An SSR marker fingerprint of Pleurotus giganteus PG46 strain and its construction method and application

Abstract

The present invention relates to the technical field of detection of Pleurotus maxima strains, and discloses an SSR marker fingerprint of Pleurotus maxima PG46 strain, its construction method, and application. The fingerprint consists of 10 pairs of SSR molecular markers developed based on whole-genome sequencing of Pleurotus maxima. The construction method includes: mycelium culture; genomic DNA extraction; SSR molecular marker detection; polyacrylamide gel electrophoresis detection; and application includes: amplifying SSR molecular markers of Pleurotus maxima strains, comparing the obtained band pattern with the fingerprint pattern, and the strain consistent with the fingerprint pattern is Pleurotus maxima PG46 strain. Compared with conventional morphological identification, antagonism test, and fruiting experiment, the present invention has the advantages of short detection time, high accuracy, and good repeatability. Using the SSR fingerprint constructed by the present invention, PG46 has strain specificity among these 7 different strains.

Description

Technical Field

[0001] The present invention relates to the technical field of detection of Pleurotus giganteus strains, and specifically to an SSR marker fingerprint of Pleurotus giganteus PG46 strain, a construction method thereof, and an application thereof. Background Art

[0002] Giant Pleurotus (Pleurotus giganteus (Berk.) Karun. & K.D. Hyde) is a rare edible fungus developed in China. Its unique taste and flavor, resembling the smoothness of pig's stomach, earns it the trade name "Pig's Tripe Mushroom." Rich in nutrients, including polysaccharides, protein, and crude fiber, it also boasts numerous medicinal properties, including anti-inflammatory, anti-tumor, antifungal, and liver-protective properties. It is highly sought after by consumers and holds high potential market value. Its strong environmental adaptability, simple cultivation techniques, and high biomass conversion rate have gradually attracted the attention of edible fungus producers. Cultivation is now underway in several provinces and cities, and the scale of cultivation is continuously expanding. Studies have found that wild giant Pleurotus is most common in the hot summer and early autumn, primarily in tropical regions of China, as well as in tropical and subtropical regions such as Southeast Asia and Oceania. Biological characterization experiments have also shown that giant Pleurotus is not only heat-resistant (35°C) during its mycelial stage, but also does not require strict cold stimulation during its primordium stage. Its fruiting bodies are also suitable for fruiting in the warmer summer temperatures (23-32°C). The typical high temperature resistance of Pleurotus ostreatus is very meaningful for solving the off-season of edible fungus production and regulating market supply, especially providing new opportunities for the development of edible fungus industry in hot areas.

[0003] However, with the continuous development of the giant fungus industry, the problem of "same species with different names, same name with different species" in giant fungus production has become increasingly prominent. A study of 20 giant fungus strains collected in China found that only 7 had different genetic backgrounds, while the others were all identical with different names. This problem not only damages the intellectual property rights of giant fungus breeders, but also poses a significant risk to producers and creates hidden dangers for the further development of the giant fungus industry. To protect the rights and interests of breeders, reduce the risks for producers, and promote the healthy, stable, and sustainable development of my country's giant fungus industry, it is urgent to establish a simple, rapid, and reliable technology for the specific identification of giant fungus strains.

[0004] With the rapid development of molecular biology and the continuous maturity of DNA sequencing technology, the cost of high-throughput sequencing is also decreasing. DNA molecular marker technology can detect the genetic specificity of Pleurotus ostreatus strains at the gene level. The completion of Pleurotus ostreatus whole genome sequencing has facilitated the development of SSR markers. SSR molecular markers are an application based on high-throughput sequencing technology, which reduces the cost of SSR marker development and is suitable for the development of molecular markers for Pleurotus ostreatus whole genome sequencing. SSR markers have the advantages of abundant quantity, high accuracy, good stability, and quick and simple operation. They are not only used for molecular marker-assisted breeding, but also for the identification of Pleurotus ostreatus strains. Summary of the Invention

[0005] In response to the problems in the related art, the present invention proposes an SSR marker fingerprint map of the giant fungus PG46, as well as its construction method and application. Compared with conventional morphological detection, antagonism test and mushroom fruiting test, the fingerprint map has the advantages of short detection time, high accuracy and good repeatability.

[0006] To this end, the specific technical solutions adopted in the present invention are as follows:

[0007] According to one aspect of the present invention, an SSR marker fingerprint of Pleurotus giganteus PG46 is provided. The fingerprint consists of 10 pairs of SSR markers. The SSR marker primers are developed based on the whole genome of Pleurotus giganteus, and have good amplification banding and high reproducibility. Detailed information on the marker primers is shown in Table 1:

[0008] Table 1 Detailed information list of SSR marker primers

[0009]

[0010]

[0011] According to another aspect of the present invention, a method for constructing an SSR marker fingerprint of Pleurotus giganteus PG46 strain is provided, comprising:

[0012] S1. Mycelial culture: Pleurotus maxima was transferred to a plate containing 20 mL of PDA medium, cultured in the dark at 28°C, and the mycelia were collected after 7 days.

[0013] S2. Extraction of genomic DNA: Extract genomic DNA from the mycelium using a plant genomic DNA extraction kit, detect the concentration and purity of the genomic DNA by agarose gel electrophoresis and UV spectrophotometry, and adjust the concentration of the sample DNA to 20-30 ng / μL;

[0014] S3. Detection of SSR molecular markers: PCR amplification of SSR molecular markers was performed on the extracted genomic DNA;

[0015] S4. Electrophoresis detection: Mix the amplified PCR product with the loading buffer, perform electrophoresis, silver stain, develop the color, and take pictures.

[0016] Furthermore, the method of extracting genomic DNA from the mycelium using a plant genomic DNA extraction kit, detecting the concentration and purity of the genomic DNA by agarose gel electrophoresis and ultraviolet spectrophotometry, and adjusting the concentration of the sample DNA to 20-30 ng / μL includes:

[0017] S201, take 100 mg of mycelium and put it into a 1.5 mL centrifuge tube, and add liquid nitrogen to grind it thoroughly;

[0018] S202. Quickly add 400 μL of Buffer LP1 and 6 μL of RNase A (10 mg / mL) to the ground powder, vortex for 1 min, and let it stand at room temperature for 10 min to allow for complete lysis.

[0019] S203. Add 130 μL of Buffer LP2 to the lysate, mix thoroughly by inverting, and vortex for 1 min.

[0020] S204, centrifuge at 12000 rpm for 5 min, and transfer the supernatant to a new centrifuge tube;

[0021] S205, add 1.5 times the volume of Buffer LP3 and mix by inverting upside down 8-10 times;

[0022] S206. Transfer the solution and precipitate obtained in S205 to the adsorption column in the collection tube, centrifuge at 12000 rpm for 1 min, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube;

[0023] S207. Add 500 μL of Buffer GW2 to the adsorption column, centrifuge at 12000 g for 1 min, discard the waste liquid in the collection tube, and return the adsorption column to the collection tube;

[0024] S208, repeat step S207;

[0025] S209, centrifuge at 12000 rpm for 2 min, discard the waste liquid in the collection tube, place the adsorption column in a new centrifuge tube, and leave it at room temperature for several minutes to dry completely;

[0026] S210. Add 50-80 μL of Buffer GE to the middle of the membrane of the adsorption column, let it stand at room temperature for 2-5 minutes, centrifuge at 12000 rpm for 1 minute, and collect the DNA solution.

[0027] S211. Take 2 μL of DNA solution and test the DNA concentration and purity on a 2% agarose gel and a spectrophotometer, respectively.

[0028] Furthermore, the PCR amplification system for the detection of SSR molecular markers was as follows: a total volume of 25 μL, including 10× Buffer 2 μL, 25 mmol / L MgCL2 2 μL, 10 mmol / L dNTPs 0.6 μL, 5 U / μL Taq DNA polymerase 0.3 μL, 10 μmol / L SSR marker forward primer and reverse primer 0.3 μL each, DNA template at a concentration of 20-30 ng / μL 0.5 μL, and ddH2O 19 μL;

[0029] The PCR reaction conditions were: 94°C for 5 min, 94°C for 40 s, 60°C for 40 s, 72°C for 1 min, and 72°C for 10 min, for 30 cycles.

[0030] Furthermore, the electrophoresis in step S4 includes: taking 1 μL of the amplified PCR product and 1 μL of 2× denaturing gel buffer, mixing them in sequence, and spotting them in the spotting holes of a polyacrylamide gel, where the volume percentage of the polyacrylamide gel is 20% and the electrophoresis buffer is 1×TBE; 180V voltage, constant voltage running for 90 minutes.

[0031] The specific process of silver staining and color development is as follows: after electrophoresis, the glass plate is disassembled, the gel plate is washed with deionized water for 10-20 seconds, then placed in silver staining solution and silver-stained in the dark for 5-8 minutes, and then washed with deionized water for 10-20 seconds after silver staining. After silver staining, it is placed in developer until clear bands appear, and then washed with deionized water for 5-8 seconds. The band characteristics are recorded by taking pictures in a biological macromolecule analyzer; the silver staining solution and developer can be reused 3-4 times.

[0032] Ten pairs of SSR marker primers were used to perform PCR amplification on the Pleurotus ostreatus strain. The number and relative molecular weight of the allelic fragments amplified by each SSR marker primer were determined by comparing with the 50bp ladder DNA marker. The strain with the band type that matched the number combination of (1+2)(1+3)(4+5)(1)(4)(1+4)(2+4+5)(2+3)(2)(2+5+6) was found, and the strain was confirmed to be Pleurotus ostreatus PG46.

[0033] According to another aspect of the present invention, an application of an SSR marker fingerprint of Pleurotus giganteus PG46 is provided, wherein 10 pairs of SSR marker primers are developed using the whole genome of Pleurotus giganteus, and SSR marker amplification is performed on 7 Pleurotus giganteus strains with different genetic backgrounds. The number and relative molecular weight of the allelic fragments amplified by the 10 pairs of SSR marker primers in each Pleurotus giganteus strain are determined by comparing with a 50 bp ladder DNA marker and numbered ( Figure 2-Figure 11 , Table 2). The numbering combination of different SSR alleles can effectively identify the "PG46" strain among the collected Pleurotus ostreatus strains (Table 3). Its banding number combination is: (1+2)(1+3)(4+5)(1)(4)(1+4)(2+4+5)(2+3)(2)(2+5+6). The strain that meets this banding combination is the Pleurotus ostreatus PG46 strain.

[0034] Table 2 Summary of information of all alleles amplified by SSR primers

[0035]

[0036]

[0037] Table 3 Allelic fragment numbers amplified by strain PG46

[0038]

[0039]

[0040] The present invention has the following beneficial effects: The SSR marker fingerprint of the Pleurotus giardia PG46 strain can be used to identify the PG46 strain. Compared with conventional morphological identification, antagonism tests, and fruiting experiments, the present invention has the advantages of shorter detection time, higher accuracy, and better repeatability. The detection time only takes 3-4 days, while conventional antagonism tests require at least 1 week and fruiting tests require at least 2 months. The method is specific for the PG46 strain among seven collected Pleurotus giardia strains with different genetic backgrounds and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0042] Figure 1This is the SSR marker fingerprint of Pleurotus maxima PG46, where M is a 50 bp ladder DNA marker, numbers 1-10 represent the 10 pairs of SSR marker primers used, and arrows indicate the specific SSR allele combinations of Pleurotus maxima PG46;

[0043] Figure 2 This is the amplification pattern of primer PGSSR23 in the seven selected Pleurotus ostreatus materials;

[0044] Figure 3 This is the amplification pattern of primer PGSSR24 in the seven selected Pleurotus ostreatus materials;

[0045] Figure 4 This is the amplification pattern of primer PGSSR31 in the seven selected Pleurotus ostreatus materials;

[0046] Figure 5 This is the amplification pattern of primer PGSSR32 in the seven selected Pleurotus ostreatus materials;

[0047] Figure 6 This is the amplification pattern of primer PGSSR34 in the seven selected Pleurotus ostreatus materials;

[0048] Figure 7 This is the amplification pattern of primer PGSSR35 in the seven selected Pleurotus ostreatus materials;

[0049] Figure 8 This is the amplification pattern of primer PGSSR46 in the seven selected Pleurotus ostreatus materials;

[0050] Figure 9 This is the amplification pattern of primer PGSSR68 in the seven selected Pleurotus ostreatus materials;

[0051] Figure 10 This is the amplification pattern of primer PGSSR86 in the seven selected Pleurotus ostreatus materials;

[0052] Figure 11 This is the amplification pattern of primer PGSSR91 in the seven selected Pleurotus ostreatus materials. DETAILED DESCRIPTION

[0053] To further illustrate each embodiment, the present invention provides drawings, which are part of the disclosure of the present invention. They are mainly used to illustrate the embodiments and can be used in conjunction with the relevant descriptions in the specification to explain the operating principles of the embodiments. By referring to these contents, ordinary technicians in this field should be able to understand other possible implementation methods and advantages of the present invention. The components in the figures are not drawn to scale, and similar component symbols are generally used to represent similar components.

[0054] In this example, aq DNA polymerase, marker and other molecular reagents were purchased from Thermo Fisher Scientific; the remaining chemical reagents and materials were all commercially available products.

[0055] Sources of 7 Pleurotus gibberellicus strains with different genetic backgrounds:

[0056] Strain PG46 (a synonym of Agaricus suis 1, Agaricus suis 2, Agaricus suis 1, Agaricus suis 2, Agaricus suis, Agaricus suis F1 from Shouguang Edible Fungi Research Institute, Shandong, Agaricus suis-1 and Agaricus suis-2 from Gutian Edible Fungi Research Institute, Fujian, c.m0003, c.m0010, c.m0013, c.m0030 from Fujian Agriculture and Forestry University, and Agaricus suis from Chengde Edible Fungi Research Institute, Hebei) was obtained from Longhu Nanke Edible Fungi Company, Haikou City, Hainan Province; strain PG79 was obtained from Longhu Nanke Edible Fungi Company, Haikou City, Hainan Province; strain PG133 was collected from the wild in Danzhou City, Hainan Province; strain PG191 of Agaricus suis was obtained from Guizhou Academy of Agricultural Sciences; strain PG219 was obtained from Fujian Agriculture and Forestry University; strain PG7031 was obtained from Yangzhou University; and strain PG7092 was obtained from Yangzhou University.

[0057] Among them, the sequences of 10 pairs of SSR marker primers (5'-3') are as follows:

[0058] PGSSR23 forward primer: GTATTTTTGTTCTTTGCCATCCA;

[0059] Reverse primer: TCCCAAAGGTAAAATGTGTCAAC;

[0060] PGSSR24 forward primer: TGGATTATACGTTTACGAGACCG;

[0061] Reverse primer: AGCACACCGTTTAGAAGAAATCA;

[0062] PGSSR31 forward primer: GACGTAGAATAACATTTCGGCTG;

[0063] Reverse primer: AAGGTGAACTAAAACGCACTCTG;

[0064] PGSSR32 forward primer: GTAATGGTCCCAATGGTCCTC;

[0065] Reverse primer: CCTACATTGTCATCACCATTTGT;

[0066] PGSSR34 forward primer: TACATACCAAACCCCATACAACC;

[0067] Reverse primer: GGATAGTTCTCGATACGAAGGCT;

[0068] PGSSR35 forward primer: GCAGTAGATTCTGTGGCTTGAAC;

[0069] Reverse primer: ACTGATTGGGAGTGACAAAAGAA;

[0070] PGSSR46 forward primer: CGAGAAAACAAGCTATCGTGAGT;

[0071] Reverse primer: CGATCGTCTGTACCTTTCAT;

[0072] PGSSR68 forward primer: GTAGGTTGTGCAGAAGAGATGCT;

[0073] Reverse primer: GCACCTCGATTTGTTGTTATCTC;

[0074] PGSSR86 forward primer: ATACATATGCTCGTTGGTCGTCT;

[0075] Reverse primer: GGAGAGAGAGAGAGAAGCCAGTC;

[0076] PGSSR91 forward primer: CTGATCGGCTTCCTCATCTAGT;

[0077] Reverse primer: CAGAGTAGTGCCATCTCCAAGTT.

[0078] Example 1

[0079] (1) Mycelial culture: Pleurotus thunbergii was transferred to a plate containing 20 mL of PDA medium and cultured in the dark at 28°C. Mycelial cells were collected after 7 days.

[0080] (2) Genomic DNA extraction: Genomic DNA from the hyphae was extracted using a new plant genomic DNA extraction kit from Kangwei Century Company according to the protocol in the kit. The concentration and purity of the genomic DNA were determined by agarose gel electrophoresis and UV spectrophotometry, and the sample DNA concentration was adjusted to 20-30 ng / μL.

[0081] The specific process of extracting genomic DNA from mycelium using the kit method includes:

[0082] ① Take about 100 mg of mycelium and place it in a 1.5 mL centrifuge tube, add liquid nitrogen and grind it thoroughly;

[0083] ② Quickly add 400 μL Buffer LP1 and 6 μL RNase A (10 mg / mL) to the ground powder, vortex for 1 minute, and let it stand at room temperature for 10 minutes to allow it to fully lyse;

[0084] ③ Add 130 μL of Buffer LP2 to the lysate, mix thoroughly by inverting, and vortex for 1 minute.

[0085] ④ Centrifuge at 12000 rpm for 5 min and transfer the supernatant to a new centrifuge tube;

[0086] ⑤ Add 1.5 times the volume of Buffer LP3 and mix by inverting for 8-10 times;

[0087] ⑥ Transfer the liquid and precipitate obtained in the previous step to the adsorption column in the collection tube, centrifuge at 12000 rpm for 1 min, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube;

[0088] ⑦ Add 500 μL of Buffer GW2 to the adsorption column, centrifuge at 12,000 rpm for 1 min, discard the waste liquid in the collection tube, and return the adsorption column to the collection tube;

[0089] ⑧Repeat step ⑦;

[0090] ⑨ Centrifuge at 12000 rpm for 2 minutes, discard the waste liquid in the collection tube, place the adsorption column in a new centrifuge tube, and leave it at room temperature for several minutes to dry completely;

[0091] ⑩ Add 50-80 μL of Buffer GE to the middle of the membrane of the adsorption column, let it stand at room temperature for 2-5 minutes, centrifuge at 12000 rpm for 1 minute, and collect the DNA solution.

[0092] Take 2 μL of DNA solution and detect the DNA concentration and purity on 2% agarose gel and spectrophotometer respectively.

[0093] (3) Detection of SSR molecular markers: The genomic DNA extracted above was subjected to PCR amplification of SSR molecular markers; the PCR amplification system was as follows: a volume of 25 μL, including 2 μL of 10× Buffer, 2 μL of 25 mmol / L MgCl2, 0.6 μL of 10 mmol / L dNTPs, 0.3 μL of 5 U / μL Taq DNA polymerase, 0.3 μL each of 10 μmol / L SSR marker forward primer and reverse primer, 0.5 μL of DNA template at a concentration of 20-30 ng / μL, and 19 μL of ddH2O;

[0094] The PCR reaction conditions were: 94°C for 5 min, 94°C for 40 s, 60°C for 40 s, 72°C for 1 min, and 72°C for 10 min, for 30 cycles.

[0095] (4) Electrophoresis: 1 μL of the PCR product obtained by the above amplification was mixed with 1 μL of 2× denaturing gel buffer, and then spotted in the spotting wells of a 20% polyacrylamide gel using 1× TBE as the electrophoresis buffer. The sample was run at 180 V for 90 min, followed by silver staining, color development, and photography.

[0096] The specific process of silver staining and color development is as follows: after electrophoresis, the glass plate is disassembled, the plate is washed with deionized water for 10-20 seconds, then placed in silver stain solution and silver-stained in the dark for 5-8 minutes. After silver staining, it is rinsed with deionized water for 10-20 seconds, placed in developer solution until clear bands appear, and then washed with deionized water for 5-8 seconds. The band characteristics are recorded using a biomacromolecule analyzer. The silver stain solution and developer solution can be reused 3-4 times.

[0097] The 10 pairs of SSR marker primers were used to perform PCR amplification of Pleurotus giganteus strains. The number and relative molecular weight of the allele fragments amplified by each SSR marker primer were determined by comparing with a 50 bp ladder DNA marker. Figure 2-Figure 11 ), find the strain with the band pattern that matches the number combination: (1+2)(1+3)(4+5)(1)(4)(1+4)(2+4+5)(2+3)(2)(2+5+6), and you can determine that the strain is Pleurotus ostreatus PG46. Figure 1 To ensure the accuracy of identification, the experiment was repeated three times.

[0098] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A method for constructing an SSR fingerprint of Pleurotus giganteus PG46 strain, characterized in that: include: S1. Mycelial culture: Pleurotus maximus was transferred to a plate containing 20 mL of PDA medium, cultured in the dark at 28°C, and the mycelia were collected after 7 days. S2. Extraction of genomic DNA: Extract genomic DNA from the mycelium using a plant genomic DNA extraction kit, detect the concentration and purity of the genomic DNA by agarose gel electrophoresis and UV spectrophotometry, and adjust the concentration of the sample DNA to 20-30 ng / μL; S3. Detection of SSR molecular markers: PCR amplification of SSR molecular markers was performed on the extracted genomic DNA; S4. Electrophoresis detection: The amplified PCR product was mixed with the loading buffer, and then electrophoresed, silver-stained, developed, and photographed. The PCR amplification system for SSR molecular marker detection is as follows: a total volume of 25 μL, including 2 μL of 10× Buffer, 2 μL of 25 mmol / L MgCl2, 0.6 μL of 10 mmol / L dNTPs, 0.3 μL of 5 U / μL Taq DNA polymerase, 0.3 μL each of 10 μmol / L SSR marker forward and reverse primers, 0.5 μL of DNA template at a concentration of 20-30 ng / μL, and 19 μL of ddH2O. PCR reaction conditions were as follows: 94°C for 5 min, 94°C for 40 s, 60°C for 40 s, 72°C for 1 min, and 72°C for 10 min, for 30 cycles; The marker primers consist of 10 pairs of SSR primers named PGSSR23, PGSSR24, PGSSR31, PGSSR32, PGSSR34, PGSSR35, PGSSR46, PGSSR68, PGSSR86, and PGSSR91. The specific sequences are as follows: PGSSR23 forward primer: GTATTTTTGTTCTTTGCCATCCA; Reverse primer: TCCCAAAGGTAAAATGTGTCAAC; PGSSR24 forward primer: TGGATTATACGTTTACGAGACCG; Reverse primer: AGCACACCGTTTAGAAGAAATCA; PGSSR31 forward primer: GACGTAGAATAACATTTCGGCTG; Reverse primer: AAGGTGAACTAAAACGCACTCTG; PGSSR32 forward primer: GTAATGGTCCCAATGGTCCTC; Reverse primer: CCTACATTGTCATCACCATTTGT; PGSSR34 forward primer: TACATACCAAACCCCATACAACC; Reverse primer: GGATAGTTCTCGATACGAAGGCT; PGSSR35 forward primer: GCAGTAGATTCTGTGGCTTGAAC; Reverse primer: ACTGATTGGGAGTGACAAAAGAA; PGSSR46 forward primer: CGAGAAAACAAGCTATCGTGAGT; Reverse primer: CGATCGTCTGTACCTTTCAT; PGSSR68 forward primer: GTAGGTTGTGCAGAAGAGATGCT; Reverse primer: GCACCTCGATTTGTTGTTATCTC; PGSSR86 forward primer: ATACATATGCTCGTTGGTCGTCT; Reverse primer: GGAGAGAGAGAGAGAAGCCAGTC; PGSSR91 forward primer: CTGATCGGCTTCCTCATCTAGT; Reverse primer: CAGAGTAGTGCCATCTCCAAGTT.

2. The method for constructing an SSR marker fingerprint of a Pleurotus giganteus PG46 strain according to claim 1, characterized in that: The electrophoresis comprises: Take 1 μL of the amplified PCR product and 1 μL of 2x denaturing gel buffer, mix them in sequence, and then spot them in the spotting wells of a polyacrylamide gel. The volume percentage of the polyacrylamide gel is 20%, and the electrophoresis buffer is 1×TBE; run at a constant voltage of 180 V for 90 min.

3. The method for constructing an SSR marker fingerprint of Pleurotus giganteus PG46 strain according to claim 1, characterized in that: The specific process of silver staining and color development is as follows: After electrophoresis, remove the glass plate, wash the gel plate with deionized water for 10-20 seconds, then place it in silver staining solution and silver stain in the dark for 5-8 minutes. After silver staining, wash it with deionized water for 10-20 seconds, place it in developer until clear bands appear, and then wash it with deionized water for 5-8 seconds. Take pictures and record the band characteristics in a biological macromolecule analyzer; the silver staining solution and developer solution can be reused 3-4 times.

4. The method for constructing an SSR fingerprint of Pleurotus giganteus PG46 according to claim 1, characterized in that: PCR amplification of the Pleurotus maxima strain was performed using 10 pairs of SSR marker primers. The number and relative molecular weight of the allelic fragments amplified by each SSR marker primer were determined by comparing with a 50bp ladder DNA marker. The strain with the band pattern that matched the number combination of (1+2)(1+3)(4+5)(1)(4)(1+4)(2+4+5)(2+3)(2)(2+5+6) was found, and the strain was confirmed to be Pleurotus maxima PG46. Among them, the information of all the allele fragments amplified by SSR primers is as follows:

5. The use of the SSR marker fingerprint of the Pleurotus giardia PG46 strain according to claim 1, characterized in that: Ten pairs of SSR marker primers developed from the whole genome of Pleurotus giganteus were used to amplify SSR markers of Pleurotus giganteus strains. The obtained banding patterns were compared with the banding patterns of Pleurotus giganteus PG46 strains. The strains with the same banding patterns were Pleurotus giganteus PG46 strains. The banding pattern number combinations of Pleurotus giganteus PG46 strains were: (1+2)(1+3)(4+5)(1)(4)(1+4)(2+4+5)(2+3)(2)(2+5+6); The information of all the alleles amplified by the SSR primers is as follows.

Images