A method for domesticating adherent cell lines into fully suspended cell lines

Abstract

The present invention relates to the technical field of cell culture, and specifically discloses a method for domesticating an adherent cell line into a fully suspended cell line. The adherent-dependent cells are inoculated on microcarriers and cell proliferation is carried out in DMEM medium containing 10% fetal bovine serum. After the cells proliferate to 10E6 cells / mL, the microcarriers are lysed, the cell clusters are centrifuged and collected. The cell clusters are inoculated in a medium containing 10% fetal bovine serum, 0.1% shear force protectant, and 2 g / L glucose and cultured at a rotation speed of 30 to 50 rpm for 3 to 4 days to enable the cells to form embryoid body clusters of 50 μm to 150 μm. The embryoid body clusters are mechanically pipetted to disperse them, and are domesticated for 18 to 22 days with DMEM medium containing different concentration gradients of low molecular weight dextran sulfate to obtain a successfully suspended and domesticated cell line. The method of the present invention improves the uniformity of cell embryoid bodies, makes the properties of the embryoid bodies more stable, and can efficiently obtain a suspended cell line.

Description

Technical Field

[0001] The present invention relates to the technical field of cell culture, and particularly relates to a method for domesticating adherent cell lines into fully suspended cell lines. Background Art

[0002] With the continuous growth of the global population and the increasing tension of resources, traditional animal husbandry has been difficult to meet people's demand for meat products. At the same time, traditional animal husbandry is one of the main sources of global greenhouse gas emissions, and also requires a large amount of water resources and land resources. Therefore, it is necessary to produce meat in a more efficient and sustainable way.

[0003] Compared with traditional animal husbandry, cultured meat can reduce energy consumption by 35%-60%, greenhouse gas emissions by 80%-95%, and land required by 98%. Developing cultured meat technology is of great significance for environmental protection, food safety, nutritional balance, ethics and animal welfare, market potential, and coping with the global food crisis. However, the industry is still in the early stage of development, and the vast majority of technologies are still in the laboratory research stage. The industry itself still faces many challenges. First of all, how to efficiently amplify cells on a large scale is the biggest challenge for the commercialization of cultured meat. It is estimated that a 50g hamburger patty is composed of approximately 250 million cells. Therefore, efficiently obtaining a large number of cells is crucial for the industrialization of cultured meat.

[0004] Compared with adherent cells, suspension cell culture technology allows cells to grow freely suspended in a liquid medium without attaching to a solid surface. This culture method can greatly save culture space, enabling more cells to be cultured in a smaller space. At the same time, when subculturing in suspension, only the volume needs to be increased. The convenient operation method is easier to realize a fully enclosed automated production line for the whole process, with simple process control and suitable for large-scale culture. It is an ideal production method for the industrialization of cultured meat.

[0005] However, the seed cells with myogenic differentiation ability currently used in cultured meat technology are mostly adherent-dependent stem cells, that is, the survival, proliferation, and differentiation of cells depend on the property of adhering to certain extracellular matrix components. When directly entering the suspension environment, a large number of cells will apoptose due to the lack of an anchoring matrix. Moreover, the proliferation of such stem cells has high requirements for the nutrient components of the culture medium, and a culture medium containing serum or serum substitutes is required to ensure the normal proliferation of cells. Currently, the method of reducing to serum-free medium by gradient is used for suspension domestication of cells such as MDCK and ST, but simply reducing to serum-free medium by gradient will cause the proliferation stagnation and loss of differentiation potential of stem cells with differentiation ability, and is not suitable for such cells. Therefore, studying an efficient and stable method for domesticating adherent-dependent cell lines into fully suspended cell lines is of great significance for the field of cultured meat. Summary of the Invention

[0006] To develop an efficient and stable method for domesticating adherent-dependent cell lines into fully suspended cell lines, the present invention provides a method for domesticating adherent cell lines into fully suspended cell lines. The method of the present invention can efficiently obtain suspended cell lines, improve the uniformity of cell embryoid bodies, and make the properties of embryoid bodies more stable.

[0007] The present invention provides a method for domesticating adherent cell lines into fully suspended cell lines, comprising the following steps:

[0008] Inoculate adherent-dependent cells on microcarriers and perform cell proliferation in DMEM medium containing 10% fetal bovine serum. After the cells proliferate to 10E6 cells / mL to 12E6 cells / mL, lyse the microcarriers, centrifuge and collect cell pellets.

[0009] Inoculate the collected cell pellets into the medium and culture at a rotation speed of 30 rpm to 50 rpm for 3 days to 4 days to form embryoid body aggregates of 50 μm to 150 μm.

[0010] The medium contains 8% to 10% (v / v) fetal bovine serum, 0.05% to 0.1% (w / w) shear force protector, and 1.8 g / L to 2 g / L glucose.

[0011] Mechanically pipette the embryoid body aggregates to disperse them, adjust the rotation speed to 50 rpm - 70 rpm, and culture at 38°C to 39°C and 5% CO2 for 3 d to 4 d before starting digestion.

[0012] Digest the cell embryoid bodies with mild trypsin every 3 to 5 days, adjust the cell density to 1E5 cells / mL to 6E5 cells / mL, and the rotation speed to 70 - 90 rpm. Digest and culture for 30 days to 45 days to disperse the cell embryoid bodies into cell pellets composed of 3 to 5 cells.

[0013] Then adjust the rotation speed to 90 rpm to 110 rpm, use DMEM medium containing 20 g / L to 25 g / L glucose and 240 mg / L to 250 mg / L low molecular weight dextran sulfate sodium, monitor the glucose content, and centrifuge and change the medium when it is lower than 1 g / L. Each time the medium is changed, re-adjust the cell density to 1E5 cells / mL to 6E5 cells / mL to screen out a cell population that can adapt to the suspended environment and proliferate normally.

[0014] Gradually reduce the concentration of low molecular weight dextran sulfate sodium in the DMEM medium and domesticate for 18 days to 22 days to obtain a successfully suspended domesticated cell line.

[0015] Furthermore, the dosage ratio of the adherent-dependent cells, microcarriers and DMEM medium containing 10% fetal bovine serum is 1.0E5 to 1.0E6: 90 mg to 100 mg: 75 mL to 80 mL.

[0016] Furthermore, the digestion and culture process is as follows:

[0017] First stage: Once every 3 days, gently digest the cell embryoid bodies with trypsin, adjust the cell density to 3E5 cells / mL, the rotation speed to 80 rpm, and culture for 9 days;

[0018] Second stage: Adjust the time to once every 4 days and continue to gently digest the cell embryoid bodies with trypsin, and culture for 12 days;

[0019] Third stage: Then adjust the interval time to once every 5 days, continue to gently digest the cell embryoid bodies with trypsin, and culture for 15 days.

[0020] Furthermore, the process of gradually reducing the concentration of low molecular weight dextran sulfate in the DMEM medium is as follows:

[0021] Prepare DMEM media containing low molecular weight dextran sulfate at concentrations of 200 mg / L, 150 mg / L, 100 mg / L, 50 mg / L, 25 mg / L, 10 mg / L, and 0 mg / L respectively;

[0022] Change the medium for culture in order from high to low concentration gradient, and domesticate for 18 to 22 days to obtain a successfully suspended and domesticated cell line.

[0023] Furthermore, the adherent-dependent cells are embryonic fibroblasts, skeletal muscle satellite cells, myoblasts or mesenchymal stem cells.

[0024] Furthermore, the embryonic fibroblasts are chicken embryo-derived fibroblasts, bovine embryo-derived fibroblasts or fish embryo-derived fibroblasts.

[0025] Furthermore, the microcarriers are gelatin microcarriers, collagen microcarriers, dextran microcarriers, polylactic acid microcarriers, chitin microcarriers, cellulose microcarriers or alginate microcarriers.

[0026] Furthermore, when the microcarrier is a gelatin microcarrier, the lysis process is: incubate with 0.2% collagenase at 37°C for 10 - 15 min.

[0027] Furthermore, the medium is DMEM, RPMI 1640, MEM, DMEM / F12, M199 or L15 medium containing 10% fetal bovine serum, 0.1% shear force protector and 2 g / L glucose.

[0028] Further, the shear force protectant is poloxamer 188.

[0029] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0030] 1. The present invention adopts the method of preliminary adaptation of cell embryoid bodies, low-speed suspension domestication, and further deep domestication at high speed. The principle is to use laminar shear stress to inhibit the proliferation of adherent-dependent cells and activate their anti-apoptosis pathways. Through this screening mechanism, cell lines adapted to suspension amplification are selected. The obtained fully suspended adapted cell line has a stable phenotype and a stable doubling time, and is suitable for large-scale commercial use.

[0031] 2. The present invention inoculates adherent cell lines on degradable microcarriers. The cells proliferate and secrete ECM to form cell microparticle tissues. After the microcarriers are degraded, cell embryoid bodies can be obtained efficiently. Compared with the AggreWell embryoid body culture plate used in the prior art (Literature: Spontaneous immortalization of chicken fibroblasts generates stable, high-yield cell lines for serum-free production of cultured meat. Nature Food), the number of embryoid bodies that can be generated by each embryoid body culture plate is limited. Taking the AggreWell 400 in the literature as an example, it is a 24-well plate, and each well has 1200 micropores. Therefore, only 2.88E4 cell embryoid bodies can be formed in one culture plate. However, the present invention uses one cell shaking flask, and 6.0E6 cell embryoid bodies can be obtained with a culture volume of 75 ml, which is 208 times that of the literature method.

[0032] Taking the AggreWell 400 in the literature as an example, operations need to be carried out in 24 wells respectively, while the present invention only needs to be operated in one cell shaking flask, reducing the number of operations, improving the uniformity of cell embryoid bodies, and making the properties of embryoid bodies more stable. The AggreWell embryoid body culture plate in the literature relies on imports, and there is currently no alternative product in China. The present invention enables suspension cell domestication to bypass this technical barrier and avoid being affected by import and export trade. Description of the Drawings

[0033] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the following drawings are only some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0034] Figure 1 It is a flowchart of a method for domesticating adherent cell lines into fully suspended cell lines.

[0035] Figure 2 It is a cell embryoid body prepared by culturing the chicken embryo-derived cell line UMNSAH / DF-1 using the method of the present invention;

[0036] In the figure, A shows the growth state of UMNSAH / DF-1 cells on porous gelatin microcarriers;

[0037] B shows the morphological characteristics of the prepared cell embryoid bodies.

[0038] Figure 3 It is a comparison of the number of embryoid bodies formed after suspending and domesticating the chicken embryo-derived cell line UMNSAH / DF-1 using the method of the present invention with the prior art. Among them, Comparative Example 1 is the number of embryoid bodies prepared using an AggreWell embryoid body culture plate; Example 1 is the number of embryoid bodies prepared using the method of the present invention.

[0039] Figure 4 It is a micrograph of UMNSAH / DF-1 adherent growth cells and UMNSAH / DF-1 suspension-adapted cells after suspension adaptation;

[0040] In the figure, A is a micrograph of UMNSAH / DF-1 adherent growth cells (magnified 40 times);

[0041] B is a micrograph of UMNSAH / DF-1 suspension-adapted cells after suspension adaptation (magnified 100 times).

[0042] Figure 5 It is the cell viability and cell doubling time detected respectively when the UMNSAH / DF-1 cell line is passaged to the 10th, 30th, and 50th generations after suspension adaptation.

[0043] Figure 6 It is to detect fibroblast-specific protein 1 (FSP-1) respectively using the qPCR method when the UMNSAH / DF-1 cell line is passaged to the 10th, 30th, and 50th generations after suspension adaptation. Detailed Embodiments

[0044] The following describes the detailed embodiments of the present invention in detail, but it should be understood that the protection scope of the present invention is not limited by the detailed embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the protection scope of the present invention. The experimental methods described in the embodiments of the present invention are all conventional methods unless otherwise specified. The materials, reagents, etc. used in the following embodiments can be obtained from commercial sources unless otherwise specified.

[0045] Example 1: A method for domesticating adherent cell lines into fully suspended cell lines.

[0046] I. Method for domesticating adherent cell lines into fully suspended cell lines

[0047] The flowchart of this example is as Figure 1 shown; specifically, it includes the following steps:

[0048] 1. The UMNSAH / DF-1 chicken embryo fibroblast cell line is obtained by spontaneous immortalization of cells extracted from chicken embryos and suspension domestication into the UMNSAH / DF-1 chicken embryo fibroblast cell line. For the detailed process, see the literature [Pasitka, L., et al. "Spontaneous immortalization of chicken fibroblasts generates stable, high-yield cell lines for serum-free production of cultured meat." Nature Food 4.1 (2023): 35 - 50.].

[0049] Inoculate the UMNSAH / DF-1 chicken embryo fibroblast cell line onto porous gelatin microcarriers. The specific process is as follows:

[0050] Take 1.0E6 UMNSAH / DF-1 chicken embryo fibroblast cells and 100 mg of porous gelatin microcarriers, add them to 50 ml of DMEM medium containing 10% fetal bovine serum. On a cell shaker, stir at a speed of 25 revolutions per minute for 5 minutes every hour (that is, run at a speed of 25 revolutions per minute for 5 minutes and then let it stand for 1 hour, and repeat this process to allow the cells to fully adhere to the microcarriers). After 24 hours, supplement 25 ml of DMEM medium containing 10% fetal bovine serum, adjust to a uniform speed of 40 revolutions per minute, and culture at 39 °C and 5% CO2 for 5 days (the cell state is as Figure 2 shown in A). After the cell count reaches 1.0E6, centrifuge at 200 g for 5 minutes, aspirate the supernatant, collect the cell pellet, add 20 ml of lysis solution, incubate at 37 °C for 15 minutes to lyse the porous gelatin microcarriers, and collect the cell mass after centrifuging at 200 g for 5 minutes;

[0051] Lysis solution preparation: Add 100 mg of collagenase to 50 ml of DMEM, stir evenly, and filter and sterilize with a 0.22 μm filter to obtain the lysis solution.

[0052] DMEM is provided by Thermo Fisher Scientific, brand: Gibco, product number: 31600083; fetal bovine serum is purchased from Tianhang Biotech, product number is 11011 - 8611, abbreviated as FBS.

[0053] For the preparation process of the porous gelatin microcarrier, please refer to the invention patent "A Preparation Method and Application of Porous Gelatin Microcarriers" with the authorization announcement number: CN114516974B.

[0054] In this step, the porous gelatin microcarriers were removed, and chicken embryo fibroblasts proliferated and secreted extracellular matrix (ECM), forming a microparticle tissue (cell mass) together with the porous gelatin microcarriers, which could fully simulate the biological environment and keep the cells in an active stage.

[0055] 2. Inoculate all the collected cell masses into 75 ml of culture medium and culture them at a rotation speed of 40 rpm for 3 days to form embryoid body masses with a size of 50 μm - 150 μm (as shown in Figure 2 B shown).

[0056] Culture medium formula: 10% fetal bovine serum (V / V) DMEM medium, and 0.1% (W / W) poloxamer 188 (Solarbio, S7070) as a shear force protector, and glucose (Maclean, D810594) was added to make the glucose concentration 2 g / L.

[0057] In this step, cells adhered to each other and autocrine ECM to form embryoid body masses, which could avoid cell apoptosis caused by losing the anchoring matrix. A rotation speed of 40 rpm could make the diameter of the embryoid bodies between 50 μm - 150 μm, preventing the embryoid bodies from being too large and the cells inside from suffering from malnutrition. The increased glucose concentration of 2 g / L could ensure cell consumption, and the reason for not adding a higher glucose concentration was to avoid changing the cell metabolic profile.

[0058] 3. Mechanically pipette the embryoid body masses twice a day for three consecutive days to disperse them, adjust the rotation speed to 60 rpm, and culture them at 39°C and 5% CO2 until digestion starts on the 4th day.

[0059] This step disperses the overly large cell embryoid body masses, and a rotation speed of 60 rpm reduces the diameter of the cell embryoid bodies, enabling them to initially adapt to the suspension environment.

[0060] 4. After the cell embryoid bodies are initially adapted to the suspension environment, digestion is carried out. The digestion process is as follows:

[0061] The first stage: Once every 3 days, use mild trypsin (Thermo, 00 - 4555 - 56) to digest the cell embryoid bodies, adjust the cell density to 3×10^5 cells / mL, and the rotation speed to 80 rpm, and culture for 9 days;

[0062] The second stage: Adjust the time to once every 4 days and continue to use mild trypsin to digest the cell embryoid bodies, and culture for 12 days;

[0063] Phase 3: Then adjust the interval time to once every 5 days, and continue to use mild trypsin to digest the cell embryoid bodies for 15 days.

[0064] In the above three stages, the total digestion time of the cell embryoid bodies is 36 days, and the cell embryoid bodies are dispersed into cell clusters composed of 3 - 5 cells.

[0065] This step disperses the cell embryoid bodies into cell clusters composed of 3 - 5 cells. Appropriate cell density and rotation speed prevent excessive cell aggregation, and appropriate laminar shear stress activates the anti - apoptosis pathway of cells, so that adherent - dependent cells will not apoptose due to the loss of the anchoring matrix.

[0066] 5. After the digestion step, adjust the rotation speed to 100 rpm, and use DMEM medium (containing 10% fetal bovine serum (V / V), 0.1% (W / W) poloxamer 188) containing 2.5 g / L glucose and 250 mg / L low - molecular - weight dextran sulfate (Macklin, D808268). Monitor the glucose content. When it is lower than 1 g / L, centrifuge and change the medium with the medium containing 250 mg / L low - molecular - weight dextran sulfate (to provide sufficient nutrition for the cells). Each time the medium is changed, readjust the cell density to 2E5 cells / mL.

[0067] This step disperses the cells into single cells. Low - molecular - weight dextran sulfate can change the charge on the cell surface to promote the suspension of single cells and prevent cell aggregation. At the same time, appropriate laminar shear stress inhibits the proliferation of adherent - dependent cells and screens out cell populations that can adapt to the suspension environment and proliferate normally.

[0068] 6. After 40 days of step 5, prepare DMEM media (containing 10% fetal bovine serum (V / V), 0.1% (W / W) poloxamer 188) with different concentrations of low - molecular - weight dextran sulfate, and respectively prepare DMEM media containing 200 mg / L, 150 mg / L, 100 mg / L, 50 mg / L, 25 mg / L, 10 mg / L, 0 mg / L low - molecular - weight dextran sulfate. Change the medium for culture in descending order of concentration gradient, and domesticate for 18 days to obtain a successfully suspended and domesticated cell line. Specifically: DMEM with 250 mg / L low - molecular - weight dextran sulfate for 3 days, then change to DMEM with 200 mg / L, and then change to 150 mg / L after another 3 days, and gradually decrease to 0 mg / L in turn.

[0069] This step gradually reduces the anti - aggregation agent and screens out cell populations that can maintain single cells in an environment without an anti - aggregation agent, avoiding the situation that low - molecular - weight dextran sulfate is not in the food additive catalog and cannot be used in the industrialization of cultured meat.

[0070] The embryoid bodies obtained in Example 1 were counted using a cell counter, and the specific steps were as follows:

[0071] (1) The chicken embryo-derived cell line UMNSAH / DF-1 was prepared into cell embryoid bodies, and the preparation process is shown in Example 1.

[0072] (2) After gently shaking well, 1 ml of the cell embryoid body suspension was taken three times and transferred into small test tubes. Then, 10 μl of the suspension was taken and counted using a hemocytometer or a cell counter, and the average value of the three times was calculated.

[0073] It was calculated that the number of cell embryoid bodies in the cell line with successful suspension domestication obtained in Example 1 was 8.0E4 cells / mL, and 6.0E6 could be obtained with a culture medium volume of 75 mL.

[0074] Example 2: A method for domesticating an adherent cell line into a fully suspended cell line.

[0075] The specific steps were the same as those in Example 1, except that:

[0076] The microcarriers of Hangke Bio purchased commercially were used to replace the porous gelatin microcarriers. According to the microcarriers used, the 3D Digest lysate of Hangke Bio with the product number R001-500 was used according to the instructions. Digest lysate, product number R001-500, operate according to the instructions.

[0077] In addition, according to different material processes, there are also methods such as thermal lysis and photo lysis for microcarriers.

[0078] Comparative Example 1: A method for culturing embryoid bodies using an AggreWell embryoid body culture plate in the prior art.

[0079] The method steps refer to the literature: Spontaneous immortalization of chicken fibroblasts generates stable, high-yield cell lines for serum-free production of cultured meat. Nature Food. The AggreWell embryoid body culture plate relies on imports, and there is currently no alternative product in China.

[0080] The specific steps were as follows: carried out according to the instructions of AggreWell 400, the seeding density was 3867 cells / well, the culture medium was DMEM10, and the cell embryoid bodies were harvested after culturing for 48 hours. TM 400, the seeding density was 3867 cells / well, the culture medium was DMEM10, and the cell embryoid bodies were harvested after culturing for 48 hours.

[0081] The reason for culturing for 48 hours is that the embryoid bodies in the AggreWell embryoid body culture plate are easily dispersed, and the culture medium cannot be changed. Therefore, it can only be cultured for 48 hours. If the culture time is longer, the cells will die due to nutrient deficiency.

[0082] Taking AggreWell 400 in the literature as an example, it is a 24-well plate with 1200 micropores in each well. It was found that only 2.88E4 cell embryoid bodies could be formed in one culture plate.

[0083] This shows that the efficiency of obtaining embryoid bodies in the method of Example 1 of the present invention is 208 times higher than that in Comparative Example 1.

[0084] II. Detection of the cell viability after the adherent cell line was domesticated into a fully suspended cell line in Example 1

[0085] 1. The chicken embryo-derived cell line UMNSAH / DF-1 was domesticated into a fully suspended adapted cell. The preparation process is shown in Example 1.

[0086] 2. Prepare a 4% trypan blue stock solution: Weigh 4 g of trypan blue, grind it with a small amount of distilled water, add double-distilled water to 100 mL, filter it with filter paper, and store it at 4°C. When in use, dilute it to 0.4% with PBS.

[0087] 3. When the fully suspended adapted cells were passaged to the 10th, 30th, and 50th generations respectively, take 1 mL of the cell suspension and make an appropriate dilution (about 1E6 cells / mL).

[0088] 4. Staining: Transfer 10 μL of the cell suspension into a small test tube, add 10 μL of 0.4% trypan blue solution, and mix well.

[0089] 5. Counting: Within 3 minutes, count the live cells and dead cells respectively using a hemocytometer or a cell counter.

[0090] 6. Observation under the microscope: Dead cells are stained light blue, while live cells are not stained.

[0091] Calculate the cell viability according to the following formula

[0092]

[0093] The results are as Figure 5 shown in A. When the fully suspended adapted cells were passaged to the 10th, 30th, and 50th generations respectively, there was no significant difference in cell viability, indicating that the cell viability was stable and ≥95%.

[0094] III. Detection of the cell doubling time after the adherent cell line was domesticated into a fully suspended cell line in Example 1

[0095] 1. The chicken embryo-derived cell line UMNSAH / DF-1 was domesticated into a fully suspended adapted cell. The preparation process is shown in Example 1.

[0096] 2. When the fully suspended adapted cells were passaged to the 10th, 30th, and 50th generations respectively, cells with good growth were taken, centrifuged, and then resuspended with the culture medium. The concentration was adjusted to 4×10⁵ cells / mL, and the cells were cultured in a cell shaker at 5% CO₂ and 39°C.

[0097] 3. After culturing in the cell shaker at 39°C for 24 h, samples were taken three times a day for cell counting, and the average value was taken. Counting was performed continuously for 5 days.

[0098] 4. Result statistics: The counting results of the 1st, 2nd, 3rd, 4th, and 5th days were collected, and the cell growth curve was plotted using Graphpad prism software; the population doubling time of the cells was calculated using SPSS software for curve fitting (Y = ae bm m=(t - 2)Ln2).

[0099] Simplified formula for cell population doubling: Td = 24 h / b

[0100] The results were as Figure 5 shown in B. When the fully suspended adapted cells were passaged to the 10th, 30th, and 50th generations respectively, there was no significant difference in the cell doubling time, indicating that the cell doubling time was stable, approximately 44 ± 2 hours.

[0101] IV. qPCR Detection of Cell Phenotype after the Adherent Cell Line in Example 1 was Domesticated into a Fully Suspended Cell Line

[0102] 1. The cell line UMNSAH / DF-1 derived from chicken embryos was domesticated into fully suspended adapted cells. The preparation process is shown in Example 1.

[0103] 2. Fibroblast-specific protein 1 (FSP-1, also known as S100A4) belongs to the S100 calcium-binding protein superfamily. Currently, FSP-1 has been regarded as a marker for fibroblasts to study the origin and in vivo activity status of fibroblasts.

[0104] Based on the FSP-1 gene of the red junglefowl (Gallus gallus), forward and reverse primers were synthesized (Sangon Biotech (Shanghai) Co., Ltd.)

[0105] Forward primer: GCCTGATGAACGACCTGGAC; (SEQ ID NO.1)

[0106] Reverse primer: GCTGGGAGGACTTTATTGCG. (SEQ ID NO.2)

[0107] 3. When the fully suspended adapted cells were passaged to the 10th, 30th, and 50th generations respectively, approximately 1×10⁶ cells with good growth were taken, centrifuged, and the cells were washed twice with physiological saline.

[0108] 4. Add 1 mL of lysis buffer and extract RNA according to the instructions of the RNA extraction kit (Tiangen RNA Easy Fast RNA Extraction Kit, DP451).

[0109] 5. Take 1 mg of total RNA and operate according to the instructions of the PrimeScript RT reagent kit (TaKaRa, RR037A). The reverse transcription system is shown in Table 1.

[0110] Table 1 Reverse transcription system

[0111]

[0112] 6. Use the cDNA obtained by reverse transcription as a template, configure the detection system according to the instructions of the qPCR reagent (TaKaRa, RR820B), use the FSP-1 primer, and perform detection on the qPCR instrument using the standard three-step method. The detection system is shown in Table 2.

[0113] Table 2 qPCR detection system

[0114]

[0115] 7. Record the qPCR detection results.

[0116] The results are as Figure 6 shown. The cells stably express fibroblast-specific protein 1 (FSP-1), and the cell phenotype has not changed and remains fibroblasts.

[0117] Although the preferred embodiments of the present invention have been described, those skilled in the art can make additional changes and modifications once they learn the basic creative concepts.

[0118] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalent technologies, the present invention is also intended to include these modifications and variations.

Claims

1. A method for domesticating adherent cell lines into fully suspended cell lines, characterized in that, It includes the following steps: Inoculate adherent-dependent cells on microcarriers and perform cell proliferation in DMEM medium containing 10% fetal bovine serum. After the cells proliferate to 1.0×10⁶ cells / mL - 1.2×10⁶ cells / mL, lyse the microcarriers, centrifuge and collect cell clusters; the dosage ratio of the adherent-dependent cells, microcarriers and DMEM medium containing 10% fetal bovine serum is 1.0×10⁵ - 1.0×10⁶: 90 mg - 100 mg: 75 mL - 80 mL; Inoculate the collected cell clusters into the medium and culture at a rotation speed of 30 rpm - 50 rpm for 3 days - 4 days to form embryoid body clusters with a size of 50 μm - 150 μm; The medium contains fetal bovine serum with a volume fraction of 8% - 10%, shear force protectant with a mass fraction of 0.05% - 0.1%, and glucose at 1.8 g / L - 2 g / L; Mechanically pipette the embryoid body clusters to disperse them, adjust the rotation speed to 50 rpm - 70 rpm, and culture at 38°C - 39°C and 5% CO₂ for 3 d - 4 d before starting digestion; The digestion and culture process is as follows: The first stage: Once every 3 days, use mild trypsin to digest the cell embryoid bodies, adjust the cell density to 3×10⁵ cells / mL, and the rotation speed to 80 rpm, and culture for 9 days; The second stage: Adjust the time to once every 4 days and continue to use mild trypsin to digest the cell embryoid bodies, and culture for 12 days; The third stage: Then adjust the interval to once every 5 days and continue to use mild trypsin to digest the cell embryoid bodies, and culture for 15 days; Digest the cell embryoid bodies with mild trypsin every 3 - 5 days, adjust the cell density to 1×10⁵ cells / mL - 6×10⁵ cells / mL, and the rotation speed to 70 rpm - 90 rpm, and perform digestion and culture for 30 days - 45 days to disperse the cell embryoid bodies into cell clusters composed of 3 - 5 cells; Then adjust the rotation speed to 90 rpm - 110 rpm, use DMEM medium containing 20 g / L - 25 g / L glucose and 240 mg / L - 250 mg / L low molecular weight dextran sulfate sodium, monitor the glucose content, and centrifuge and change the medium when it is lower than 1 g / L. Each time the medium is changed, re-adjust the cell density to 1×10⁵ - 6×10⁵ cells / mL to screen out a cell population that can adapt to the suspension environment and proliferate normally; Gradually reduce the concentration of low molecular weight dextran sulfate sodium in the DMEM medium: Prepare DMEM media containing low molecular weight dextran sulfate sodium at concentrations of 200 mg / L, 150 mg / L, 100 mg / L, 50 mg / L, 25 mg / L, 10 mg / L, and 0 mg / L respectively; Perform medium replacement and culture in sequence from high to low according to the concentration gradient, and domesticate for 18 days - 22 days to obtain a successfully suspension-domesticated cell line.

2. The method for domesticating an adherent cell line into a fully suspended cell line according to claim 1, wherein The adherent-dependent cells are embryonic fibroblasts, skeletal muscle satellite cells, myoblasts or mesenchymal stem cells.

3. The method for domesticating an adherent cell line into a fully suspended cell line according to claim 2, characterized in that, The embryonic fibroblasts are chicken embryo-derived fibroblasts, bovine embryo-derived fibroblasts or fish embryo-derived fibroblasts.

4. The method for domesticating an adherent cell line into a fully suspended cell line according to claim 1, characterized in that, The microcarriers are gelatin microcarriers, collagen microcarriers, dextran microcarriers, polylactic acid microcarriers, chitin microcarriers, cellulose microcarriers or alginate microcarriers.

5. The method for domesticating an adherent cell line into a fully suspended cell line according to claim 4, characterized in that, When the microcarriers are gelatin microcarriers, the lysis process is as follows: incubate with 0.2% collagenase at 37 °C for 10 - 15 min.

6. The method for domesticating an adherent cell line into a fully suspended cell line according to claim 1, characterized in that, The culture medium is DMEM, RPMI 1640, MEM, DMEM / F12, M199 or L15 medium containing 10% fetal bovine serum, 0.1% shear force protectant and 2 g / L glucose.

7. The method for domesticating an adherent cell line into a fully suspended cell line according to claim 6, characterized in that The shear force protectant is poloxamer 188.

Images