Molecular markers for differential diagnosis of aortic dissection and acute myocardial infarction and their applications

Abstract

The present invention discloses molecular markers for differential diagnosis of aortic dissection and acute myocardial infarction and their applications. The molecular markers include gene SIGLEC8, gene CCL2, gene PRR35, gene FAM240C, gene TNFAIP8L3, and gene ASTL. The genes SIGLEC8, CCL2, PRR35, FAM240C, TNFAIP8L3, and ASTL protected by the present invention can be used as biomarkers for differentiating aortic dissection and acute myocardial infarction. The markers protected by the present invention have the potential for good differential diagnosis of patients with aortic dissection and acute myocardial infarction, and have good diagnostic efficacy, which can distinguish patients with aortic dissection from those with acute myocardial infarction, enabling patients to receive effective treatment in a timely manner.

Description

Technical Field

[0001] The present invention belongs to the technical field of biological detection, and particularly relates to molecular markers for differential diagnosis of aortic dissection and acute myocardial infarction and their applications. Background Art

[0002] Aortic dissection (referred to as AD for short) is one of the most dangerous diseases in cardiovascular diseases. It is caused by the rupture of the aortic intima for various reasons, and blood enters the media, causing the aortic vascular wall to tear and form a true and false lumen. According to the Stanford classification, AD can be divided into Stanford type A and Stanford type B. Among them, acute Stanford type A aortic dissection (ATAAD) is a critical emergency clinically and has a very high mortality rate. The mortality rate within 2 days after its onset increases by about 1% per hour, and the mortality rate of patients without surgical treatment is as high as 74% within 2 weeks.

[0003] ATAAD patients usually present with severe chest and back pain when they get ill. Similarly, acute myocardial infarction (AMI) patients can also present with chest pain when they get ill. It is not easy to distinguish between the two, and misdiagnosis is very likely. Although ATAAD can be clearly diagnosed by enhanced aortic CT and differentiated from AMI, many hospitals perform emergency percutaneous coronary intervention empirically to save time because ATAAD is relatively rare. Once misdiagnosed as acute myocardial infarction, preoperative antiplatelet treatment will lead to catastrophic consequences. At present, there is no blood test index that can specifically and sensitively diagnose ATAAD. For clinicians, it is a huge challenge to quickly distinguish between these two diseases in the emergency room because both are very dangerous and have completely different treatment plans. Once misdiagnosed and given the wrong treatment plan, the consequences are often catastrophic. Therefore, it is particularly important to find markers that can sensitively and specifically diagnose ATAAD or predict the occurrence of ATAAD through simple and rapid blood tests.

[0004] With the completion of the human genome sequencing project and the development of high-throughput sequencing technology, scientific researchers in the medical field have a deeper understanding of the human genome, and their understanding of disease-related genetic variations, the functions of related genes, and regulatory networks has also gradually deepened. High-throughput sequencing has been widely used. In recent years, more and more studies have found genes related to ATAAD through high-throughput sequencing. However, most of the studies are based on RNA expressed in aortic tissue. Since obtaining aortic tissue causes great trauma to the human body and is difficult to apply clinically, it may not be appropriate to use the differentially expressed RNA in aortic tissue as a biomarker for AD.

[0005] ATAAD has a high disability and mortality rate and is not easily detected early. Although enhanced CT of the aorta is the gold standard for diagnosing ATAAD, it is costly, time-consuming for patients, and many primary hospitals do not have the conditions to complete this examination. Moreover, it is difficult to obtain aortic tissue, and it is difficult to use differentially expressed RNA as a biomarker. Therefore, differentially expressed RNA screened from peripheral blood can be more conveniently used as a biomarker for ATAAD in clinical practice. Summary of the Invention

[0006] Technical problems to be solved: In view of the above technical problems, the present invention provides molecular markers for differential diagnosis of aortic dissection and acute myocardial infarction and their applications, which can effectively solve the deficiencies of existing methods in the long detection time for type A aortic dissection and the difficulty in differentiating it from acute myocardial infarction.

[0007] Technical solutions: In a first aspect, the present invention provides molecular markers for differential diagnosis of aortic dissection and acute myocardial infarction, including gene SIGLEC8 (Gene ID: 27181), gene CCL2 (Gene ID: 6347), gene PRR35 (Gene ID: 146325), gene FAM240C (Gene ID: 285095), gene TNFAIP8L3 (Gene ID: 388121), and gene ASTL (Gene ID: 431705).

[0008] In a second aspect, the present invention provides a kit, including reagents for detecting the expression levels of the molecular markers for aortic dissection and acute myocardial infarction described in the first aspect, or reagents specifically recognizing the molecular markers for aortic dissection and acute myocardial infarction described in the first aspect, or reagents for detecting the contents of the molecular markers for aortic dissection and acute myocardial infarction described in the first aspect.

[0009] Preferably, the kit includes primers for detecting the expression levels of the molecular markers for aortic dissection and acute myocardial infarction; or primers specifically recognizing the molecular markers for aortic dissection and acute myocardial infarction.

[0010] Furthermore, the primers include upstream and downstream primers for amplifying genes SIGLEC8, CCL2, PRR35, FAM240C, TNFAIP8L3, and ASTL, and their nucleotide sequences are shown as SEQ ID No.1 - SEQ ID No.12:

[0011] SEQ ID No.1: GGAAGAAATCGGCAAGGCCAG;

[0012] SEQ ID No.2: GGGGTTGCCATCTTTCCAGG;

[0013] SEQ ID No.3: GATCTCAGTGCAGAGGCTCG;

[0014] SEQ ID No.4: TGAACCCACTTCTGCTTGGG;

[0015] SEQ ID No.5: CTGCCTGAGTCGTGGAAGC;

[0016] SEQ ID No.6: GGCTGAGCGGGTAGTTGAC;

[0017] SEQ ID No.7: CTTCCGGAGGGTCATGGAGA;

[0018] SEQ ID No.8: CCCGAGGTGGGATTATTACGG;

[0019] SEQ ID No.9: TGATGACACCAGCAGCGAGA;

[0020] SEQ ID No.10: TCCCGATTTTGATCGCCACCT;

[0021] SEQ ID No.11: TCCTTGCCAGGTGTGATCCTA;

[0022] SEQ ID No.12: GCCCTTGGTTAATTGCAGGAATG。

[0023] In a third aspect, there is provided the use of the molecular marker according to the first aspect or the kit according to the second aspect in the preparation of a product for differentiating aortic dissection from acute myocardial infarction.

[0024] Advantageous effects: 1) The genes SIGLEC8, CCL2, PRR35, FAM240C, TNFAIP8L3, and ASTL protected by the present invention can be used as biomarkers for differentiating and diagnosing aortic dissection and acute myocardial infarction;

[0025] 2) The marker composed of the genes SIGLEC8, CCL2, PRR35, FAM240C, TNFAIP8L3, and ASTL protected by the present invention has the potential to well differentiate and diagnose patients with aortic dissection and acute myocardial infarction, and has good diagnostic efficacy, which can distinguish AD patients from AMI patients, enabling patients to receive effective treatment in a timely manner. Description of the Drawings

[0026] Figure 1 Volcano plot (A) and clustered heat map (B) of differentially expressed genes, where L represents the case group of aortic dissection, and HC represents the normal control group;

[0027] Figure 2 This is the qPCR result of specific verification of the mRNA expression levels of each gene between the case groups of aortic dissection and acute myocardial infarction and the normal control group in the present invention. Among them, CON: normal control group (n = 64); AMI: case group of acute myocardial infarction; ATAAD: case group of aortic dissection (n = 64), *: P < 0.05; **: P < 0.01; ***: P < 0.001; ns: no statistically significant difference;

[0028] Figure 3 It is the restricted cubic spline regression analysis curve of the association between the mRNA expression level of the specific gene and ATAAD;

[0029] Figure 4 It is the ROC curve diagram for the molecular marker of different gene combinations in the present invention to distinguish aortic dissection and acute myocardial infarction. Detailed implementation manners

[0030] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments: Example 1

[0031] First, high-throughput transcriptome sequencing was performed on 8 cases of ATAAD and 20 normal controls to screen out the gene mRNAs with differential expression in ATAAD cases. Twenty upregulated and twenty downregulated genes with the most significant differential expression in the sequencing results were included in the validation work. Immediately afterwards, a three-group case-control study design was adopted. In the first stage, 84 pairs of ATAAD cases and control samples were used for validation. Gene mRNAs with validation results consistent with the sequencing direction and statistically significant were included in the second-stage validation; in the second stage, 94 pairs of ATAAD cases and control samples were used for validation. Gene mRNAs with validation results consistent with the sequencing direction and statistically significant were included in the specific validation. For the specific validation, 64 cases of AMI and controls were used, and gene mRNAs with differential expression between the ATAAD and AMI case groups were used as the specific gene mRNAs of ATAAD. The expression levels of the gene mRNAs to be validated were detected by quantitative real-time polymerase chain reaction (qRT-PCR). Finally, the relative quantification method 2-ΔΔCT was used to calculate the mRNA expression levels. The Mann-Whitney U test was used to compare the gene expression differences between the case group and the control group. Restricted cubic spline (RCS) was used to explore the dose-response relationship between the gene mRNA expression levels and ATAAD; the receiver operating characteristic curve (ROC curve) was used to evaluate the discriminative ability of the specific gene mRNAs for ATAAD and normal populations and the discriminative ability between ATAAD and AMI, analyze their sensitivity, specificity, and the area under the ROC curve (AUC), and construct different models to analyze their discriminative value for ATAAD onset. The specific data are as follows:

[0032] Association between specific mRNA expression and acute Stanford type A aortic dissection: A case-control study.

[0033] 1. Clinical samples:

[0034] Peripheral blood was collected from 178 patients hospitalized in the Department of Cardiovascular Surgery of Nanjing First Hospital from 2019 to 2022 with the main diagnosis of AD. 1.5 mL of peripheral blood was collected using an EDTA anticoagulant tube, and 4.5 mL of whole blood RNA preservation solution (Nanjing Yining Fusheng Biotechnology Co., Ltd.) was added and thoroughly mixed, and then stored in a -20°C refrigerator for RNA extraction. Inclusion criteria:

[0035] Inclusion criteria for ATAAD cases: ① Han population aged 18 - 85 years old; ② Patients with ATAAD diagnosed by enhanced whole - aorta scan and confirmed during the operation. Exclusion criteria for cases: ① Exclude cardiovascular diseases caused by genetic diseases or genetic cardiovascular diseases such as Marfan syndrome, Ehlers - Danlos syndrome, familial thoracic aortic aneurysm, dissection caused by trauma, etc.; ② Patients proved not to have ATAAD during the operation; ③ Suffering from malignant tumors; ④ Patients considered by the researcher to have other situations not suitable for inclusion in this study, etc.

[0036] Inclusion criteria for AMI cases: ① Han population aged 18 - 85 years old; ② Patients hospitalized for AMI in the First Hospital of Nanjing. The diagnosis of acute myocardial infarction (type I myocardial infarction) adopts the criteria of the fourth edition of "Global Definition of Myocardial Infarction", that is, acute myocardial injury [serum cardiac troponin (cTn) increased and / or decreased, and at least 1 time higher than the upper limit of normal value (99th percentile value of the upper limit of reference value)], and at the same time there is clinical evidence of acute myocardial ischemia, including: I. Symptoms of acute myocardial ischemia; II. New ischemic electrocardiogram changes; III. New pathological Q waves; IV. New imaging evidence of viable myocardial loss or ventricular wall segmental motion abnormalities; V. Coronary angiography or intravascular imaging examination. Exclusion criteria for cases: ① Taking anti - platelet drugs and lipid - regulating drugs within the past 2 weeks; ② Severe hepatic and renal insufficiency (ALT > 5 times ULN, eGFR < 30 mL / min / 1.73 mm 2 ); ③ Suffering from malignant tumors; ④ Known hemorrhagic diseases or active bleeding; ⑤ Patients participating in other interventional clinical trials.

[0037] This invention cooperates with the School of Public Health of Nanjing Medical University, and the control source is the population of the prospective cohort study carried out in Jurong City, Jiangsu Province from 2018 to 2019.

[0038] Inclusion criteria for the control: Matched 1:1 by individual with ATAAD and AMI cases in the way of consistent age (±2 years) and gender.

[0039] Exclusion criteria for the control: Suffering from severe heart, brain, lung, kidney diseases and tumors.

[0040] 2. Experimental methods:

[0041] 2.1 RNA extraction:

[0042] The extraction of total RNA from peripheral blood adopts the magnetic bead method (Cat#Yu - BR02 - 1, Yaan Biotechnology Co., Ltd., Wuxi, China). The specific steps are as follows:

[0043] (1) Sample processing: Thaw the frozen preservation fluid sample at room temperature, mix it well by inverting it up and down. Add 800 μL of the sample into a 1.5 mL centrifuge tube, then add 600 μL of isopropanol, and mix well by inverting it up and down. Place it in a centrifuge at 4°C and centrifuge at 7230 rpm for 10 min;

[0044] (2) Discard the supernatant, retain the precipitate, and sequentially add 400 μL of lysis adsorption solution, 10 μL of RNA protectant, and 10 μL of mixed magnetic beads to it. Close the lid, place the centrifuge tube on a shaker and shake for 10 min, take out the centrifuge tube, and centrifuge briefly;

[0045] (3) Place the centrifuge tube on a magnetic rack, let it stand for 2 min, open the lid, use a pipette to aspirate and discard the liquid, and retain the magnetic beads;

[0046] (4) Add 600 μL of Buffer AW1, close the lid, place the centrifuge tube on a shaker and shake for 1 min;

[0047] (5) Place the centrifuge tube on a magnetic rack, let it stand for 1 min, then quickly invert the magnetic rack up and down to fully recover the magnetic beads on the centrifuge tube lid. Let it stand for another 1 min. Open the lid, use a pipette to aspirate and discard the liquid, and retain the magnetic beads;

[0048] (6) Add 600 μL of 80% DEPC ethanol, close the lid, place the centrifuge tube on a shaker and shake for 1 min;

[0049] (7) Place the centrifuge tube on a magnetic rack, let it stand for 1 min, then quickly invert the magnetic rack up and down to fully recover the magnetic beads on the centrifuge tube lid. Let it stand for another 1 min. Open the lid, use a pipette to aspirate and discard the liquid, and retain the magnetic beads;

[0050] (8) Repeat steps (6)-(7);

[0051] (9) Place the centrifuge tube on a foam board, put it into a 50°C constant temperature water bath, and dry for 2 min;

[0052] (10) Take back the centrifuge tube, add 50 μL of elution buffer A, blow and beat the magnetic beads thoroughly to disperse them into the elution buffer, close the lid, place the centrifuge tube on a foam board, put it into a 52°C constant temperature water bath, and water bath for 2 min;

[0053] (11) Place the centrifuge tube on a magnetic rack, let it stand for 2 min until the liquid is clear, open the lid, use a pipette to aspirate the liquid and transfer it to another new centrifuge tube, and discard the magnetic beads;

[0054] (12) Use ultraviolet spectrophotometry (nucleic acid and protein analyzer Thermo Nano Drop 2000) to detect the RNA concentration and purity. The RNA purity is qualified when the OD value (260 / 280) is between 1.8 and 2.0.

[0055] 2.2 RNA reverse transcription to synthesize cDNA

[0056] Use the TAKARA reverse transcription kit (RR047A Takara PrimeScript™ RT reagent Kit with gDNA Eraser, Japan) to synthesize cDNA. The specific steps are as follows:

[0057] (1) According to the measured concentration, balance the RNA of different concentration samples to four fixed values of 10 ng / μL, 30 ng / μL, 50 ng / μL, and 100 ng / μL. Calculate the volume of eluent A to be added according to the concentration;

[0058] (2) Add 2 μL of reverse transcription system 1 to a 200 μL centrifuge tube;

[0059] (3) Add the RNA sample (the volume is calculated according to the concentration) to the centrifuge tube, centrifuge, and incubate in a water bath at 42 °C for 2 min;

[0060] (4) Add 10 μL of reverse transcription system 2 and centrifuge;

[0061] (5) PCR amplification, the program is set as 37 °C for 15 min, 85 °C for 5 s, 15 °C ∞;

[0062] (6) After reverse transcription is completed, store it in a -80 °C refrigerator for subsequent experiments.

[0063] 2.3 qRT-PCR

[0064] Design the primer sequences of mRNAs according to the primer design principle of mRNAs;

[0065] The relative quantitative detection of mRNA is completed by qPCR, and the SYBR Green method is used for detection. The experiment uses a 384-well plate, and each sample is set with 3 parallel replicates. GAPDH is used as an internal reference gene. The first-stage detection is completed using the ABI QuantStudio7 fluorescence quantitative PCR system, and the second-stage and specific verification are completed using the Fosheng FS384 real-time fluorescence quantitative PCR instrument. The standard deviation of the CT values between the replicates of each sample is less than 0.5, and the final reading takes the average value of the three replicates;

[0066] The system uses 1.5 μL of cDNA sample, 1.3 μL of RNase-free H2O, 2.8 μL of SYBR Green Master Mix, and 0.2 μL of forward and reverse primers each, for a total of 6 μL system;

[0067] The qPCR program was set as follows: ① Pre-denaturation: 95°C, 5 min; ② Denaturation: 95°C, 10 s; ③ Annealing: 57°C, 20 s; ④ Extension: 72°C, 20 s; ⑤ Melting curve: default settings of the instrument. Steps ② - ④ were cycled 40 times in sequence, and the remaining steps were performed only once.

[0068] 2.4 Method for calculating mRNA expression level

[0069] The relative quantification method (2-ΔΔCT) was used to calculate the mRNA expression levels of each gene. The specific method was as follows:

[0070] (1) ΔCT = CT value of the target gene - CT value of the internal reference gene;

[0071] (2) Batch coefficient fn = average ΔCT of the control group in each batch / average ΔCT of the total control group;

[0072] (3) ΔCT core = ΔCT / fn;

[0073] (4) ΔΔCT core = ΔCT core - average ΔCT of the total control group;

[0074] (5) mRNA expression level = 2(-ΔΔCT core).

[0075] 2.5 Data sorting and statistical analysis

[0076] All experimental data were independently sorted by two people and their consistency was verified. The mRNA expression levels of each gene were calculated using the relative quantification method. Before analysis, the extreme values were corrected with the mean ± three standard deviations of the ΔCT values. The differences in the mRNA expression levels between the case group and the control group were compared using the Mann-Whitney U test. The dose-response relationship between the mRNA expression level and ATAAD was analyzed using the Restricted Cubic Spline (RCS). The receiver operating characteristic (ROC) curve was plotted to analyze the discriminative ability of specific mRNA for ATAAD and normal populations and for ATAAD and AMI, and its sensitivity, specificity, and area under the curve (AUC) were obtained. All of the above analyses were performed using the statistical software SPSS 24 or R 4.2.2. The results of the statistical analysis were considered statistically significant when the two-sided P < 0.05.

[0077] 3. Experimental results:

[0078] As Figure 1Shown as follows: A total of 19,548 mRNAs were detected by RNA-Seq, among which 3,634 mRNAs were significantly dysregulated (Padj < 0.05, |log2FC| > 1); compared with the normal control group, 1,923 mRNAs were significantly upregulated and 1,711 mRNAs were significantly downregulated in the ATAAD group. The volcano plot ( Figure 1 in A) and the heat map ( Figure 1 in B) showed the expression profiles of mRNAs between ATAAD and normal control.

[0079] As Figure 2 shown: Compared with the control group, the mRNAs of CCL2 and ASTL genes were differentially upregulated in the AMI case group (P < 0.05), and there was no significant difference in the mRNAs of SIGLEC8 and FAM240C genes (P > 0.05); compared with the AMI case group, the mRNAs of SIGLEC8, FAM240C, CCL2, and ASTL genes were differentially downregulated in the ATAAD case group (P < 0.05); compared with the control group, the mRNAs of each gene were differentially expressed in the ATAAD case group.

[0080] As Figure 3 shown: Generally, the mRNAs of upregulated genes all showed that the risk of ATAAD increased with the increase in expression level. Among them, with the increase in the expression level of TNFAIP8L3, the risk of ATAAD showed an increase in disease risk. When the expression level reached a certain level, the risk no longer increased; the initial risk of PRR35 increased with the increase in expression level, and then decreased slightly with the increase in expression level, but the risk was still much higher than that of the low-expression level; generally, the mRNAs of downregulated genes all showed that the risk of ATAAD decreased with the increase in expression level. Among them, the risks of SIGLEC8 and CCL2 decreased with the increase in expression level, and finally the OR tended to 1; the risk of FAM240C decreased with the increase in expression level, and finally showed a protective effect (OR < 1); the risk of ASTL first decreased with the increase in expression level, then increased slightly with the increase in expression level, and finally showed a harmful effect (OR > 1).

[0081] As Figure 4 shown: The AUC values of the genes SIGLEC8, CCL2, PRR35, FAM240C, TNFAIP8L3, and ASTL > 0.85, indicating that the above gene combination has good potential for differentiating aortic dissection from acute myocardial infarction, and the greater the AUC value, the stronger its differentiating ability.

[0082] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, and improvements made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A kit, characterized in that, Reagents for detecting the expression levels of molecular markers for aortic dissection and acute myocardial infarction, wherein the molecular markers for aortic dissection and acute myocardial infarction include gene SIGLEC8, gene CCL2, gene PRR35, gene FAM240C, gene TNFAIP8L3, and gene ASTL.

2. The kit according to claim 1, wherein Primers for detecting the expression levels of molecular markers for aortic dissection and acute myocardial infarction.

3. The kit according to claim 2, wherein The primers include upstream and downstream primers for amplifying gene SIGLEC8, gene CCL2, gene PRR35, gene FAM240C, gene TNFAIP8L3, and gene ASTL, and their nucleotide sequences are shown in SEQ ID No.1 - SEQ ID No.

12.

4. Use of the kit according to any one of claims 1 - 3 in the preparation of a product for differentiating aortic dissection from acute myocardial infarction.

Images