An endophytic fungus HSDM12 of Cannabis that simultaneously produces three flavonoid components and its application
By using the cannabis endophytic fungus HSDM12, efficient and environmentally friendly flavonoids are achieved, the problems of low yield and environmental pollution in the existing technology have been solved, and the industrial application of flavonoids has been promoted.
Patent Information
- Application Number
- CN202410927996.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-11
- Publication Date
- 2025-07-11
- Estimated Expiration
- 2044-07-11
AI Technical Summary
The existing production methods of flavonoids are low in yield, high in cost and polluting the environment, making it difficult to achieve industrial production.
A cannabis endophytic fungus HSDM12 (Coniochaeta hoffmannii), the strain is able to produce three flavonoid components during the fermentation process: vistin, kaempferol and luteolin, which achieves efficient production through microbial fermentation.
The fermentation yield of cannabis endophytic fungus HSDM12 is high, with few by-products, less pollution, short production cycle, simple product separation, and suitable for industrial production.
Smart Images

Figure CN118813419B_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the field of microorganisms, and in particular to an endophytic cannabis fungus HSDM12 capable of producing three flavonoid components simultaneously and an application thereof. Background Art
[0002] Flavonoids are generally found in plants in nature and have a variety of biological activities, including anti-tumor, anti-oxidation, hypoglycemic, and anti-myocardial ischemia. They are widely used in the fields of food, medicine, and cosmetics. Among them, luteolin (C 15 H 10 Quercetin (C O6) is a natural flavonoid compound found in many plants. It has a variety of pharmacological activities, such as anti-inflammatory, anti-allergic, uric acid lowering, anti-tumor, antibacterial, antiviral, etc. It is mainly used clinically for cough relief, expectoration, anti-inflammatory, uric acid lowering, treatment of cardiovascular diseases, treatment of "amyotrophic lateral sclerosis", SARS, hepatitis, etc. 15 H 10 O7) is a representative of flavonoid compounds. The anti-apoptosis and antioxidant functions of quercetin can protect against multiple organ damage. In addition, quercetin also has multiple pharmacological effects such as anti-cancer, anti-inflammatory, antibacterial, antiviral, hypoglycemic, hypotensive, immune regulation and cardiovascular protection. In particular, due to its ability to regulate inflammation and redox imbalance, it has been used as a treatment option for lung diseases. 21 H 20 O 10 ), has anti-cancer, anti-inflammatory, anti-allergic and neuroprotective effects, and has a certain protective effect on the kidneys.
[0003] The existing production of flavonoids such as luteolin, quercetin, and vitexin is currently mainly extracted and separated from plant tissues, and the content of the above flavonoids in plant raw materials is relatively low, and the demand for raw materials is large; and the raw materials are easily restricted by seasons. All of the above factors lead to high costs and are not conducive to industrial production. Artificial chemical synthesis produces flavonoids, which have high purity, are controllable, and the compound structure can be designed. They can be used for mass production and avoid excessive use of plant resources, but the waste and toxic waste gas generated during the synthesis process will aggravate environmental pollution. Summary of the invention
[0004] The present invention aims to solve the problems of low yield and environmental pollution in the existing production methods of flavonoid compounds, and provides a cannabis endophytic fungus HSDM12 that simultaneously produces three flavonoid components and its application.
[0005] The present invention provides an endophytic fungus of cannabis HSDM12, which is Coniochaeta hoffmannii HSDM12. It has been deposited in the China Center for Type Culture Collection, with the deposit address being Wuhan University, Wuhan City, the deposit date being May 16, 2024, and the deposit number being CCTCC NO: M 2024969.
[0006] The colony of the endophytic fungus of cannabis HSDM12 of the present invention is yellow, with sparse mycelia, felt-like, and the substrate is yellow.
[0007] The ITS rDNA sequence of the endophytic fungus of cannabis HSDM12 of the present invention was submitted to the NCBI database for BLAST analysis and alignment. The MEGA7 software was used to analyze the sequences of strains with relatively high homology to the sequence of the endophytic fungus of cannabis HSDM12. The similarity between the sequence of the endophytic fungus of cannabis HSDM12 strain and Coniochaeta hoffmannii (OQ692842.1) reached 100%. The endophytic fungus of cannabis HSDM12 was identified as Coniochaeta hoffmannii.
[0008] The application of the endophytic fungus of cannabis HSDM12 of the present invention in the fermentation production of three flavonoid compounds.
[0009] Furthermore, the three flavonoid compounds are vitexin, kaempferol, and luteolin.
[0010] The application of the endophytic fungus of cannabis HSDM12 of the present invention in inhibiting bacteria.
[0011] Furthermore, the bacteria are Bacillus subtilis and Acinetobacter baumannii.
[0012] The beneficial effects of the present invention:
[0013] An endophytic fungus of cannabis HSDM12 was isolated from industrial cannabis in the present invention and was identified as Coniochaeta hoffmannii. This strain can produce three flavonoid compounds simultaneously, namely vitexin, kaempferol, and luteolin. The endophytic fungus of cannabis HSDM12 of the present invention has good antibacterial activity, has a certain inhibitory effect on both Bacillus subtilis and Acinetobacter baumannii, and has a better antibacterial effect on Bacillus subtilis.
[0014] The endophytic fungus of cannabis HSDM12 of the present invention can produce flavonoid compounds by dry production. Due to the large production volume of microbial fermentation, few by-products, little pollution, short production cycle, and relatively simple product separation, it has broad application prospects in industrial production. Description of the Drawings
[0015] Figure 1 Colony morphology diagram of the endophytic fungus HSDM12 of the present invention;
[0016] Figure 2 Mycelium morphology diagram of the endophytic fungus HSDM12 of the present invention;
[0017] Figure 3 Phylogenetic tree of the endophytic fungus HSDM12 of the present invention;
[0018] Figure 4 HPLC chromatogram of luteolin in the ethyl acetate extraction part of HSDM12;
[0019] Figure 5 HPLC chromatogram of kaempferol in the ethyl acetate extraction part of HSDM12;
[0020] Figure 6 HPLC chromatogram of vitexin in the n-butanol saturated with water extraction part of HSDM12;
[0021] Figure 7 Analysis result of compound A by HPLC method;
[0022] Figure 8 For compound A 1 1H nuclear magnetic resonance spectrum;
[0023] Figure 9 Analysis result of compound B by HPLC method;
[0024] Figure 10 For compound B 1 1H nuclear magnetic resonance spectrum;
[0025] Figure 11 Analysis result of compound C by HPLC method;
[0026] Figure 12 For compound C 1 1H nuclear magnetic resonance spectrum. Detailed implementation manners
[0027] The following makes a detailed description of the embodiments of the present invention. The following embodiments are implemented on the premise of the technical solution of the present invention, and detailed implementation schemes and specific operation processes are given, but the protection scope of the present invention is not limited to the following embodiments.
[0028] Example 1:
[0029] The endophytic fungus HSDM12 of this example is Coniochaeta hoffmannii HSDM12, which has been deposited in the China Center for Type Culture Collection. The deposit address is Wuhan University, Wuhan. The deposit date is May 16, 2024, and the deposit number is CCTCC NO: M 2024969.
[0030] The method for obtaining the endophytic fungus HSDM12 of industrial hemp in this example is as follows:
[0031] Take the leaves of industrial hemp (Cannabis sativa L.) (Longma No. 5, collected from the Science and Technology Innovation Farm of Suihua Branch of Heilongjiang Academy of Agricultural Sciences), and disinfect the surface. The disinfection procedure is as follows: soak the seeds in 75% alcohol for 30 s, wash with sterile water, then rinse in sodium hypochlorite for 5 min, wash with sterile water, then soak in 75% alcohol for 30 s, and finally wash with sterile water again.
[0032] Use a sterile scalpel to cut the disinfected experimental material into small squares with a side length of 5 mm, place them in PDA medium, and incubate at 28 °C for 5 - 7 d.
[0033] Take the last washing solution of the disinfection procedure, spread and inoculate it in PDA medium. And place the non - cut experimental material after disinfection on the PDA medium, roll it around once and then take it out, and co - culture it with the endophytic fungus isolation medium as a control.
[0034] Preparation method of potato solid medium (PDA medium): Weigh 100 g of fresh peeled potato pieces, place them in boiling water, keep boiling for 30 min, filter, add 20 g of glucose and 16 g of agar powder in the formula to the filtrate. After it is completely dissolved, make up the total volume of the medium to 1 L with water, the pH is natural, dispense, sterilize (121 °C, 0.1 MPa, 30 min), and let it cool for standby.
[0035] The endophytic fungus HSDM12 was isolated from the leaves of industrial hemp. No bacteria grew in the negative control plate and the negative control liquid medium, and this was the case after repeated experiments many times, thus proving that the isolated bacteria are endophytic fungi of industrial hemp.
[0036] Example 2: Identification of the endophytic fungus HSDM12 of industrial hemp
[0037] Colony and spore morphology observation and ITS rDNA sequence analysis method were used for strain identification.
[0038] The colony morphology diagram of the endophytic fungus HSDM12 is as Figure 1 shown, and the hypha morphology diagram is as Figure 2 shown. The colony of the endophytic fungus HSDM12 is yellow, the hyphae are sparse, felt - like, and the substrate is yellow.
[0039] The ITS rDNA sequence (549bp) of the endophytic fungus HSDM12 of the present invention was submitted to the NCBI database, analyzed by BLAST and aligned, and a phylogenetic tree of the endophytic fungus HSDM12 was constructed using MEGA7 software, as Figure 3 shown. The similarity between the sequence of the endophytic fungus HSDM12 strain and Coniochaeta hoffmannii (OQ692842.1) reached 100%. The endophytic fungus HSDM12 was identified as Coniochaeta hoffmannii.
[0040] The ITS rDNA sequence of the endophytic fungus HSDM12 is as follows:
[0041] CTGCGGAGGGATCATTACAAGAAGCCGAAAGGCTACTTCAAACCATCGCGAACTCGTCCAAGTTGCTTCGGC
[0042] GGCGCGGCACCCCTTAACGGGGGCGCCGCAGCCCTGCCTCTCCGGAGGTTCGGGGCGCCCGCCGGAGGTACGAAACT
[0043] CTGTATTATAGTGGCATCTCTGAGTATAAAACAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATC
[0044] GATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACAT
[0045] TGCGCCCGGTAGTACTCTACCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCTGCTTGGTGTTGGGGCC
[0046] CTACGGCTGCCGTAGGCCCTGAAAGGAAGTGGCGGGCTCGCTACAACTCCGAGCGTAGTAATTCATTATCTCGCTAG
[0047] GGAGGTTGCGGCGTGCTCCTGCCGTTAAAGACCCATCTTTAACCAAGGTTGACCTCGGATCAGGTAGGAATACCCGC
[0048] TGAACTTAAGCATAT
[0049] Example 3: Isolation of Three Flavonoid Components from the Fermentation Broth of Endophytic Fungus HSDM12 in Cannabis
[0050] 1. Preparation of Test Solution
[0051] Take the activated endophytic fungus HSDM12, pick the mycelium under aseptic conditions and inoculate it into 50 mL of PDB medium. Incubate it on a shaker at 28 °C and 120 r / min for 3 d to prepare a seed solution of 1×10 7 CFU / mL; Transfer the seed solution to 3 L of sterilized PDB medium at an inoculation amount of 20% (v / v), and culture it on a shaker at 28 °C and 120 r / min for 14 d. Filter the fermentation broth, concentrate it under reduced pressure at 50 °C, extract the concentrated fermentation broth with ethyl acetate three times (3×100 mL), combine the extraction solutions, concentrate them to dryness at low temperature of 50 °C, and dissolve them in 1 mL of methanol to prepare a test solution for standby.
[0052] 2. Preparation of Industrial Cannabis Medicinal Material Solution
[0053] Accurately weigh 5 g of industrial cannabis leaves, crush them, add 95% ethanol according to a solid-liquid ratio of 1:50, extract them by ultrasonic wave (50 °C, 3×250 mL), filter, combine the extraction solutions, concentrate them under reduced pressure to 100 mL at 50 °C, and then extract them with ethyl acetate (3×100 mL) to obtain an extraction solution. Combine the ethyl acetate extraction solutions, concentrate them to dryness under reduced pressure, and dissolve them in 1 mL of chromatographic methanol for standby.
[0054] 3. Preparation of Reference Solution
[0055] Accurately weigh 0.5 mg of vitexin reference substance and place it in a 1 mL centrifuge tube. Add 1 mL of chromatographic methanol to dissolve it and prepare a reference solution for standby.
[0056] Accurately weigh 0.5 mg of kaempferol reference substance and place it in a 1 mL centrifuge tube. Add 1 mL of chromatographic methanol to dissolve it and prepare a reference solution for standby.
[0057] Accurately weigh 0.5 mg of luteolin reference substance and place it in a 1 mL centrifuge tube. Add 1 mL of chromatographic methanol to dissolve it and prepare a reference solution for standby.
[0058] Take 300 mL of PDB culture solution and concentrate it under reduced pressure at 50 °C. Extract the concentrated PDB culture solution with ethyl acetate three times (3×100 mL), combine the extraction solutions, concentrate them to dryness at low temperature of 50 °C, and dissolve them in 1 mL of methanol to prepare a blank control solution for standby.
[0059] 4. HPLC Analysis of the Fermentation Broth of Endophytic Fungus HSDM12
[0060] Chromatographic column: Venusil XBP-C 18 Column (4.6 mm × 250 mm, 5 μm, USA) Mobile phase ①: Acetonitrile - 0.1% glacial acetic acid (80:20); Mobile phase ②: Acetonitrile - 0.1% glacial acetic acid (75:25); Mobile phase ③: Methanol - water - glacial acetic acid (60:40:0.1); Flow rate: 1 mL·min -1 ; Column temperature: 25 °C; Detection wavelength: 220 nm; Injection volume: 10 μL.
[0061] 5. Isolation of three flavonoid components from the fermentation broth of endophytic fungus HSDM12
[0062] Take 10 L of the fermentation broth of endophytic fungus HSDM12, slowly pass it through a D101 macroporous resin column, and perform gradient elution with 30%, 50%, 70% and 90% ethanol. Collect each eluate, and recover the solvent to obtain each elution part of the D101 macroporous resin column.
[0063] Take the elution part of the 30% D101 macroporous resin column for polyamide column chromatography separation, and perform gradient elution with 30%, 50%, 70% and 90% ethanol. Collect the eluates (10 mL / bottle), and combine the components numbered 108 - 189 in the 50% ethanol eluate to obtain crude product A; Combine the components numbered 211 - 258 in the 70% ethanol eluate to obtain crude product B.
[0064] Perform silica gel column separation on crude product A, use petroleum ether - ethyl acetate (1:7) as the eluent for elution, collect the eluates (10 mL / bottle), combine the components numbered 41 - 92, and perform recrystallization multiple times to obtain compound A; Perform silica gel column separation on crude product B, use petroleum ether - ethyl acetate (4:1) as the eluent for elution, collect the eluates (10 mL / bottle), combine the components numbered 127 - 172, and perform recrystallization multiple times to obtain compound B.
[0065] Take the elution part of the 50% D101 macroporous resin column for polyamide column chromatography separation, and perform gradient elution with 30%, 50%, 70% and 90% ethanol. Collect the eluates (10 mL / bottle), and combine the components numbered 118 - 187 in the 50% ethanol eluate to obtain crude product C; Perform silica gel column separation on crude product C, use petroleum ether - ethyl acetate (7:1) as the eluent for elution, collect the eluates (10 mL / bottle), combine the components numbered 25 - 73, and perform recrystallization multiple times to obtain compound C.
[0066] 6. HPLC analysis results of the fermentation broth of endophytic fungus HSDM12
[0067] Use HPLC to analyze the fermentation broth of endophytic fungus HSDM12, and the results are shown inFigure 4 , Figure 5 and Figure 6 .
[0068] The HPLC chromatogram of luteolin in the ethyl acetate extraction fraction of HSDM12 is shown as Figure 4 follows ( Figure 4 in which A: the test sample of industrial hemp leaves; B: luteolin; C: the ethyl acetate extraction sample of HSDM12; D: the PDB blank control). It can be Figure 4 seen that in the ethyl acetate extraction fraction of the fermentation broth of the endophytic fungus HSDM12 of industrial hemp, there is a chromatographic peak with the same retention time as the luteolin reference substance, and there is no interference from the negative (blank PDB medium), indicating that luteolin may be present in the ethyl acetate extraction fraction.
[0069] The HPLC chromatogram of kaempferol in the ethyl acetate extraction fraction of HSDM12 is shown as Figure 5 follows ( Figure 5 in which A: the test sample of industrial hemp leaves; B: kaempferol; C: the ethyl acetate extraction sample of HSDM12; D: the PDB blank control). It can be Figure 5 seen that in the ethyl acetate extraction fraction of the fermentation broth of the endophytic fungus HSDM12 of industrial hemp, there is a chromatographic peak with the same retention time as the kaempferol reference substance, and there is no interference from the negative (blank PDB medium), indicating that kaempferol may be present in the ethyl acetate extraction fraction.
[0070] The HPLC chromatogram of vitexin in the n-butanol extraction fraction saturated with water of HSDM12 is shown as Figure 6 follows ( Figure 6 in which A: the test sample of industrial hemp leaves; B: vitexin; C: the n-butanol extraction sample saturated with water of HSDM12; D: the PDB blank control). It can be Figure 6 seen that in the n-butanol extraction fraction saturated with water of the fermentation broth of the endophytic fungus HDM12 of industrial hemp, there is a chromatographic peak with the same retention time as the vitexin reference substance, and there is no interference from the negative (blank PDB medium), indicating that vitexin is present in the n-butanol extraction fraction saturated with water.
[0071] 7. Separation results of three flavonoid components in the fermentation broth of endophytic fungus HSDM12
[0072] According to the HPLC analysis results of the HSDM12 fermentation broth, a separation route was designed for the three flavonoid compounds that may be contained in the HSDM12 fermentation broth, and three compounds were separated from the HSDM12 fermentation broth.
[0073] Compound A: yellow powder. Using vitexin as a reference, HPLC analysis was performed on Compound A, and the results are shown in Figure 7 ( Figure 7A: Compound A; B: Compound A + Vitexin reference substance; C: Vitexin reference substance).
[0074] To further confirm the structure of Compound A, Compound A was 1 analyzed by 1H-NMR as Figure 8 shown below. 1 1H NMR (400 MHz, DMSO) δ: 13.15 (s, 1H), 10.60 (m, 2H), 8.01 (d, J = 8.6 Hz, 2H), 7.17 - 6.33 (m, 3H), 6.25 (s, 1H), 4.99 (t, J = 5.2 Hz, 2H), 4.69–4.23 (m, 2H), 3.91–3.65 (m, 2H), 3.50 (s, 1H), 3.23 (s, 1H), 1.21 (s, 1H).
[0075] According to HPLC and 1 1H-NMR and comparison with the data in the literature, the physicochemical properties of Compound A and 1 the 1H-NMR results were completely consistent with those of vitexin. Therefore, Compound A was confirmed to be vitexin.
[0076] Compound B: Yellow crystalline powder. Using kaempferol as a reference, Compound B was analyzed by HPLC. The results are shown in Figure 9 ( Figure 9 A: Compound B; B: Compound B + kaempferol reference substance; C: kaempferol reference substance).
[0077] To further confirm the structure of Compound B, Compound B was 1 analyzed by 1H-NMR, 1 1H-NMR (500 MHz, Methanol-d4) δ: 7.88 (2H, d, J = 9.0 Hz, H-2′ / H-6′), 6.96 (2H, d, J = 9.0 Hz, H-3′ / H-5′), 6.48 (1H, d, J = 2.0 Hz, H-8), 6.24 (1H, d, J = 2.0 Hz, H-6), and the results are shown in Figure 10 the figure below.
[0078] According to HPLC and 1 1H-NMR and comparison with the data in the literature, the physicochemical properties of Compound B and 1 the 1H-NMR results were completely consistent with those of kaempferol. Therefore, Compound B was confirmed to be kaempferol.
[0079] Compound C: Yellow crystalline powder. Using luteolin as a reference, Compound C was analyzed by HPLC. The results are shown in Figure 11 ( Figure 11A: Compound C; B: Compound C + luteolin reference standard; C: luteolin reference standard).
[0080] To further confirm the structure of Compound C, Compound C was 1 analyzed by 1 1H-NMR. 1H-NMR (400 MHz, Methanol-d4) δ 7.43 - 7.34 (2H, m, H-2', 6'), 6.91 (1H, d, J = 8.9 Hz, H-5'), 6.55 (1H, s, H-3), 6.45 (1H, d, J = 2.1 Hz, H-8), 6.21 (1H, d, J = 2.1 Hz, H-6). The results are as Figure 12 shown.
[0081] According to HPLC and 1 1H-NMR and comparison with the data in the literature, the physicochemical properties of Compound C and 1 the 1H-NMR results are completely consistent with those of luteolin. Therefore, Compound C was confirmed to be luteolin.
[0082] Example 4: Antibacterial Activity Analysis of Endophytic Fungus HSDM12
[0083] Activation of endophytic fungus HSDM12: Take endophytic fungus HSDM12 and inoculate it onto the surface of a test plate containing PDA medium under sterile conditions. Incubate at 28 °C for 3 d under constant temperature for standby.
[0084] Preparation of the fermentation broth of endophytic fungus HSDM12: Take the activated endophytic fungus HSDM12, pick the mycelium under sterile conditions and inoculate it into 50 mL of PDB medium. Incubate on a shaker at 28 °C and 120 r / min for 3 d to prepare a seed solution of 1×10 7 CFU / mL; Transfer the seed solution to 3 L of sterilized PDB medium at an inoculation amount of 20% (v / v), and incubate on a shaker at 28 °C and 120 r / min for 14 d. Filter the fermentation broth.
[0085] Preparation of the test solution: Take the fermentation broth of endophytic fungus HSDM12 and concentrate it under reduced pressure to 50 mL at 50 °C, then add 50 mL of methanol and extract it ultrasonically 3 times to obtain an extract. Concentrate it to dryness under reduced pressure, dissolve it in 10 mL of methanol, and use it as the test solution for standby. Take appropriate amounts of streptomycin and nystatin powders, dissolve them in appropriate amounts of methanol respectively to prepare 200 μg / mL positive control solutions for standby.
[0086] Preparation of the plate containing the test strains:
[0087] Take the activated test bacteria: Staphylococcus aureus, Bacillus pumilus, Bacillus subtilis, Listeria monocytogenes, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, inoculate them on the slant of NA test tubes, and culture at 37°C for 1 day; take the activated test fungus Candida albicans, inoculate it on the slant of PDA test tubes, and culture at 28°C for 3 days for standby. The above test strains are purchased from the Heilongjiang Institute of Microbiology.
[0088] Respectively take the above-activated test strains, add an appropriate amount of sterile water, and shake to dilute each strain into a bacterial suspension of 1×10 7 CFU / mL, pour it into the corresponding medium, and sub-pack it into sterile plates with Oxford cups. After it solidifies, take out the Oxford cups for standby.
[0089] Analysis of antibacterial activity:
[0090] Precisely add 150 μL of the test solution, positive control solution, and negative control solution to two wells of the above-prepared bacteria-containing plates. After incubating the plates containing bacteria at a constant temperature (37°C, 1 day), measure the diameter of the inhibition zone (n = 3); after incubating the plates containing fungi at a constant temperature (28°C, 3 days), measure the diameter of the inhibition zone (n = 3).
[0091] The antibacterial activity results of the fermentation broth of the endophytic fungus HSDM12 of industrial hemp are shown in Table 1. It can be seen from the results of Table 1 that the endophytic fungus HSDM12 of industrial hemp has a certain inhibitory effect on Bacillus subtilis and Acinetobacter baumannii, and has a better antibacterial effect on Bacillus subtilis. Therefore, it has good antibacterial activity.
[0092] Table 1
[0093]
[0094] In Table 1, A is *Staphylococcus aureus*; B is *Listeria monocytogenes*; C is *Bacillus subtilis*; D is *Enterococcus faecalis*; E is *Enterococcus faecium*; F is *Bacillus pumilus*; G is *Escherichia coli*; H is *Pseudomonas aeruginosa*; I is *Klebsiella pneumoniae*; J is *Acinetobacter baumannii*; K is *Candida albicans*; Str is streptomycin; Nys is nystatin; - indicates no antibacterial activity.
Claims
1. An endophytic fungus HSDM12 of Cannabis that simultaneously produces three flavonoid components, characterized in that, The cannabis endophytic fungus HSDM12 is Chaetomium hoffmannii( Coniochaeta hoffmannii ) HSDM12, which has been deposited in the China Center for Type Culture Collection. The deposit address is Wuhan University, Wuhan. The deposit date is May 16, 2024, and the deposit number is CCTCC NO: M2024969.
2. Use of the Cannabis endophytic fungus HSDM12 as claimed in claim 1 in the fermentation production of three flavonoid compounds, wherein the three flavonoid compounds are vitexin, kaempferol and luteolin.
3. Use of the endophytic fungus HSDM12 of cannabis as claimed in claim 1 in inhibiting bacteria; the bacteria are Bacillus subtilis ( Bacillus subtilis ) and Acinetobacter baumannii ( Acinetobacter baumannii ).
Citation Information
Patent Citations
Industrial hemp endophytic fungus HSDMZ07 for producing oleanolic acid and application of industrial hemp endophytic fungus HSDMZ07
CN118956606A