104] (2) constructing a precursor plasmid of the R6K replication system that can be reorganized into a ring, wherein the precursor plasmid contains the target gene, the R6K replication element, a pair of unidirectional specific recombination sites, an antibiotic resistance gene, lacI q lacI q The promoter tandemly expresses the lacI gene and the wild-type II protein encoding gene pirWT;

[0105] (3) transforming the above precursor plasmid into the JM108-araBAD-cre-pir116 engineered strain and screening positive clones;

[0106] (4) Cultivating cells, the precursor plasmid replicates at a low copy under the action of the II protein expressed by the pirWT gene; inducing the expression of the recombinase to cause the precursor plasmid to undergo self-recombination, and one molecule of the precursor plasmid forms one molecule of a non-resistance screening tag mini-plasmid containing the target gene and the R6K replication element and one molecule of a circular double-stranded DNA containing a plasmid backbone sequence such as an antibiotic resistance gene, a lacI gene, and a pirWT gene;

[0107] (5) Isolation and purification, screening out monoclonal strains without antibiotic resistance, and the plasmid without antibiotic resistance screening tag replicates at high copy under the action of the II protein encoded and expressed by the pir-116 gene;

[0108] (6) Cultivate cells and extract plasmids.

[0109] In a more specific embodiment, the method for preparing a non-selective tag plasmid provided herein comprises:

[0110] (1) Constructing a mutant II protein manipulation expression system. The mutant II protein manipulation expression system is integrated into the genome of an Escherichia coli engineering bacterium that already contains a site-specific recombinase inducible expression system for expression. The mutant II protein manipulation expression system comprises: the expression control region of the Lac operon, including a promoter (such as P lacUV5-tac promoter) and an operating sequence (such as a lacO operating sequence), a mutant II protein encoding gene pir-116, and a transcription terminator.

[0111] (2) Construct a precursor plasmid that can be reorganized into a circle. The precursor plasmid contains: DNA replication element ori R6Kγ , target gene, a pair of specific recombination sites in the same direction, a screening tag gene (such as an antibiotic resistance gene), a tandemly expressed Lac operon repressor protein encoding gene lacI and a wild-type II protein encoding gene pirWT (the tandem genes are represented by P lacI q Initiate expression), the target gene does not contain specific recombination sites of the same type as the plasmid backbone. In addition to the target gene sequence and DNA replication elements, plasmid backbone sequences such as screening tag genes and tandem expression genes are located inside a pair of unidirectional specific recombination sites. After induced recombination, the precursor plasmid can be reconstructed under the action of site-specific recombinases and split to form two circular double-stranded DNAs, one of which contains plasmid backbone sequences such as screening tag genes and tandem expression genes, does not have replication ability, and can be gradually lost during cell amplification; the other is a mini-plasmid containing only DNA replication elements and target gene sequences, which can continue to amplify as the cells proliferate.

[0112] (3) Transform the precursor plasmid in the above genetically modified strain and screen for positive clones. Prepare the above genetically modified strain into competent cells, transform the precursor plasmid, and use the selective medium corresponding to the screening tag gene on the precursor plasmid to screen for positive clones.

[0113] (4) Culture the cells and induce recombination. Pick the transformed positive clones in (3) and culture them overnight in a liquid medium containing antibiotics to enrich the bacteria. The pirWT gene carried by the precursor plasmid encodes and expresses Π protein, which regulates the replication of the R6K replicon to complete plasmid replication. At the same time, the expression product of the lacI gene binds to the operator gene of the Lac operon of the mutant Π protein expression system on the Escherichia coli genome, repressing the expression of the mutant Π protein by the pir-116 gene. Wash the cells with a liquid medium without selective pressure, resuspend the bacteria with a medium without selective pressure containing an inducer, and induce the expression of recombinase to cause recombination between the two recombination sites carried by the plasmid itself, deleting the plasmid backbone sequences such as antibiotic resistance genes and tandem expression genes between the recombination sites, forming a mini plasmid without a screening tag. As recombination occurs, the tandem expression genes of the precursor plasmid are gradually lost during cell amplification, and the repression of the expression of the pir-116 gene encoded by the lacI gene expression product gradually weakens, so the coding gene of Π protein gradually switches from pirWT of the precursor plasmid to pir-116 of the Escherichia coli genome.

[0114] (5) Isolate and purify, and screen for monoclonal strains without antibiotic resistance. Streak the completely recombined bacterial liquid in (4) on a plate without selective pressure to isolate single colonies. Pick multiple single colonies and spot them on a resistance plate, and correspondingly inoculate them into a non-resistant LB liquid medium and culture overnight. Select the colonies that cannot grow on the resistance plate and can grow in the non-resistant LB liquid medium, and culture them to obtain strains containing only the plasmid without a screening tag.

[0115] (6) Culture the strain obtained in (5) in a non-resistant medium, extract the plasmid, and obtain the final product of the mini plasmid without a screening tag.

[0116] The plasmid without an antibiotic gene and its production method provided in this article can be used as a DNA delivery vector or a viral packaging plasmid vector, and are applied in the fields of gene and cell therapy to improve the safety and stability of the plasmid and reduce cytotoxicity.

[0117] The beneficial technical effects of the present invention include but are not limited to:

[0118] 1. The plasmid has no antibiotic screening tag and no redundant prokaryotic DNA elements except for the replication site;

[0119] 2. No antibiotic drugs are added during the plasmid production process;

[0120] 3. High plasmid yield, enabling large-scale production;

[0121] 4. Improve the purification efficiency of the sub-plasmid during the preparation process.

[0122] The technical solutions of the present invention will be further described in detail below through examples and in conjunction with the accompanying drawings. Unless otherwise specified, the methods and materials described in the following examples are conventional products that can be obtained through market purchases. Those skilled in the art to which the present invention pertains will understand that the methods and materials described below are merely exemplary and should not be regarded as limiting the scope of the present invention.

[0123] Example 1: Establishment of the Π protein mutant manipulation expression system in Escherichia coli

[0124] The inventors have constructed an Escherichia coli JM108 engineered strain (JM108-araBAD-cre engineered bacteria, see Example 1 of PCT / CN2021 / 133141) containing a site-specific recombinase inducible expression system in the international application PCT / CN2021 / 133141 "plasmid system without selectable markers and production method thereof" submitted on November 25, 2021. The brief preparation process of the JM108-araBAD-cre engineered bacteria is as follows:

[0125] 1. The cre fragment (SEQ ID NO: 13) was synthesized by Nanjing GenScript Biotechnology Co., Ltd.

[0126] 2. The pKD46 plasmid was treated with the restriction endonuclease EcoR I to obtain the pSC101-araBAD linear fragment. The pKD46 plasmid can be referred to NCBI Sequence ID: AY048746.1;

[0127] 3. Assembled to obtain the pSC101-araBAD-cre (Amp R ) plasmid containing the recombinase Cre inducible expression system;

[0128] 4. The recombinant enzyme system was integrated into the JM108 genome for expression through λRed recombination and CRISPR / Cas9 editing.

[0129] In this example, a Π protein mutant manipulation expression system was constructed based on this engineered strain. The system includes: the regulatory region of the Lac operon, including the promoter P lacUV5-tacand the LacO operator sequence (the nucleotide sequence of the operator sequence is shown in SEQ ID NO: 1), a gene encoding a mutant Π protein pir116 (sequence information is shown in SEQ ID NO: 2), and a transcription terminator. As a control group, the JM108-araBAD-cre-pirWT engineering strain was also constructed (the sequence information of pirWT is shown in SEQ ID NO: 3), and the construction process was the same as that of JM108-araBAD-cre-pir116.

[0130] The pir-116 expression cassette was constructed onto the pKD46 vector plasmid. Using this plasmid as a template, it was integrated into the genome of the JM108-araBAD-cre engineering bacteria for expression by λRed recombination and CRISPR / Cas9 editing. The specific steps are as follows:

[0131] 1.1 Construction of the pKD46-Lac-pir116 plasmid

[0132] (1) Amplify the pir116 gene (the template is the pir1 competent strain provided by the reagent department of GenScript), the Lac operon (including the repressor protein encoding gene, promoter, operator gene), and the pKD46 vector (plasmid NCBI Sequence ID: AY048746.1). The amplification system and PCR system are shown in Tables 1 and 2, and the fragment sizes are 918 bp, 1512 bp, and 3361 bp respectively. The results of agarose gel electrophoresis are as Figure 2 shown, the fragment sizes are correct, and the amplified products are recovered using a gel extraction kit. PrimerStar GXL DNA polymerase is purchased from Takara Bio Inc. (Beijing), product number: R050A.

[0133] Table 1 Amplification system

[0134]

[0135]

[0136] Table 2 Amplification process

[0137]

[0138] (2) Assemble the pKD46-Lac-pir116 plasmid

[0139] The assembly system is shown in Table 3. React at 50 °C for 20 min, and the product is transformed into JM108 competent cells and cultured on a transformation plate in a 37 °C incubator. Gene builder TM cloning Kit is purchased from Nanjing GenScript Biotech Corporation, product number: C20012009.

[0140] Table 3 Assembly system

[0141]

[0142] (3) Verify the pKD46-Lac-pir116 plasmid

[0143] Pick 10 single colonies from the transformation plates in the above steps, culture them in a 48-well plate medium at 37 °C, and send the bacterial solution to the Nanjing GenScript Sequencing Department for Sanger sequencing. The sequencing results are as Figure 3 . The pKD46-Lac-pir116 plasmid was successfully assembled.

[0144] 1.2 Integrate the mutant Π protein manipulation expression system into the genome of the JM108-araBAD-cre engineering strain through λRed recombination and CRISPR / Cas9 editing. The specific steps are as follows:

[0145] 1) Design the CRISPR / Cas9 specific target between the hemC and cyaA genes: the gRNA length is 20 bp, and the specific gRNA sequence is as shown in SEQ ID NO:9.

[0146] 2) Design the homologous arms on both sides of the insertion site between the hemC and cyaA genes: see the specific left and right homologous arm sequences in SEQ ID NO:4 and 5.

[0147] 3) Use the λRed recombination technology and CRISPR / Cas9 technology to perform a scarless knock-in of the pir-116 cassette into the E. coli JM108-araBAD-Cre strain.

[0148] 4) Screen and verify the edited strain by colony PCR. The bacterial detection primers are designed at both ends of the pir-116 gene expression cassette (primers: the sequences are shown in SEQ ID NO:6 and 7). The theoretically correct band size for the successfully knocked-in colony PCR is 2798 bp, and the theoretically correct band size for the unsuccessfully knocked-in one is 1365 bp. The results are shown in Figure 4 . Lane 1 is the PCR amplification band without the inserted target fragment, and lane 2 is the PCR amplification band after inserting the target fragment. The band sizes are correct.

[0149] 5) Perform Sanger sequencing on the correctly verified clones by PCR. The sequencing results are correct without mutations. The results are shown in Figure 5 .

[0150] Example 2: Construct a precursor plasmid containing the R6K replicon and the pirWT expression cassette

[0151] ori R6KγWhen the plasmid is amplified at a low copy number, it mainly exists in the haploid form. In this example, the wild-type Π protein encoded by the pirWT gene is used to regulate ori R6Kγ replication, so that the precursor plasmid containing ori R6Kγ replicates at a low copy number before recombination is induced, maintaining the haploid form of the plasmid. The precursor empty plasmid pMF5-lacI-pirWT-loxp includes: the DNA replication element ori R6Kγ , the resistance screening tag gene Kan R , the tandemly expressed Lac operon repressor protein encoding gene lacI and the wild-type Π protein encoding gene pirWT (the tandem genes are expressed by P lacI q promoter), terminator, a pair of direct-specific recombination sites lox71 / lox66, multiple cloning sites, and the replication element and multiple cloning sites are located between lox71 / lox66 (see the structure diagram in Figure 1 ).

[0152] 2.1 The construction of the precursor empty plasmid pMF5-lacI-pirWT-loxp is based on the pMF5-loxp-RFP plasmid in the international application PCT / CN2021 / 133141 "plasmid system without selectable markers and production method thereof" (see Example 6 of the international application PCT / CN2021 / 133141), where ori R6Kγ is 389 bp (the sequence is shown in SEQ ID NO: 8), and this plasmid is synthesized by Nanjing Genscript. The sequence is shown in SEQ ID NO: 12, which includes the DNA replication element ori R6Kγ , the resistance screening tag gene Kan R , a pair of direct-specific recombination sites lox71 / lox66, and the inserted sequence RFP target gene. The replication element and the inserted gene are located between lox71 / lox66.

[0153] The lacI fragment encoding the Lac operon repressor protein was amplified by PCR (using primers lacI-F: AAGTATATATGAGTAAACTTGGTCTGACAGGACACCATCGAATGGTGCAA (SEQ ID NO: 14) and lacI-R: GTTCACGTCCATCATGACCTTGAGTCTCATCTCGAGTCACTGCCCGCTTTCCAGTC (SEQ ID NO: 15)), the pirWT gene fragment (using primers pir-F: ATGAGACTCAAGGTCATGAT (SEQ ID NO: 16) and pir-R: TTTCATTTGATGCTCGATGAGTTTTTCTAAGGTTCTT (SEQ ID NO: 17)), and the pMF5-loxp vector fragment (using primers R6K WT-loxp-F: TTAGAAAAACTCATCGAGCA (SEQ ID NO: 18) and R6K WT-loxp-R: CTGTCAGACCAAGTTTACTC (SEQ ID NO: 19)). The fragment sizes were 1227 bp, 1415 bp, and 2289 bp respectively. The amplification system is shown in Table 4, and the amplification program is shown in Table 5. The results are shown in Figure 6 , lanes 1 and 2 are the amplified lacI fragments, lanes 3 and 4 are the amplified pirWT fragments, and lanes 6 and 7 are the amplified pMF5 vector fragments. The sizes are correct, and gel extraction was performed according to the gel extraction kit. Using the Gene builder TM cloning Kit for assembly. The assembly system is shown in Table 6. Incubate at 50 °C for 20 min, then transform into JM108. Take 50 μL / 100 μL of the transformed product for coating and culture overnight at 37 °C.

[0154] Table 4 Amplification system

[0155]

[0156] Table 5 Amplification process

[0157]

[0158] Table 6 Assembly system

[0159]

[0160] Single colonies grew from the assembled pMF5-lacI-pirWT-loxp plasmid. Eight monoclonal colonies were picked for Sanger sequencing. The Sanger sequencing results are shown in Figure 7 , and the assembly was successful.

[0161] 2.2 Construction of the pMF5-lacI-pirWT-loxp precursor plasmid

[0162] Based on the constructed pMF5-lacI-pirWT-loxp precursor empty plasmid, fragments with different sequence lengths were inserted at the multiple cloning site, and the lengths of the gene fragments were 1.0 kb, 1.5 kb, and 2.3 kb, respectively. In this example, control plasmids were also constructed simultaneously: pMF5-loxp-fragments with different sequence lengths.

[0163] PCR amplified the above three gene fragments (gene fragment 1.0 kb, gene fragment 1.5 kb, and gene fragment 2.3 kb), the pMF5-lacI-pirWT-loxp vector fragment, and the pMF5-loxp vector fragment. The amplification system is shown in Table 7, and the amplification program is shown in Table 8. The results are shown in Figure 8 , with the correct size, and gel extraction was performed according to the gel kit. Using the Gene builder TM cloning Kit kit for assembly. The assembly system is shown in Table 9. Incubate at 50 °C for 20 min, transform into JM108, and take 50 μL / 100 μL of the transformed product for coating, and culture overnight at 37 °C.

[0164] Table 7 Amplification system

[0165]

[0166] Table 8 Amplification process

[0167]

[0168] Table 9 Assembly system

[0169]

[0170] Single colonies grew from the assembled pMF5-lacI-pirWT-loxp-fragments with different sequence lengths plasmids and pMF5-loxp-fragments with different sequence lengths plasmids. Eight monoclonal colonies were picked from each for sanger sequencing. The sanger sequencing results showed successful assembly.

[0171] Example 3: Preparation of a plasmid without a resistance screening tag based on a wild-type-mutant Π protein switching expression system

[0172] During the preparation and purification of the plasmid without a resistance screening tag, when choosing a high-copy precursor plasmid, the problem of severe multimer contamination and low screening efficiency for antibiotic-free strains occurred; when choosing a low-copy precursor plasmid, the yield was insufficient during large-scale preparation, and the genomic contamination was serious. This example elaborated on the method of successfully improving the purification efficiency and plasmid yield during the preparation of the plasmid without a resistance screening tag by using a wild-type-mutant Π protein switching expression system through multiple groups of controls. The specific operations are as follows:

[0173] 3.1 Prepare competent cells from the genetically modified strain JM108-cre-pir116, and transform with the pMF5-lacI-pirWT-loxp group of precursor plasmids. The inserted fragment sequences are 1.0 kb, 1.5 kb fragment, and 2.3 kb fragment respectively, and spread on a Kan-resistant plate. Control group: JM108-cre-pir116 + pMF5-loxp group of precursor plasmids. The specific transformation steps are as follows:

[0174] 1) Take the competent cells and let them melt naturally on ice;

[0175] 2) Add 1 μL of plasmid to the competent cells on ice and mix the competent cells and the plasmid;

[0176] 3) Incubate on ice for 30 min;

[0177] 4) Heat shock at 42 °C for 90 s and then incubate on ice for 3 min;

[0178] 5) Add 800 μL of fresh liquid LB medium and incubate in a full-temperature shaking incubator at 37 °C and 220 rpm for 45 min;

[0179] 6) Take an appropriate amount of the bacterial solution and spread it on a solid LB + Kan + 1% glucose plate, and incubate overnight in a 37 °C incubator;

[0180] 7) Select single colonies of normal size for subsequent experiments.

[0181] 3.2 Add arabinose to induce Cre-loxp recombination:

[0182] Add a certain amount of arabinose to the culture system to induce the expression of Cre recombinase and achieve Cre-loxp recombination. The specific operations are as follows:

[0183] 1) Pick 3 - 4 transformed clones into 4 mL of liquid LB + Kan + 1% glucose medium and incubate overnight at 37 °C and 220 rpm to enrich the bacteria.

[0184] 2) Divide 4 mL of the bacterial solution equally into 2 2-mL EP tubes. Take one tube and wash it twice with antibiotic-free LB medium, and then resuspend the bacteria with the induction solution (the induction solution is LB + 2% arabinose).

[0185] 3) Induce recombination at 37 °C and 220 rpm for 1 h;

[0186] 4) Take 5 μL of the recombined bacterial solution and streak it in four zones on an antibiotic-free LB solid plate, and incubate overnight in a 37 °C incubator; The remaining bacterial solution and the other tube of non-induced recombined bacterial solution are used to extract plasmids for verification. Perform agarose gel electrophoresis, using the non-induced recombined plasmid as a control. The electrophoresis results of the induced recombined plasmid are asFigure 9 as shown Figure 9 On the left is the JM108-cre-pir116 + pMF5-lacI-pirWT-loxp group. The 1.0 kb, 1.5 kb, and 2.3 kb bands to the left of the Marker are the uninduced recombinant pMF5-lacI-pirWT-loxp-1.0 kb / 1.5 kb / 2.3 kb precursor plasmids, with sizes of 5817 bp, 6317 bp, and 7078 bp respectively; the 1.0 kb, 1.5 kb, and 2.3 kb bands to the right of the Marker are the pMF5-lacI-pirWT-loxp-1.0 kb / 1.5 kb / 2.3 kb antibiotic-free screening tag plasmids obtained after 1 h of induced recombination, with sizes of 1429 bp, 1929 bp, and 2684 bp respectively. Compared with the uninduced products on the left, the induced recombinant products on the right have an additional circular double-stranded DNA with no replication ability, with a size of 4422 bp in addition to the precursor plasmid and the antibiotic-free screening tag plasmid. The band sizes are all correct.

[0187] Figure 9 On the right is the JM108-cre-pir116 + pMF5-loxp group. The 1.0 kb, 1.5 kb, and 2.3 kb bands to the left of the Marker are the uninduced recombinant pMF5-loxp-1.0 kb / 1.5 kb / 2.3 kb precursor plasmids, with sizes of 3265 bp, 3765 bp, and 4526 bp respectively; the 1.0 kb, 1.5 kb, and 2.3 kb bands to the right of the Marker are the pMF5-loxp-1.0 kb / 1.5 kb / 2.3 kb antibiotic-free screening tag plasmids obtained after 1 h of induced recombination, with sizes of 1429 bp, 1929 bp, and 2690 bp respectively. Compared with the uninduced recombinant products on the left, the induced recombinant products on the right have an additional circular double-stranded DNA with no replication ability, with a size of 1836 bp in addition to the precursor plasmid and the antibiotic-free screening tag plasmid. The band sizes are all correct.

[0188] 3.3 Kan antibiotic screening to purify the antibiotic-free screening tag plasmid:

[0189] 1) After spreading the above recombinant bacterial solution on an antibiotic-free plate, 10 single colonies were picked from each, and each colony was spotted on an LB + Kan (1‰) antibiotic-resistant plate and cultured overnight in a 37°C incubator (the antibiotic-resistant screening plate is as Figure 10 shown); at the same time, inoculate into an LB antibiotic-free liquid medium and culture at 37°C and 220 rpm for antibiotic screening;

[0190] 2) Select the clones that do not grow on the LB + Kan antibiotic-resistant plate but grow normally in the antibiotic-free LB liquid medium for plasmid extraction and plasmid verification;

[0191] 3) Subject the extracted plasmid to agarose gel electrophoresis. The plasmid with the correct size, i.e., the plasmid without the resistance screening tag, is the plasmid product.

[0192] As Figure 10 shown, the resistance of clone #4 in the JM108-cre-pir116 + pMF5-loxp-1.5kb group was not lost, and the remaining clones did not grow on the resistance plate, indicating the loss of the resistance gene; the clones in the JM108-cre-pir116 + pMF5-lacI-pirWT-loxp group did not grow on the resistance plate. Figure 11 In Figure 10 , the plasmid of the JM108-cre-pir116 + pMF5-lacI-pirWT-loxp group on the left corresponded to Figure 10 the clones that lost resistance on the left in In Figure 10 . The main bands of the plasmids of this group of clones were all haploid bands, with high purity and correct size. In the JM108-cre-pir116 + pMF5-loxp group on the right, the main bands of the 1.0kb group were all haploid in size, with slight contamination of miscellaneous bands; in the 1.5kb group, the resistance of one clone was not lost, and the plasmid bands were not verified. The proportion of haploid clones was 60%; in the 2.3kb group, the proportion of haploid clones was 60%. Comparing the JM108-cre-pir116 + pMF5-lacI-pirWT-loxp group with the JM108-cre-pir116 + pMF5-loxp group, the inserted fragments of the two groups were the same, both 1.0kb, 1.5kb, and 2.3kb. However, the results of the above examples proved that the JM108-cre-pir116 + pMF5-lacI-pirWT-loxp group, namely the wild-type-mutant Π protein switching expression system, effectively improved the preparation and purification efficiency of the plasmid without the resistance screening tag.

[0193] Example 4: Large-scale extraction of plasmid without resistance screening tag

[0194] Based on the plasmid without the resistance screening tag obtained by screening in Example 3, this example conducts cell culture, large-scale plasmid extraction, and QC analysis, using the JM108-cre-pirWT + PMF5-loxp group as a control, but not limited to this example. Among them, the cell culture and large-scale plasmid extraction were completed by Nanjing Genscript Biotech Co., Ltd.

[0195] Inoculate the strain containing only the pure plasmid without the resistance screening tag obtained through the above steps of recombination and verification into 100 mL of rich medium and culture overnight. Collect the bacteria, perform lysis, neutralization, and purification to finally obtain the extracted plasmid.

[0196] QC test results:

[0197] The large-scale plasmid extraction products were subjected to Sanger sequencing, which was completed by Nanjing GenScript Biotech Corporation. The sequencing results of the non-resistant gene sequences were correct. The plasmid verification results are as Figure 12 shown, and the plasmid yields are shown in Table 10. Among them, in the JM108-cre-pirWT + pMF5-loxp group (the inserted gene fragments were 2.3 kb, 2.8 kb, and 4.3 kb respectively), the plasmid band was unique and the size was correct, but the low plasmid copy number led to low yield and there was genomic contamination. In the JM108-cre-pir116 + pMF5-lacI-pirWT-loxp group (the inserted gene fragments were 1.0 kb, 1.5 kb, and 2.3 kb respectively), all plasmid bands were unique and the size was correct, and the plasmid yield increased by an order of magnitude compared with the JM108-cre-pirWT + pMF5-loxp group.

[0198] The results of the screening and purification efficiency and large-scale plasmid extraction yield during the recombination process showed that the wild-type-mutant Π protein switching expression system had the advantages of high screening and purification efficiency and high large-scale plasmid extraction yield, successfully achieving the goal of reducing the proportion of bacterial-derived sequences in the production plasmids, reducing potential safety risks and increasing plasmid yield at the same time.

[0199] Table 10 Plasmid Yields

[0200]

[0201] Some of the sequence information mentioned in this article is as follows:

[0202] lacO operator sequence (SEQ ID NO:1):

[0203]

[0204] Mutant Π protein coding gene pir-116 (SEQ ID NO:2):

[0205]

[0206] Π protein coding gene pirWT (SEQ ID NO:3):

[0207]

[0208] Left homologous arm (SEQ ID NO:4):

[0209]

[0210] Right homologous arm (SEQ ID NO:5):

[0211]

[0212] C4241GG050-1JJFH (SEQ ID NO:6): TTAGTCCGGCTACGGCAAGAATGAT

[0213] C4241GG050-1JJRH (SEQ ID NO:7): GCTGACTTCCACACCCAGCGAGGCG

[0214] ori R6Kγ (SEQ ID NO:8):

[0215]

[0216] gRNA sequence (SEQ ID NO:9): TTGTAATAAGGAATTTACAG

[0217] Lox71 (SEQ ID NO:10): TACCGTTCGTATAATGTATGCTATACGAAGTTAT

[0218] Lox66 (SEQ ID NO:11): ATAACTTCGTATAATGTATGCTATACGAACGGTA

[0219] pMF5-loxp-RFP plasmid (SEQ ID NO:12):

[0220]

[0221]

[0222] Cre recombinase coding sequence (SEQ ID NO:13):

[0223]

[0224]

[0225] P lacI q Promoter sequence (SEQ ID NO:20)

[0226]

[0227] The embodiments of the present invention are not limited to those described in the above embodiments. Without departing from the spirit and scope of the present invention, those of ordinary skill in the art can make various changes and improvements in form and detail, and all of these are considered to fall within the protection scope of the present invention.

Claims

1. Precursor plasmid, including: 1) A conditional replication initiation site, whose plasmid replication initiation ability depends on a regulatory protein, wherein the conditional replication initiation site has a first replication initiation state in the presence of a first regulatory protein and has a second replication initiation state in the presence of a second regulatory protein, and the conditional replication initiation site has a stronger ability to initiate plasmid replication in the second replication initiation state than in the first replication initiation state; 2) a first regulatory protein expression cassette for expressing the first regulatory protein; 3) the coding sequence of the repressor protein; 4) Screening of tag genes; 5) The target gene, or the cloning site for inserting the target gene; as well as 6) Paired recombination sites, wherein the paired recombination sites can cause the precursor plasmid to undergo self-recombination in the presence of a recombinase to form a daughter plasmid and a circular double-stranded DNA; The sub-plasmid includes the conditional replication initiation site and the cloning site, or includes the conditional replication initiation site and the target gene; The circular double-stranded DNA includes the screening tag gene, the first regulatory protein expression cassette and the coding sequence of the repressor protein.

2. The precursor plasmid according to claim 1, wherein when the precursor plasmid is introduced into a host cell expressing a second regulatory protein, the presence of the repressor protein can inhibit the expression of the second regulatory protein in the host cell.

3. The precursor plasmid of claim 2, wherein the host cell comprises a second regulatory protein expression cassette for expressing a second regulatory protein, the second regulatory protein expression cassette comprises an expression control sequence, and the repressor protein inhibits the expression of the second regulatory protein when bound to the expression control sequence.

4. The precursor plasmid of any one of claims 1 to 3, wherein the repressor protein coding sequence is located in the first regulatory protein expression cassette, such that the repressor protein is expressed in tandem with the first regulatory protein.

5. The precursor plasmid according to any one of claims 1-4, wherein the conditional replication origin is ori R6K γ a replication origin.

6. The precursor plasmid of any one of claims 1 to 5, wherein the first regulatory protein is a wild-type II protein and the second regulatory protein is a mutant of the wild-type II protein.

7. The precursor plasmid according to any one of claims 1-6, wherein the second regulatory protein is pir -116 encoded gene product.

8. The precursor plasmid according to claim 7, wherein the pir -116 coding gene comprises the sequence shown in SEQ ID NO:

2.

9. The precursor plasmid according to any one of claims 1 to 8, wherein the conditional replication initiation site comprises the sequence shown in SEQ ID NO:

8.

10. The precursor plasmid of any one of claims 1 to 9, wherein the sequences of the paired recombination sites are in the same orientation.

11. The precursor plasmid according to any one of claims 1 to 10, wherein the paired recombination sites are loxP sequences in the same direction, and the recombinase is Cre recombinase; the paired recombination sites are FRT sequences in the same direction, and the recombinase is Flp recombinase; or the paired recombination sites are attB / attP sequences in the same direction, and the recombinase is PhiC31 recombinase.

12. The precursor plasmid according to any one of claims 1 to 11, wherein the pair of recombination sites are a lox71 sequence and a lox66 sequence in the same direction.

13. The precursor plasmid according to any one of claims 1 to 12, wherein the repressor protein is LacI protein.

14. The precursor plasmid according to any one of claims 3-13, wherein the expression regulatory sequence comprises lacO an operator sequence.

15. The precursor plasmid according to claim 14, wherein the lacO manipulation sequence comprises the sequence shown in SEQ ID NO:

1.

16. The precursor plasmid according to any one of claims 1-15, wherein the promoter of the first regulatory protein expression cassette is P lacI q a promoter.

17. The precursor plasmid according to claim 16, wherein the P lacI q promoter comprises the sequence shown in SEQ ID NO:

20.

18. The precursor plasmid according to any one of claims 1-17, wherein the selection tag gene is an antibiotic resistance gene.

19. A composition, the composition comprising the precursor plasmid according to any one of claims 1-18 and a host cell, wherein, The host cell includes: 1) A recombinase expression cassette expressing a recombinase; and 2) A second regulatory protein expression cassette expressing a second regulatory protein, wherein the second regulatory protein expression cassette includes an expression regulatory sequence, and the expression of the second regulatory protein is inhibited when the repressor protein expressed by the precursor plasmid according to claim 1 binds to the expression regulatory sequence, wherein the expression regulatory sequence does not contain the coding sequence of the repressor protein; The recombinase expression cassette and / or the second regulatory protein expression cassette are integrated into the genome of the host cell.

20. The composition according to claim 19, wherein the recombinase is Cre recombinase, Flp recombinase or PhiC31 recombinase.

21. The composition according to claim 19 or 20, wherein the recombinase expression cassette is an inducible recombinase expression cassette.

22. The composition according to claim 21, wherein the inducible recombinase expression cassette is an arabinose-inducible expression cassette.

23. The composition according to any one of claims 19-22, wherein the second regulatory protein is pir -116 encoded gene product.

24. The composition according to claim 23, wherein the pir -116 encoding gene comprises the sequence shown in SEQ ID NO:

2.

25. The composition according to any one of claims 19-24, wherein the repressor protein is LacI protein.

26. The composition according to any one of claims 19-25, wherein the expression regulatory sequence comprises lacO an operator sequence.

27. The composition according to claim 26, wherein the lacO manipulation sequence comprises the sequence shown in SEQ ID NO:

1.

28. The composition according to any one of claims 19-27, wherein, The host cell is Escherichia coli.

29. A method for preparing a plasmid without a selection tag gene, comprising: I) Preparing a precursor plasmid, the precursor plasmid comprising 1) A conditional replication origin, the plasmid replication initiation ability of which depends on a regulatory protein, having a first replication initiation state in the presence of a first regulatory protein and a second replication initiation state in the presence of a second regulatory protein, and having a stronger ability to initiate plasmid replication when the conditional replication origin is in the second replication initiation state than when in the first replication initiation state; 2) A first regulatory protein expression cassette expressing the first regulatory protein; 3) The coding sequence of the repressor protein; 4) A selection tag gene; 5) A target gene, or a cloning site for inserting a target gene; And 6) A pair of recombination sites, wherein the pair of recombination sites can cause the precursor plasmid to undergo self-recombination in the presence of a recombinase to form a sub-plasmid and a circular double-stranded DNA; The sub-plasmid includes the conditional replication origin and the cloning site, or includes the conditional replication origin and the target gene; the circular double-stranded DNA includes the selection tag gene, the first regulatory protein expression cassette and the coding sequence of the repressor protein; II) Introducing the precursor plasmid into a host cell, wherein the host cell includes: 1) A recombinase expression cassette expressing the recombinase; and 2) A second regulatory protein expression cassette expressing the second regulatory protein, wherein the second regulatory protein expression cassette includes an expression regulatory sequence, and the expression of the second regulatory protein is inhibited when the repressor protein binds to the expression regulatory sequence; III) Select the host cells expressing the screening tag gene; IV) Culture the host cells screened in step III), allow the recombinase to be expressed in the host cells, continue to culture the host cells and screen out the host cells that do not express the screening tag gene; and V) Culture the host cells screened in step IV) and extract the plasmid.

30. The method according to claim 29, wherein when introducing the precursor plasmid into the host cells, the presence of the repressor protein can inhibit the expression of the second regulatory protein in the host cells.

31. The method according to claim 29 or 30, wherein the coding sequence of the repressor protein is located in the first regulatory protein expression cassette, such that the repressor protein is expressed in tandem with the first regulatory protein.

32. The method according to any one of claims 29-31, wherein the conditional replication origin is ori R6K γ a replication origin.

33. The method according to any one of claims 29-32, wherein the first regulatory protein is wild-type Π protein and the second regulatory protein is a mutant of wild-type Π protein.

34. The method according to any one of claims 29-33, wherein the second regulatory protein is pir -116 coding gene product.

35. The method according to any one of claims 29-34, wherein the sequences of the paired recombination sites are in the same orientation.

36. The method according to any one of claims 29-35, wherein the paired recombination sites are direct loxP sequences, the recombinase is Cre recombinase; the paired recombination sites are direct FRT sequences, the recombinase is Flp recombinase; or the paired recombination sites are direct attB / attP sequences, the recombinase is PhiC31 recombinase.

37. The method according to any one of claims 29-36, wherein the paired recombination sites are direct lox71 sequences and lox66 sequences.

38. The method according to any one of claims 29-37, wherein the repressor is LacI protein, and the expression regulation sequence comprises lacO an operator sequence.

39. The method according to any one of claims 29-38, wherein the screening tag gene is an antibiotic resistance gene.

40. The method according to any one of claims 29-39, wherein the recombinase expression cassette is an inducible recombinase expression cassette.

41. The method according to claim 40, wherein the inducible recombinase expression cassette is an arabinose-inducible expression cassette.

42. The method according to any one of claims 29-41, wherein the recombinase expression cassette and / or the second regulatory protein expression cassette are integrated into the genome of the host cell.

43. The method according to any one of claims 29-42, wherein the host cell is Escherichia coli.

44. The method according to any one of claims 29-43, wherein, In step IV), allowing the recombinase to be expressed in the host cells is achieved by adding an inducer corresponding to the inducible recombinase expression cassette to the host cells.

45. Use of the precursor plasmid according to any one of claims 1-18 or the composition according to any one of claims 19-28 in the preparation of a plasmid without a screening tag gene.

46. A kit for preparing a plasmid without a screening tag gene, comprising the precursor plasmid according to any one of claims 1-18 and / or the composition according to any one of claims 19-28.

Images