A cellulase mutant

By modifying cellulase through protein engineering and introducing specific amino acid mutations, the specific activity of cellulase was improved, solving the problem of insufficient specific activity of cellulase. This makes it suitable for the textile industry and reduces production costs.

CN118813592BActive Publication Date: 2026-01-23QINGDAO VLAND BIOTECH GRP CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411164645.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-08-26
Publication Date
2026-01-23
Estimated Expiration
2042-08-26

AI Technical Summary

Technical Problem

The specific activity of existing cellulases is insufficient, which limits their widespread application in industrial production, especially in the textile field where their application is costly and inefficient.

Method used

By modifying cellulase through protein engineering and introducing specific amino acid mutations, such as S44N, S84D, S109V, I123L, A178S, F183V, L194I, T225P, and S234G, its specific activity at 50℃ can be improved.

Benefits of technology

It significantly improves the specific activity of cellulase, reduces the amount of cellulase required, saves labor and energy, lowers production costs, and is suitable for the textile industry.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The present application relates to the technical field of genetic engineering and protein modification, and particularly relates to a high specific activity cellulase mutant and application thereof. The mutant provided by the present application comprises substitution of amino acids at at least one position selected from the group consisting of 44, 84, 109, 123, 178, 183, 194, 225 and 234. The specific activity of the mutant at 50 DEG C is generally increased by 7.1% to 38%; wherein the specific activity of the S44N single-point mutant, the I123L single-point mutant and the L194I single-point mutant is respectively increased by 26.8%, 25.7% and 38%, thereby facilitating the wide application of the cellulase in the textile field.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and protein modification technology, specifically to a cellulase mutant and its applications. Background Technology

[0002] Cellulose, polymerized from glucose via β-1,4-glycosidic bonds, is the most abundant renewable biomass on Earth. However, current utilization of cellulose primarily relies on direct combustion, resulting in low utilization rates and air pollution. Therefore, the effective utilization of cellulose has become a core concern. Cellulase is a key factor in the effective utilization of cellulose. Cellulase is a collective term for a complex enzyme system capable of degrading cellulose. Currently, the main recognized functional enzymes are endo-β-1,4-glucanases (EGs, EC 3.2.1.4), exo-β-1,4-glucanases (CBHs, EC 3.2.1.91), and β-1,4-glucosidases (BGs, EC 3.2.1.21). Currently, cellulase is mainly used in the food, animal husbandry, pharmaceutical, textile, and biomass energy industries.

[0003] Nature provides a wide range of sources for cellulase, which is abundant in bacteria, fungi, and actinomycetes. Studies have shown that bacteria have a relatively weak ability to degrade cellulose because they can only secrete endoglucanases, most of which lack the ability to degrade cellulose crystals. Furthermore, bacterial cellulase cannot be secreted extracellularly, making extraction and purification difficult and costly, thus making them unsuitable for industrial production. Fungi are currently the most potent known cellulase-producing microorganisms, primarily because they can secrete extracellular cellulase. During their growth, fungal hyphae can penetrate the cuticle of plants, disrupting part of the lignocellulose structure and exposing cellulose. The secreted extracellular cellulase can directly bind to cellulose for enzymatic hydrolysis, thereby increasing degradation efficiency. Actinomycetes have a much lower ability to degrade cellulose than fungi and bacteria because their metabolism is very slow, resulting in extremely low cellulase production, fewer types of secreted cellulase, and weaker cellulase activity. Therefore, they are rarely used in industrial production.

[0004] Cellulase is essentially a protein, and its activity is affected by factors such as temperature, pH, enzyme concentration, substrate concentration, and ionic strength. Different types of cellulase have different optimal reaction conditions. Cellulase has advantages such as mild reaction conditions, high specificity, no production of other impurities, safety, and no pollution, making it a research hotspot in the industrialization of cellulose.

[0005] With the development of molecular biology techniques, an increasing number of researchers are using protein engineering to modify enzyme molecules to improve their enzymatic properties. For example, Liu Danni used error-prone PCR to modify the nucleotide sequence of the multifunctional cellulase Nccle, thereby obtaining a high specific activity multifunctional cellulase mutant, Nccle-mut, containing 13 mutation sites. Yao Bin et al. provided a high-catalytic-efficiency cellulase mutant by replacing the N-terminus of a high-catalytic-efficiency cellulase with the N-terminus of a low-catalytic-efficiency cellulase. Under these modification conditions, the specific activity of the mutant was 1.8–6.7 times higher than that of the wild type; the catalytic efficiency was 1–4.7 times higher than that of the wild type; and the optimal temperature and pH of the enzymatic reaction remained unchanged. Wu Bin et al. used single-point mutagenesis technology, based on homology modeling and molecular docking methods, to optimize the molecular structure of endonucleases by selecting key amino acids in the enzyme's active architecture, thereby improving enzyme activity and obtaining a class of endonuclease mutants with significantly improved continuous enzyme activity.

[0006] Extensive research has been conducted to modify the enzymatic properties of cellulases to suit their applications in various scenarios. However, specific activity remains a key indicator limiting cellulase applications. Higher specific activity of cellulase leads to lower production costs and lower enzyme prices, which in turn promotes its widespread adoption. Summary of the Invention

[0007] The purpose of this invention is to provide a high specific activity cellulase mutant and its applications. This invention obtains a mutant protein through protein engineering modification of cellulase. Compared with the wild type, the specific activity of the mutant is significantly improved, and it can be widely used in the textile processing field.

[0008] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0009] The present invention relates to a cellulase mutant comprising an amino acid sequence having at least 90% identity with SEQ ID NO:1, and comprising an amino acid substitution at at least one position selected from the group consisting of: 44, 84, 109, 123, 178, 183, 194, 225, 234 compared with SEQ ID NO:1.

[0010] In some embodiments of the invention, the amino acid sequence of the mutant has at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identity with SEQ ID NO:1.

[0011] In some more specific embodiments, the amino acid sequence of the mutant has at least 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identity with SEQ ID NO:1.

[0012] In some embodiments of the present invention, the mutant comprises a substitution of at least one amino acid from the following group: S44N, S84D, S109V, I123L, A178S, F183V, L194I, T225P, S234G.

[0013] In some embodiments of the present invention, the mutant comprises the following substitutions or combinations thereof:

[0014] S44N;

[0015] S44N / S84D;

[0016] S44N / S109V;

[0017] S44N / S111N;

[0018] S44N / I123L;

[0019] S44N / Q147R;

[0020] S44N / A178S;

[0021] S44N / L194I;

[0022] S44N / T225P;

[0023] S44N / S84D / S111N;

[0024] S44N / S109V / S111N;

[0025] S44N / S109V / I123L;

[0026] S44N / S109V / Q147R;

[0027] S44N / S111N / I123L;

[0028] S44N / S111N / L194I;

[0029] S44N / I123L / Q147R;

[0030] S44N / I123L / A178S;

[0031] S44N / I123L / L194I;

[0032] S44N / I123L / S234G;

[0033] S44N / Q147R / A178S;

[0034] S44N / Q147R / F183V;

[0035] S44N / A178S / L194I;

[0036] S44N / Q147R / T225P;

[0037] S44N / A178S / S234G;

[0038] S44N / S111N / I123L / Q147R;

[0039] S44N / S111N / I123L / L194I;

[0040] S44N / I123L / Q147R / F183V;

[0041] S44N / I123L / Q147R / L194I;

[0042] S44N / I123L / Q147R / F183V;

[0043] S44N / I123L / Q147R / L194I;

[0044] S44N / Q147R / F183V / T225P;

[0045] S44N / Q147R / F183V / S234G;

[0046] S44N / S84D / I123L / Q147R / F183V;

[0047] S44N / S84D / I123L / Q147R / L194I;

[0048] S44N / S111N / I123L / Q147R / L194I;

[0049] S44N / I123L / Q147R / A178S / L194I;

[0050] S44N / I123L / F183V / L194I / T225P;

[0051] S44N / I123L / Q147R / F183V / L194I / S234G;

[0052] S84D;

[0053] S84D / S109V;

[0054] S84D / S111N;

[0055] S84D / I123L;

[0056] S84D / Q147R;

[0057] S84D / F183V;

[0058] S84D / S109V / S111N;

[0059] S84D / S109V / I123L;

[0060] S84D / S111N / I123L;

[0061] S84D / I123L / F183V;

[0062] S84D / I123L / T225P;

[0063] S84D / I123L / S234G;

[0064] S109V;

[0065] S109V / S111N;

[0066] S109V / Q147R;

[0067] S109V / A178S;

[0068] S109V / L194I;

[0069] S109V / I123L / L194I;

[0070] S109V / I123L / T225P;

[0071] S109V / I123L / S234G;

[0072] S111N / Q147R / L194I;

[0073] S111N / I123L / Q147R / L194I;

[0074] S111N / I123L / Q147R / L194I / S234G;

[0075] I123L;

[0076] I123L / Q147R;

[0077] I123L / A178S;

[0078] I123L / L194I;

[0079] I123L / F183V;

[0080] I123L / Q147R / A178S;

[0081] I123L / Q147R / L194I;

[0082] I123L / Q147R / T225P;

[0083] I123L / A178S / L194I;

[0084] I123L / Q147R / A178S / L194I;

[0085] Q147R / A178S;

[0086] Q147R / L194I;

[0087] Q147R / A178S / L194I;

[0088] A178S;

[0089] A178S / F183V;

[0090] A178S / L194I;

[0091] A178S / T225P;

[0092] A178S / S234G;

[0093] A178S / L194I / S234G;

[0094] Q147R;

[0095] Q147R / L194I;

[0096] A178S;

[0097] A178S / L194I;

[0098] A178S / S234G;

[0099] F183V;

[0100] F183V / T225P;

[0101] F183V / S234G;

[0102] F183V / L194I / S234G;

[0103] L194I;

[0104] S111N / L194I;

[0105] L194I / S234G;

[0106] T225P;

[0107] S234G.

[0108] The present invention also relates to DNA molecules encoding the above-mentioned cellulase mutants.

[0109] The present invention also relates to recombinant expression vectors comprising the above-described DNA molecules.

[0110] The present invention also relates to a host cell comprising the above-described recombinant expression vector.

[0111] In some embodiments of the present invention, the host cell is Trichoderma reesei.

[0112] The recombinant expression vector was transformed into Trichoderma reesei host cells for recombinant expression, and the resulting cellulase mutant had higher specific activity.

[0113] The present invention also relates to the application of the above-mentioned cellulase mutant in the textile field.

[0114] The cellulase mutants provided by this invention exhibit higher specific activity at 50°C. Compared with the wild type, cellulase mutants containing single-point mutations of S44N, S84D, S109V, I123L, A178S, F183V, L194I, T225P, and S234G generally showed a 7.1%-38% increase in specific activity at 50°C. Among them, the specific activities of the S44N, I123L, and L194I single-point mutants were increased by 26.8%, 25.7%, and 38%, respectively, achieving unexpected technical effects.

[0115] Furthermore, the present invention provides two-point mutants: S44N / S111N, S111N / L194I, I123L / F183V, I123L / Q147R, F183V / S234G, and L194I / S234G; two-point mutants: S44N / S111N / I123L, S44N / S111N / L194I, S44N / I123L / L194I, S111N / Q147R / L194I, and I123L / Q147R / T225P; and three-point mutants: S44N / S111N / I123L / L194I, S44N / I123L / Q147R / The four-point mutants L194I, S44N / Q147R / F183V / T225P; the five-point mutants S44N / S111N / I123L / Q147R / L194I, S111N / I123L / Q147R / D179S / L194I, S44N / I123L / F183V / L194I / T225P; and the six-point mutant S44N / I123L / Q147R / F183V / L194I / S234G, under 50℃ conditions, generally showed a 10%-59% increase in specific activity compared to wild-type cellulase NT45, achieving unexpected technical results.

[0116] In summary, the cellulase mutant described in this invention is more suitable for application in the textile industry than the wild type, and can greatly reduce the amount of cellulase used, save labor and energy, and reduce production costs. Detailed Implementation

[0117] This invention utilizes conventional techniques and methods used in the fields of genetic engineering and molecular biology, such as those described in *MOLECULAR CLONING: ALABORATORY MANUAL, 3rd Ed.* (Sambrook, 2001) and *CURRENTPROTOCOLS IN MOLECULAR BIOLOGY* (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, this invention is not limited to any specific methods, experimental protocols, and reagents described.

[0118] The present invention will now be described in detail with reference to specific embodiments.

[0119] Example 1: Screening of cellulase mutants

[0120] To improve the specific activity of wild-type cellulase NT45 (amino acid sequence SEQ ID NO:1, encoding nucleotide sequence SEQ ID NO:2), the applicant screened for a large number of mutations in amino acids near the active site of the enzyme using directed evolution technology.

[0121] The PCR primers NtE-F1 and NtE-R1 were designed as follows:

[0122] NtE-F1: GGC GAATTC ATGCGCTCCT CCACCATTC (The underlined part is the EcoRI restriction enzyme recognition site);

[0123] NtE-R1: ATA GCGGCCGC TTAGGCGCACTGGTGGTAGTAGTC (The underlined part is the NotI restriction enzyme recognition site).

[0124] Using the wild-type cellulase NT45 gene (SEQ ID NO:2) as a template, PCR amplification was performed using the above primers with the GeneMorph II random mutagenesis PCR kit (Stratagene). The PCR product was recovered from the gel, digested with EcoRI and NotI, and then ligated into the pET21a vector digested with the same enzymes. The transformed cells were then transformed into Escherichia coli BL21(DE3), plated on LB+Amp plates, and incubated upside down at 37°C. After the transformants appeared, they were picked one by one into a 96-well plate with a toothpick. 150 μL of LB+Amp medium containing 0.1 mM IPTG was added to each well. The cells were incubated at 37°C and 220 rpm for about 6 h. After centrifugation and discarding the supernatant, the cells were resuspended in buffer and repeatedly freeze-thawed to break the cell wall, obtaining E. coli cell lysate containing cellulase.

[0125] Take 50 μL of lysis buffer into two new 96-well plates and measure their cellulase activity and protein content at 50 °C. Calculate the specific activity of different mutants.

[0126] Experimental results showed that some mutations had no effect on the specific activity of cellulase at 50℃, while others even worsened its specific activity. Still others, although increasing the specific activity of cellulase, significantly altered its enzymatic properties, which did not meet the requirements. Ultimately, the applicant obtained mutation sites that significantly increased specific activity at 50℃, namely: S44N, S84D, S109V, I123L, A178S, F183V, L194I, T225P, and S234G.

[0127] Based on cellulase NT45, this invention provides cellulase mutants containing single mutation sites of S44N, S84D, S109V, I123L, A178S, F183V, L194I, T225P, and S234G, respectively.

[0128] The present invention also provides cellulase mutants containing at least 2, at least 3, at least 4, at least 5, or at least 6 mutation sites selected from S44N, S84D, S109V, I123L, A178S, F183V, L194I, T225P, and S234G. Examples include: two-point mutants such as S44N / S111N, S111N / L194I, I123L / F183V, I123L / Q147R, F183V / S234G, and L194I / S234G; three-point mutants such as S44N / S111N / I123L, S44N / S111N / L194I, S44N / I123L / L194I, S111N / Q147R / L194I, and I123L / Q147R / T225P; and S44N / S111N / I123L / L194V / Q147R / T225P. Four-point mutants such as 4I, S44N / I123L / Q147R / L194I, and S44N / Q147R / F183V / T225P; five-point mutants such as S44N / S111N / I123L / Q147R / L194I, S111N / I123L / Q147R / D179S / L194I, and S44N / I123L / F183V / L194I / T225P; and six-point mutants such as S44N / I123L / Q147R / F183V / L194I / S234G.

[0129] Example 2: Expression of cellulase mutant in Trichoderma reesei

[0130] Based on the codon preference of Trichoderma, the gene sequence of cellulase NT45 (SEQ ID NO:2) and the gene sequence of the mutant were optimized and synthesized, and two restriction sites, KpnI and MluI, were added to the 5' and 3' ends of the synthesized sequence, respectively.

[0131] 2.1 Construction of expression vector

[0132] The synthesized plasmid was digested with restriction endonucleases KpnI (Fermentas) and XbaI, respectively; simultaneously, plasmid pTGII was digested with restriction endonucleases KpnI (Fermentas) and XbaI. The digestion products were purified using a gel purification kit, and the two digestion products were ligated using T4 DNA ligase (Fermentas). The ligation products were transformed into Trans5α Escherichia coli (Transgen), and selection was performed using ampicillin. To ensure accuracy, several clones were sequenced (Invitrogen). After successful sequencing, the recombinant plasmid containing the cellulase gene was obtained.

[0133] Plasmids were purified from correctly sequenced E. coli clones using a plasmid medium-quantity preparation kit (Axygen).

[0134] 2.2 Protoplast Preparation

[0135] Spore suspensions of *Trichoderma reesei* U4, a host fungus with a cellulase gene deficiency, were inoculated onto PDA plates and cultured at 30°C for 6 days. After abundant sporulation, colonies of approximately 1 cm × 1 cm were excised and placed in liquid medium containing 120 mL of YEG+U (0.5% yeast extract, 1% glucose, and 0.1% uridine) and cultured at 30°C with shaking at 220 rpm for 14–16 h. Mycelia were collected by filtration through sterile gauze and washed once with sterile water. The mycelia were then placed in Erlenmeyer flasks containing 20 mL of 10 mg / mL lyase solution (Sigma L1412) and incubated at 30°C with shaking at 90 rpm for 1–2 h. The progress of protoplast transformation was observed under a microscope.

[0136] Add 20 mL of pre-chilled 1.2 M sorbitol (1.2 M sorbitol, 50 mM Tris-Cl, 50 mM CaCl2) to the Erlenmeyer flask, gently mix, filter through sterile Miracloth filter cloth, collect the filtrate, centrifuge at 3000 rpm, 4°C for 10 min; discard the supernatant, add 5 mL of pre-chilled 1.2 M sorbitol solution to resuspend the bacterial cells, centrifuge at 3000 rpm, 4°C for 10 min; discard the supernatant, add an appropriate amount of pre-chilled 1.2 M sorbitol to resuspend and dispense (200 μL / tube, protoplast concentration 10). 8 (units / mL).

[0137] 2.3 Expression vector transformation and strain validation

[0138] All the following operations were performed on ice. 10 μg of recombinant plasmid was added to a sterile 7 mL centrifuge tube containing 200 μL of protoplast solution. Then, 50 μL of 25% PEG (25% PEG, 50 mM Tris-Cl, 50 mM CaCl2) was added, the bottom of the tube was gently tapped to mix, and the tube was incubated on ice for 20 min. 2 mL of 25% PEG was added, mixed, and incubated at room temperature for 5 min. 4 mL of PEG solution was then added. 1.2M sorbitol was gently mixed and poured into the melted upper medium (0.1% MgSO4, 1% KH2PO4, 0.6% (NH4)2SO4, 1% glucose, 18.3% sorbitol, 0.35% agarose) and kept at 55°C. This mixture was then spread onto the prepared lower medium (2% glucose, 0.5% (NH4)2SO4, 1.5% KH2PO4, 0.06% MgSO4, 0.06% CaCl2, 1.5% agar) and incubated at 30°C for 5–7 days until transformants appeared. Transformants were then transferred to the lower medium for re-screening and incubated at 30°C for 2 days. Strains with smoother colony edges were considered positive transformants.

[0139] Take an appropriate amount of mycelium and place it in a 2 mL centrifuge tube. Add 100 mg of sterile quartz sand and 400 μL of extraction buffer (100 mM Tris-HCl, 100 mM EDTA, 250 mM NaCl, 1% SDS). Vigorously shake with a bead mixer for 2 min. After incubating in a 65 °C water bath for 20 min, add 200 μL of 10 M NH4AC and incubate on ice for 10 min. Centrifuge at 13000 rpm for 10 min. Take the supernatant, add 2 volumes of anhydrous ethanol, and place at -20 °C for 30 min. Centrifuge at 13000 rpm for 10 min and discard the supernatant. Wash twice with 70% ethanol. Air dry, dissolve in water, and store at -20 °C.

[0140] Using the extracted genomic DNA from the transformants as a template, the target gene was amplified by PCR using primers M6-F and M6-R for verification.

[0141] M6-F: ATGCGCTCCT CCACCATTC;

[0142] M6-R: TTAGGCGCACTGGTGGTAGTAGTC.

[0143] PCR amplification conditions were: 94℃ for 4 min; 94℃ for 40 s; 58℃ for 40 s, 72℃ for 1 min, 30 cycles; 72℃ for 7 min, 16℃; PCR amplification products were recovered using a gel extraction kit and sequenced for analysis.

[0144] Following the above method, the applicant constructed recombinant cellulase-expressing Trichoderma reesei engineered strains and the above mutants, respectively.

[0145] Example 3 Fermentation Verification

[0146] The engineered Trichoderma reesei strains constructed above were inoculated onto PDA solid plates and cultured at 30℃ for 6 days. After spore abundance, two 1 cm diameter mycelial blocks were inoculated into 250 mL Erlenmeyer flasks containing 50 mL of fermentation medium (1.5% glucose, 1.7% lactose, 2.5% corn steep liquor, 0.44% (NH4)2SO4, 0.09% MgSO4, 2% KH2PO4, 0.04% CaCl2, 0.018% Tween-80, 0.018% trace elements). The flasks were cultured at 30℃ for 48 hours, followed by 25℃ for 48 hours. The fermentation broth was centrifuged to obtain fermentation supernatants containing cellulase NT45 and the aforementioned mutant, respectively.

[0147] 3.1 Enzyme activity assay

[0148] (1) Definition of cellulase activity

[0149] Under conditions of 50°C and pH 6.0, the amount of enzyme required to release 1 μmol of reducing sugar per minute from a 5 mg / ml sodium carboxymethyl cellulose solution is defined as one enzyme activity unit (U), where the reducing sugar is in equal amounts to glucose.

[0150] (2) Cellulase assay method

[0151] Add 0.5 mL of CMC substrate to each of three test tubes and preheat them together with the enzyme solution at 50°C for 5 min. Add 0.5 mL of the test solution to each of the first and second test tubes and start timing; react in a 50°C water bath for 15 min. After the reaction is complete, add 1.5 mL of DNS reagent to each of the three test tubes, and add 0.5 mL of the enzyme solution to the third test tube. Remove and shake the three test tubes well, and react in a boiling water bath for 5 min. Quickly cool to room temperature and dilute to 5.0 mL with water. Using the solution in the third test tube as a control, measure the absorbance of the solutions in the first and second test tubes at a wavelength of 540 nm. The absorbance should ideally be between 0.25 and 0.35. The absolute value of the difference between the absorbance of the enzyme solution and the absorbance of the control enzyme solution should not exceed 0.015.

[0152] Enzyme activity X = (equivalent amount of glucose / 180 / 15 / 0.5) × n.

[0153] Where: X—enzyme activity unit, IU / g(mL);

[0154] 180 — Glucose converted from micrograms to micromoles;

[0155] 15 — Reaction time between the test solution and the substrate;

[0156] 0.5 — The amount of the enzyme solution to be tested added to the reaction;

[0157] n – dilution factor.

[0158] (3) Measurement results

[0159] Enzyme activity was detected using the above method. The results showed that the enzyme activity of the fermentation supernatant of the recombinant wild-type cellulase NT45 and its mutant Trichoderma reesei engineered bacteria obtained above was 80-150 U / mL at 50℃.

[0160] 3.2 Protein content determination

[0161] (1) Measurement method:

[0162] The Coomassie Brilliant Blue (Bradford) binding method for protein determination is a combined colorimetric and dye-based method. Coomassie Brilliant Blue G-250 is brownish-red in acidic solution, turning blue upon binding with protein. Within a certain protein concentration range, it obeys Beer's Law and can be measured colorimetrically at 595 nm. It exhibits significant absorption within 3–5 minutes and remains stable for at least 1 hour. In the range of 10–1000 μg / mL, the absorbance is directly proportional to the protein concentration.

[0163] The enzyme solution and Coomassie Brilliant Blue solution were mixed at a volume ratio of 1:5, allowed to stand for 10 minutes, and the protein content was determined by the Coomassie Brilliant Blue (Bradford) binding method.

[0164] (2) Protein content determination results

[0165] The cellulase protein content in the fermentation supernatant of the above-mentioned engineered Trichoderma reesei strains was determined according to the above method. The results showed that the protein content in the fermentation supernatant of the recombinant Trichoderma reesei strains expressing wild-type cellulase NT45 and its mutant was 0.04-0.1 mg / mL at 50℃.

[0166] 3.3 Calculation of specific vitality

[0167] Specific activity refers to the number of enzyme activity units per unit weight of protein, usually expressed as U / mg protein. Generally speaking, the higher the specific activity of an enzyme, the purer the enzyme.

[0168] Specific activity calculation formula: Specific activity (U / mg) = Enzyme activity (U / mL) / Protein content (mg / mL).

[0169] The specific activity of the fermentation supernatant of the recombinant cellulase NT45 and its mutant Trichoderma reesei engineered bacteria constructed in Example 3 of this invention at 50°C is shown in Table 1.

[0170] Table 1. Specific activity of cellulase NT45 and its mutants at 50℃

[0171] Cellulase Specific activity (U / mg) at 50℃ Cellulase NT45 280 S44N single-point mutant 355 S84D single-point mutant 314 S109V single-point mutant 300 I123L single-point mutant 387 A178S single-point mutant 333 F183V single-point mutant 304 L194I single-point mutant 352 T225P single-point mutant 320 S234G single-point mutant 330

[0172] As can be seen from the data in Table 1, compared with wild-type cellulase NT45, the specific activity of the single-point mutants provided by this invention is generally increased by 7.1%-38% at 50℃, indicating that the specific activity of the single-point mutants provided by this invention is significantly improved at low temperature conditions of 50℃. Among them, the specific activities of the S44N single-point mutant, I123L single-point mutant, and L194I single-point mutant are increased by 26.8%, 25.7%, and 38%, respectively, achieving unexpected technical effects.

[0173] Furthermore, the present invention provides two-point mutants: S44N / S111N, S111N / L194I, I123L / F183V, I123L / Q147R, F183V / S234G, and L194I / S234G; two-point mutants: S44N / S111N / I123L, S44N / S111N / L194I, S44N / I123L / L194I, S111N / Q147R / L194I, and I123L / Q147R / T225P; and three-point mutants: S44N / S111N / I123L / L194I, S44N / I123L / Q147R / The four-point mutants L194I, S44N / Q147R / F183V / T225P; the five-point mutants S44N / S111N / I123L / Q147R / L194I, S111N / I123L / Q147R / D179S / L194I, S44N / I123L / F183V / L194I / T225P; and the six-point mutant S44N / I123L / Q147R / F183V / L194I / S234G, under 50℃ conditions, generally showed a 10%-59% increase in specific activity compared to wild-type cellulase NT45, achieving unexpected technical results.

[0174] Example 4: Application of cellulase mutant in one-bath process for depilation and dyeing of knitted and woven fabrics

[0175] The application temperature is 35-55℃;

[0176] Processing time is 30-150 minutes;

[0177] The pH range is 4.0-8.5;

[0178] The above process conditions are particularly suitable for dyeing in the same bath; the applicable bath ratio range is 1:5-1:30, and the equipment types used are overflow dyeing machines, roll dyeing machines, washing machines, etc. The amount of cellulase mutant is 240-800 U / L.

[0179] The cellulase mutant provided by this invention removes hair cleanly with minimal loss of fabric strength, and can achieve dyeing and hair removal processes in one bath.

[0180] Compared with wild-type cellulase NT45, the amount of cellulase mutant required to achieve the same treatment effect is reduced by 31-77%, which significantly reduces the enzyme cost in the processing process and is conducive to further reducing production costs.

Claims

1. A cellulase mutant, characterized in that, The mutant is a cellulase with the amino acid sequence SEQ ID NO:1 in which the 178th amino acid is changed from Ala to Ser.

2. A DNA molecule encoding the cellulase mutant of claim 1.

3. A recombinant expression vector, characterized in that, The recombinant expression vector carries the DNA molecule described in claim 2.

4. A host cell, characterized in that, The host cell carries the recombinant expression vector as described in claim 3.

5. The host cell as described in claim 4, characterized in that, The host cell is *Trichoderma reesei* ( Trichoderma reesei ).

Citation Information

Patent Citations

  • High-efficiency and stable cellulase mutant

    CN110982807A

  • High-specific-activity cellulase mutant and application thereof

    CN112795555A