A technology for bioconverting resveratrol into pterostilbene using Yarrowia lipolytica

Abstract

The object of the present invention is to provide a technology for biotransforming resveratrol into pterostilbene using Yarrowia lipolytica, including: constructing a vector: assembling a resveratrol O-methyltransferase gene fragment with an Escherichia coli expression vector, followed by digestion, transformation, and then large-scale culture to obtain the recombinant plasmid pACYCDuet-ROMT; transformation: transferring the recombinant plasmid pACYCDuet-ROMT into Yarrowia lipolytica, and screening through culture to obtain recombinant Yarrowia lipolytica; fermentation: biotransforming resveratrol into pterostilbene through the fermentation of recombinant Yarrowia lipolytica in a basal medium. The present invention uses Yarrowia lipolytica as a chassis cell, and expresses resveratrol O-methyltransferase (ROMT) by genetic engineering means, realizing the biotransformation of resveratrol into pterostilbene, which is more efficient and environmentally friendly than chemically synthesizing or directly extracting pterostilbene from natural plants.

Description

Technical Field

[0001] The present invention relates to the technical fields of food and medicine, and particularly provides a technology for biotransforming resveratrol into pterostilbene by using Yarrowia lipolytica, and particularly relates to a method for biotransforming resveratrol into pterostilbene by using Yarrowia lipolytica. Background Art

[0002] Yarrowia lipolytica is an unconventional yeast belonging to Hemiascomycetes. It is called an unconventional yeast because it exhibits many characteristics in physiological features, metabolic pathways, and gene expression compared with conventional yeasts such as Saccharomyces cerevisiae. For example, Yarrowia lipolytica has a strong ability to decompose hydrophobic compounds and can only grow using glucose, glycerol, acetate, and N-acetylglucosamine as carbon sources. As a generally recognized as safe (GRAS) organism, Yarrowia lipolytica is becoming a crucial new non-model microbial chassis cell in the fields of metabolic engineering and synthetic biology. Compared with Escherichia coli, Yarrowia lipolytica has a complete endomembrane system and a protein post-translational modification system similar to that of plants, making it more suitable for the expression of plant-derived proteins. In addition, compared with Escherichia coli and Saccharomyces cerevisiae, Yarrowia lipolytica is a typical oil-producing yeast with a relatively high accumulation of fatty acids, fatty acyl-CoA, and acetyl-CoA in cells. Therefore, this yeast has obvious advantages in the production of plant terpenoids (acetyl-CoA derivatives, Acetyl-CoA-derived products), has broad development prospects, and has been used in genetic engineering to produce a series of high-value terpenoids, such as β-carotene, α-farnesene, and geraniol.

[0003] Pterostilbene is a representative substance of stilbene (3,5-dimethoxy-4'-hydroxy-trans-stilbene), a natural derivative compound that exhibits strong antifungal activity. It was initially discovered in the heartwood of Pterocarpus santalinus and later found in grapes, blueberries, Dalbergia hupeana, alfalfa, and a few other plant species. Pterostilbene is a structural analog of resveratrol. Modern pharmacological studies have shown that pterostilbene has various pharmacological activities similar to resveratrol, such as anti-tumor, anti-inflammatory, antioxidant, anti-aging, and cardiovascular protection effects. Moreover, it has higher bioavailability and biological activity than resveratrol, can be rapidly absorbed, and is widely distributed in tissues. According to research experiments conducted by multiple medical research institutions at home and abroad, pterostilbene can simultaneously exhibit excellent effects in inhibiting melanin, inhibiting tyrosinase, antioxidant, resisting ultraviolet rays, anti-inflammatory, and anti-glycation, and is also one of the most comprehensive and excellent natural active ingredients for whitening and anti-aging. As a hot compound in current research, pterostilbene has good application prospects in the fields of medicine, health food, and cosmetics. However, the low content of pterostilbene in natural plants and the high extraction cost have greatly restricted the promotion and application of pterostilbene. To effectively obtain this bioactive resveratrol analog, it is necessary to develop a biotransformation technology from resveratrol to pterostilbene. Summary of the Invention

[0004] The purpose of the present invention is to provide a technology for biotransforming resveratrol into pterostilbene using Yarrowia lipolytica. By using Yarrowia lipolytica as the chassis cell and expressing resveratrol O-methyltransferase (ROMT) through genetic engineering means, the biotransformation of resveratrol into pterostilbene is achieved, which is more efficient and environmentally friendly compared to chemical synthesis or direct extraction of pterostilbene from natural plants.

[0005] To achieve the above purpose, the technical solution of the present invention is as follows:

[0006] On the one hand, the present invention provides a biotransformation method for synthesizing pterostilbene, including:

[0007] Transferring the recombinant plasmid into the chassis strain, and obtaining recombinant Yarrowia lipolytica through culture and screening;

[0008] Biotransforming resveratrol into pterostilbene by fermenting the recombinant Yarrowia lipolytica in a basal medium.

[0009] Furthermore, the chassis strain of the recombinant Yarrowia lipolytica is Yarrowia lipolytica PO1f or Yarrowia lipolytica PO1g, and the recombinant plasmid is pACYCDuet-ROMT.

[0010] Furthermore, the chassis strain of the recombinant Yarrowia lipolytica is Yarrowia lipolytica PO1f.

[0011] Furthermore, the recombinant plasmid pACYCDuet-ROMT is the linearized vector pACYCDuet carrying the gene of the sequence shown in SEQ ID NO:1.

[0012] Furthermore, the fermentation conditions are carried out at 25-35 °C for 100-150 h, the pH value during the fermentation process is maintained at about 4.5-5.5, and at the same time, the dissolved oxygen is maintained at 5-20% and the C / N is maintained at (5-15):1 by controlling stirring and ventilation.

[0013] Furthermore, the fermentation conditions are carried out at 30 °C for 120 h, the pH value during the fermentation process is maintained at about 5.0, and at the same time, the dissolved oxygen is maintained at 10% and the C / N is maintained at 10:1 by controlling stirring and ventilation.

[0014] Furthermore, the basal medium contains 0.5-1.5 mM resveratrol, 0.4-0.8 g / L magnesium salt (e.g., MgCl2 or MgSO 4 ·7H 2 O), 8-12 g / L nitrogen source (e.g., tryptone, (NH 4 ) 2 SO 4 )), 3-7 g / L potassium salt (e.g., KH 2 PO 4 , K2SO 4 ), 30-50 g / L carbon source (e.g., glycerol, sucrose, glucose, soluble corn starch), 5-10 mg / L vitamin (e.g., Wolfe's Vitamin Solution) and 1-3 mg / L trace metal solution.

[0015] The magnesium salt is selected from: MgCl2, MgSO 4 ·7H 2 O, etc.

[0016] The nitrogen source is selected from: tryptone, (NH 4 ) 2 SO 4 , etc.

[0017] The potassium salt is selected from: KH 2 PO 4 , K2SO 4 , etc.

[0018] The carbon source is selected from: glycerol, sucrose, glucose, soluble corn starch, etc.

[0019] Vitamins: Wolfe's Vitamin Solution, etc.

[0020] Trace metal solution: Consisting of 1.43 g / L ZnSO 4 ·7H 2 O, 0.32 g / L MnCl 2 ·4H 2 O, 0.23 g / L CoCl 2 ·6H 2 O, 0.12 g / L Na 2 MoO 4 ·2H 2 O, 2.8 g / L FeSO 4 ·7H 2 O, and 80 mL of 0.5 M EDTA.

[0021] Formulation and preparation method of Wolfe's Vitamin Solution: Resuspend the following components in 1 L of deionized water, stir until completely dissolved, and filter sterilize through a 0.22 μm filter membrane.

[0022]

[0023] Furthermore, the basal medium contains 0.5 - 1.5 mM resveratrol, 0.4 - 0.8 g / L MgSO 4 ·7H 2 O, 8 - 12 g / L (NH 4 ) 2 SO 4 , 3 - 7 g / L KH 2 PO 4 , 30 - 50 g / L glucose, 5 - 10 mg / L vitamins, and 1 - 3 mg / L trace metal solution.

[0024] Furthermore, the basal medium contains 1 mM resveratrol, 0.6 g / L MgSO 4 ·7H 2 O, 10 g / L (NH 4 ) 2 SO 4 , 5 g / L KH 2 PO 4 , 40 g / L glucose, 8 mg / L vitamins, and 1 - 3 mg / L trace metal solution.

[0025] Furthermore, the steps for obtaining the recombinant Yarrowia lipolytica include:

[0026] Constructing the vector: After assembling the resveratrol O-methyltransferase gene (ROMT) fragment with an Escherichia coli expression vector, digesting and transforming it, and then performing an enlarged culture, the recombinant plasmid pACYCDuet-ROMT was obtained;

[0027] Transformation: The recombinant plasmid pACYCDuet-ROMT was transferred into Yarrowia lipolytica, and recombinant Yarrowia lipolytica was obtained through culture and screening.

[0028] Furthermore, the Escherichia coli expression vector is the linear vector pACYCDuet.

[0029] Furthermore, the assembly process is as follows: The target gene ROMT was assembled with the linearized vector pACYCDuet using 2X MultiF Seamless Assembly Mix; preferably, the reaction system for the assembly is 1 - 3 μL of the linearized vector pACYCDuet, 2 - 4 μL of the ROMT fragment, 4 - 6 μL of 2X MultiF Seamless Assembly Mix, and assembled under the reaction conditions of 45 - 55 °C for 10 - 20 min.

[0030] Furthermore, the assembly process is as follows: The target gene ROMT was assembled with the linearized vector pACYCDuet using 2X MultiF Seamless Assembly Mix. Further, the reaction system for the assembly is 2 μL of the linearized vector, 3 μL of the ROMT fragment, 5 μL of 2X MultiF Seamless Assembly Mix, and assembled under the reaction condition of 50 °C for 15 min.

[0031] Furthermore, the digestion and transformation refer to digesting the assembled plasmid with DpnΙ and then heat-shock transforming the E.coli Turbo cloning competent cells.

[0032] Furthermore, the medium used for the enlarged culture is LB medium, and the specific composition is 8 - 15 g / L of Tryptone, 4 - 6 g / L of Yeast Extract, 7 - 15 g / L of NaCl, and 1 - 2% agar is additionally added to the solid medium.

[0033] Furthermore, the medium used for the enlarged culture is LB medium, and the specific composition is 10 g / L of Tryptone, 5 g / L of Yeast Extract, 10 g / L of NaCl, and 1.5% agar is additionally added to the solid medium.

[0034] Furthermore, during the transformation process, the culture conditions are 25 - 35 °C, 150 - 300 rpm, OD 600When OD = 0.8 - 1.0, inoculate into a 1 L flask containing 200 - 300 mL of YPD liquid medium at an inoculation amount of 1%, and culture at 25 - 35 °C and 150 - 300 rpm for 24 - 36 h; preferably, the specific composition of the YPD liquid medium is Tryptone 15 - 30 g / L, Yeast Extract 7 - 15 g / L, and Glucose 15 - 30 g / L.

[0035] Further, during the transformation process, the culture conditions are 30 °C and 200 rpm, OD 600 When OD = 0.8 - 1.0, inoculate into a 1 L flask containing 250 mL of YPD liquid medium at an inoculation amount of 1%, and culture at 30 °C and 200 rpm for 24 - 36 h.

[0036] Further, the specific composition of the YPD liquid medium is Tryptone 20 g / L, Yeast Extract 10 g / L, and Glucose 20 g / L. Further, 1.5% agar is additionally added to the solid medium.

[0037] On the other hand, the present invention provides a recombinant Yarrowia lipolytica that can individually express resveratrol O - methyltransferase. Further, the recombinant Yarrowia lipolytica carries the recombinant plasmid pACYCDuet - ROMT.

[0038] Further, the recombinant plasmid pACYCDuet - ROMT is a linearized vector pACYCDuet carrying the gene with the sequence shown in SEQ ID NO:1.

[0039] On the other hand, the present invention provides an application of the recombinant Yarrowia lipolytica in the production process of pterostilbene.

[0040] The present invention provides a biological conversion technology for pterostilbene. Specifically, a recombinant Yarrowia lipolytica is constructed to synthesize pterostilbene using resveratrol as a substrate, avoiding the constraints of raw materials and climate conditions, realizing the production of pterostilbene under controllable conditions, with a biological conversion rate reaching 72%, laying a foundation for the industrial production of pterostilbene, and being an efficient biological technology production method.

[0041] In the present invention, all the numbers disclosed herein are approximate values whether the words "about" or "approximate" are used or not. The numerical value of each number may vary by 1%, 2%, 5%, 7%, 8%, 10%, 15% or 20%. Whenever a number with a value of N is disclosed, any number with a value of N+ / -1%, N+ / -2%, N+ / -3%, N+ / -5%, N+ / -7%, N+ / -8%, N+ / -10%, N+ / -15% or N+ / -20% will be explicitly disclosed, where "+ / -" means plus or minus. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 . of the sample 1 1H-NMR test chart.

[0043] Figure 2 . of the sample 13 13C-NMR test chart.

[0044] Figure 3 . MS test chart of the sample.

[0045] Figure 4 . HPLC detection chart of the change in product conversion rate. DETAILED DESCRIPTION OF THE INVENTION

[0046] The present invention will be further described below in conjunction with specific embodiments. These embodiments are only used to illustrate the present invention and not to limit the scope of the present invention.

[0047] The reagents used in the present invention can all be purchased from the market or can be prepared by the methods described in the present invention.

[0048] Tryptone: Tryptone

[0049] Yeast Extract: Yeast extract

[0050] Glucose: Glucose

[0051] Example 1

[0052] Using the commercially available Yarrowia lipolytica PO1f (deposit number: ATCC90811) as the starting host strain, Escherichia coli was used to construct plasmids and amplify them. The Escherichia coli strain was cultured on LB broth or LB agar plates containing chloramphenicol (34 mg / L) at a culture temperature of 37°C; Yarrowia lipolytica was cultured on YPD medium.

[0053] LB medium: Tryptone 10 g / L, Yeast Extract 5 g / L, NaCl 10 g / L. Additionally, 1.5% agar is added to the solid medium.

[0054] YPD medium: Tryptone 20 g / L, Yeast Extract 10 g / L, Glucose 20 g / L. Additionally, 1.5% agar is added to the solid medium.

[0055] Cloning and vector construction: The resveratrol O-methyltransferase gene (ROMT) is from Vitis vinifera. The sequence of resveratrol O-methyltransferase (ROMT) codon-optimized for Yarrowia lipolytica is shown in SEQ ID NO:1. The ROMT gene was synthesized by Tianyi Biotech. The ROMT fragment was amplified using Phanta Max Super-Fidelity DNA Polymerase. The primer sequences and SEQ ID NO:1 were artificially synthesized by Guangzhou Tianyi Huiyuan Gene Technology Co., Ltd. Sanger sequencing was provided by Sangon Biotech (Shanghai) Co., Ltd. The primers used were: ROMT-F: GTTTAACTTTAAGAAGGAGATATACATATGGACCTGGCCAACGGCGTCAT ROMT-R: CAAGGGGTTATGCTAGTTATTTTAGGGGTAGACCTCGATCAGAGATC SEQ ID NO:1

[0056] ATGGACCTGGCCAACGGCGTCATCTCCGCCGAGCTGCTGCACGCCCAGGCCCATGTC

[0057] TGGAACCACATCTTCAACTTCATCAAGTCCATGTCCCTGAAGTGCGCCATCCAGCTG

[0058] GGCATCCCCGACATCATCCATAACCACGGCAAGCCCATGACCCTCCCCGAGCTTGTC

[0059] GCCAAGCTCCCCGTCCACCCCAAGCGATCCCAGTGCGTCTACCGACTGATGCGAATC

[0060] CTTGTCCACTCCGGCTTCCTCGCCGCCCAGCGAGTCCAGCAGGGCAAGGAGGAGGAG

[0061] GGCTACGTCCTCACCGATGCCTCCCGACTGCTCCTCATGGATGACTCCCTTTCCATCC

[0062] GACCCCTGGTCCTCGCCATGCTGGATCCCATCCTCACCAAGCCCTGGCACTACCTTTC

[0063] CGCCTGGTTCCAGAACGACGATCCTACCCCCTTCCACACCGCCCACGAGCGATCCTT

[0064] CTGGGATTACGCCGGCCACGAGCCCCAGCTCAACAACTCCTTCAACGAGGCCATGGC

[0065] CTCCGATGCTCGACTGCTGACCAGCGTCCTCCTCAAGGAGGGACAGGGCGTCTTCGC

[0066] CGGCCTGAACTCCCTGGTCGACGTCGGCGGCGGCACCGGTAAGGTCGCTAAGGCCAT

[0067] CGCCAACGCCTTCCCTCATCTCAACTGCACCGTTCTCGACCTGCCCCACGTTGTTGCC

[0068] GGTCTGCAGGGCTCCAAGAACCTGAACTACTTCGCCGGCGACATGTTTGAGGCCATT

[0069] CCCCCCGCCGACGCCATCCTCCTCAAGTGGATCCTGCACGATTGGTCCGACGAGGAG

[0070] TGCGTTAAGATCCTGAAGCGATGCCGAGAGGCCATTCCTTCTAAGGAGAACGGCGGT

[0071] AAGGTCATCATCATCGATATGATCATGATGAAGAACCAGGGCGACTACAAGAGCAC

[0072] CGAGACCCAGCTGTTCTTTGACATGACCATGATGATCTTCGCCCCCGGCCGAGAGCG

[0073] AGACGAGAACGAGTGGGAGAAGCTGTTTCTGGACGCCGGCTTCTCTCACTACAAGAT

[0074] CACCCCCATCCTCGGCCTGCGATCTCTGATCGAGGTCTACCCCTAA

[0075] The PCR reaction procedure is as follows:

[0076] Table 1 Reaction procedure

[0077]

[0078]

[0079] The products were detected using 1% agarose gel and the target bands were recovered. The target gene ROMT was assembled with the linearized vector pACYCDuet using 2X MultiF Seamless Assembly Mix. The reaction system was 2 μL of linearized vector, 3 μL of inserted ROMT fragment, and 5 μL of 2X MultiF Seamless Assembly Mix. Assembly was carried out at 50 °C for 15 min. After assembly, the plasmid template was digested with DpnΙ and then heat-shock transformed into E. coli Turbo competent cells for cloning. After transformation of the assembly products, they were spread on plates containing 34 mg / L chloramphenicol resistance and cultured overnight. After single colonies were picked and verified as positive monoclonal by PCR, they were cultured on a large scale and plasmid extraction was performed using the HiPure Plasmid / BAC EF Micro Kit. Sanger sequencing was carried out by Sangon Biotech for confirmation.

[0080] Example 2

[0081] Transformation and fermentation of the recombinant plasmid: The recombinant plasmid pACYCDuet-ROMT was transferred into Yarrowia lipolytica PO1f (deposit number: ATCC90811), screened on YPD plates, and cultured at 30 °C for 1 - 2 d. Single colonies were picked into 2 mL of liquid medium and cultured at 30 °C and 200 rpm for 16 - 24 h as seeds. The seeds were mixed with 50% glycerol in equal proportion and stored in the strain preservation room. The seeds were streaked on YPD plates and cultured at 30 °C for 1 - 2 d. Single colonies were picked and inoculated into 5 mL YPD shake flasks, and the culture conditions were 30 °C and 200 rpm, OD 600When = 0.8 - 1.0, inoculate at an inoculation amount of 1% into a 1 L flask containing 250 mL of YPD liquid medium, and culture at 30 °C and 200 rpm for 24 - 36 h. Fermentation is carried out in a 5 L bioreactor. The initial OD of the fermenter after inoculation 600 is 0.8. The bioreactor is equipped with dissolved oxygen (DO), pH value, and temperature measurement probes, and is fed by an automatically controlled feeding system. Fermentation is carried out at 30 °C for 120 h. The reactor contains 3.5 L of basal medium, including 1 mM resveratrol, 0.6 g / L MgSO 4 ·7H 2 O, 10 g / L (NH 4 ) 2 SO 4 , 5 g / L KH 2 PO 4 , 40 g / L glucose, 8 mg / L vitamins, and 1 - 3 mg / L trace metal solution. The pH value during fermentation is maintained at about 5.0, and at the same time, the dissolved oxygen is maintained at 10% and the C / N is maintained at 10:1 by controlling stirring and ventilation.

[0082] Samples are taken at intervals during the reaction process. Using HPLC to detect the product, it is found that the conversion rate of the product pterostilbene is as high as 72% at 120 h of the reaction. The specific results are as Figure 4 shown.

[0083] Example 3

[0084] In this example, the same fermentation method as in Example 2 is used, but Yarrowia lipolytica Po1g (deposit number: ATCC20226) is used as the chassis strain, and the recombinant plasmid pACYCDuet-ROMT is transferred into Yarrowia lipolytica Po1g, and fermentation is carried out under the same conditions (the same as in Example 2). The conversion rate of the product pterostilbene is 57%, and the fermentation time is 144 hours. Although it can also obtain a good conversion rate, its implementation effect is not as good as that of Example 2. It can be seen that Yarrowia lipolytica PO1f is more adaptable than Yarrowia lipolytica Po1g after the transfer of the recombinant plasmid pACYCDuet-ROMT.

[0085] Comparative Example 1

[0086] In this example, the same fermentation method as in Example 2 was adopted, but Escherichia coli E. coli W3110 (deposit number: Bio-82057) was used as the chassis strain. The recombinant plasmid pACYCDuet-ROMT was transferred into Escherichia coli E. coli W3110. The temperature during the recombinant plasmid transformation and fermentation process was 37 °C. It was found by HPLC detection that the conversion rate of the product pterostilbene was 35%, and the fermentation time was 60 hours, which was not as effective as in Example 2 and Example 3. It can be seen from this that Yarrowia lipolytica is more adaptable when combined with the recombinant plasmid pACYCDuet-ROMT.

[0087] Example 4

[0088] Verification of the product in Example 2: The yield was detected by HPLC technology, and the structure of pterostilbene was confirmed by nuclear magnetic resonance (NMR) and mass spectrometry (MS). The specific structural formula is shown as follows:

[0089]

[0090] HPLC: It was fully extracted with an equal volume of ethyl acetate, and the ethyl acetate layer was separated. The organic solvent was removed by a rotary evaporator. The product HPLC analysis was carried out using an Agilent 1100 high-performance liquid chromatograph. The experimental method was as follows: Temperature: 25 °C; Injection volume: 10 μL; Flow rate: 1 min / L; Mobile phase: water: acetonitrile = 20:80; Time: 8 min; Detection wavelength: 280 nm; Solvent: methanol.

[0091] It was found by HPLC verification that the conversion rate of the product was as high as 72%. Therefore, using Yarrowia lipolytica as the chassis cell and expressing resveratrol O-methyltransferase (ROMT) by genetic engineering means, the bioconversion of resveratrol to pterostilbene was achieved, which is an efficient biotechnological production method.

[0092] Table 2 Attribution table of NMR test data of samples

[0093]

[0094] NMR: Test instrument: Nuclear magnetic resonance spectrometer Bruker AVANCE III HD, Radio frequency: 400 MHz, Test solvent: deuterated methanol. The results are shown in Table 2, Figure 1 and Figure 2 as shown.

[0095] MS: Test instrument: Waters SQ Detector 2 quadrupole mass spectrometer equipped with an ESI ion source (Waters). Test method: Dilute an appropriate amount of the sample with methanol and then perform the test on the instrument. Mobile phase A: Acetonitrile. Mobile phase B: 0.1% formic acid aqueous solution. Mobile phase C: 0.05% ammonia aqueous solution. Positive ion mode: Flow rates of mobile phases A and B are 0.4 mL / min. Negative ion mode: Flow rates of mobile phases A and C are 0.4 mL / min. The MS test results show that the molecular weight of the sample is 256, which is consistent with the theoretical molecular weight of pterostilbene. Combining the NMR test data of the sample, it is speculated that the molecular formula of the sample is C 16 H 16 O 3 which is consistent with the theoretical molecular formula of pterostilbene. The results are as Figure 3 shown.

[0096] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A bioconversion method for preparing pterostilbene, characterized in that: include: The recombinant plasmid was transferred into the chassis strain, and the recombinant Yarrowia lipolytica was obtained through culture and screening; Bioconversion of resveratrol to pterostilbene by fermentation with recombinant Yarrowia lipolytica in minimal medium; The chassis strain of the recombinant Yarrowia lipolytica is Yarrowia lipolytica PO1f, with the accession number being ATCC90811; The recombinant plasmid contains a codon-optimized resveratrol O-methyltransferase gene, wherein the codon-optimized resveratrol O-methyltransferase gene sequence is shown in SEQ ID NO: 1; The vector used in the recombinant plasmid is pACYCDuet.

2. The bioconversion method for preparing pterostilbene according to claim 1, characterized in that: The fermentation conditions are 25-35°C for 100-150 h, the pH value is maintained at 4.5-5.5 during the fermentation process, and the dissolved oxygen is maintained at 5-20% and the C / N is maintained at (5-15):1 by controlling stirring and ventilation.

3. The bioconversion method for preparing pterostilbene according to claim 1, characterized in that: The basic culture medium contains 0.5-1.5 mM resveratrol, 0.4-0.8 g / L magnesium salt, 8-12 g / L nitrogen source, 3-7 g / L potassium salt, 30-50 g / L carbon source, 5-10 mg / L vitamins and 1-3 mg / L trace metal solution.

4. The bioconversion method for preparing pterostilbene according to claim 3, characterized in that: The magnesium salt is selected from MgCl2 or MgSO4.7H2O.

5. The bioconversion method for preparing pterostilbene according to claim 3, characterized in that: The nitrogen source is selected from tryptone and (NH4)2SO4.

6. The bioconversion method for preparing pterostilbene according to claim 3, characterized in that: The potassium salt is selected from KH2PO4 and K2SO4.

7. The bioconversion method for preparing pterostilbene according to claim 3, characterized in that: The carbon source is selected from glycerol, sucrose, glucose, and soluble corn starch.

8. The bioconversion method for preparing pterostilbene according to claim 3, characterized in that: The vitamins are selected from Wolfe's Vitamin Solution.

9. The bioconversion method for preparing pterostilbene according to any one of claims 1 to 8, characterized in that: The step of obtaining the recombinant Yarrowia lipolytica comprises: a) constructing a vector: assembling the resveratrol O-methyltransferase gene fragment with the Escherichia coli expression vector, digesting, transforming and then expanding the culture to obtain a recombinant plasmid; b) Transformation: The recombinant plasmid is transferred into Yarrowia lipolytica, and the recombinant Yarrowia lipolytica is obtained through culture and screening.

10. The bioconversion method for preparing pterostilbene according to claim 9, characterized in that: The assembly process is as follows: assemble the target gene ROMT with the linearized vector pACYCDuet; the assembly reaction system is 1-3 μL of the linearized vector pACYCDuet, 2-4 μL of the ROMT fragment, 4-6 μL of 2X MultiF Seamless Assembly Mix, and assemble at 45-55 °C for 10-20 min; The digestion and transformation refer to digesting the assembled plasmid with Dpn Ι and then heat-shock transforming the E. coli Turbo clone competent cell; The culture medium for expanded culture is LB medium, which specifically comprises Tryptone 8-15 g / L, Yeast Extract 4-6 g / L, and NaCl 7-15 g / L, and 1-2% agar is additionally added to the solid culture medium.

11. The bioconversion method for preparing pterostilbene according to claim 9, characterized in that: During the transformation process, the culture conditions were 25-35 °C, 150-300 rpm, and OD 600 =0.8-1.0, inoculate in a 1 L shake flask containing 200-300 mL YPD liquid culture medium at a rate of 1%, and culture at 25-35°C and 150-300 rpm for 24-36 h; the specific composition of the YPD liquid culture medium is Tryptone 15-30 g / L, Yeast Extract 7-15 g / L, and Glucose 15-30 g / L.

12. A recombinant Yarrowia lipolytica prepared by the bioconversion method for preparing pterostilbene according to any one of claims 1 to 11.

13. Use of the recombinant Yarrowia lipolytica according to claim 12 in the production process of pterostilbene.

Images