Use of nitrilase mutants for hydrolysis of canola meal glucosinolate-derived nitrile compounds

By performing site-directed mutagenesis on the nitrile hydrolase PgNIT2, the resulting nitrile hydrolase mutant PgNIT2-A190I significantly improved the hydrolysis capacity of 3-butenonitrile and 4-pentenonitrile in rapeseed meal, solving the problem of low efficiency of nitrile hydrolase in existing technologies and achieving a highly efficient detoxification effect on rapeseed meal.

CN118813594BActive Publication Date: 2026-03-27GUANGXI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-08-14
Publication Date
2026-03-27

AI Technical Summary

Technical Problem

The lack of efficient nitrile hydrolases in existing technologies to hydrolyze glucosinolate-derived nitrile compounds in rapeseed meal leads to the inability to effectively remove anti-nutritional substances from animal feed.

Method used

The nitrile hydrolase PgNIT2 of *Paraburkholderia graminis* C4D1M was mutated at position 190 by alanine to isoleucine to obtain the nitrile hydrolase mutant PgNIT2-A190I. Recombinant plasmids and genetically engineered bacteria were then constructed to improve its hydrolytic ability for 3-butenonitrile and 4-pentenonitrile.

Benefits of technology

The nitrile hydrolase mutant PgNIT2-A190I exhibits significantly enhanced enzyme activity against 3-butenonitrile and 4-pentenonitrile at pH 7.0 and 45℃, demonstrating superior hydrolytic ability compared to the original enzyme. Furthermore, it maintains high efficiency over a wide pH and temperature range, making it suitable for detoxification treatment of rapeseed meal.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The application discloses a nitrilase mutant PgNIT2-A190I, which is obtained by point mutation of alanine at the 190th position of nitrilase PgNIT2 of Paraburkholderia graminis C4D1M into isoleucine. Accordingly, the inventors also design a recombinant plasmid of a nitrilase mutant PgNIT2-A190I coding gene, and construct a corresponding recombinant genetically engineered bacterium. Researches show that, with 3-butenenitrile and 4-pentenenitrile as substrates, the enzyme activity of the nitrilase and the mutant PgNIT2-A190I of the application is 5.94 U / mg and 6.66 U / mg, 9.95 U / mg and 11.90 U / mg at pH 7.0 and 45 DEG C respectively, and the nitrilase mutant of the application is significantly improved. Under various substrate concentration conditions, the hydrolysis capacity of the mutant PgNIT2-A190I of the application to 3-butenenitrile and 4-pentenenitrile is also higher than that of the nitrilase PgNIT2. Moreover, the mutant xylanase has good pH and temperature tolerance, and has production application potential in efficient hydrolysis of rapeseed meal glucosinolate derived nitrile compounds.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of nitrilase, and particularly relates to application of a nitrilase mutant in hydrolysis of glucosinolate-derived nitrile compounds in rapeseed meal. BACKGROUND

[0002] Rape is a major oil crop in China. A large amount of agricultural and sideline products, rapeseed meal, is produced after oil extraction from rapeseed. Rapeseed meal is a kind of by-product protein resource, and the amino acid composition is relatively balanced, which is a good raw material for unconventional protein feed. Rapeseed meal contains a kind of anti-nutritional substance, glucosinolate, which is referred to as glucosinolate. Glucosinolate itself is non-toxic, but when it is ingested by animals along with feed, it will be degraded to form 3-butenenitrile and 4-pentenenitrile and other nitrile compounds, which are harmful to the growth and development of animals. The biological method for eliminating anti-nutritional substances is environmentally friendly, scientific and efficient.

[0003] Nitrilase (EC 3.5.5.1) can hydrolyze toxic nitrile compounds into non-toxic carboxylic acid and ammonia, and is a green catalyst for detoxification of unconventional protein feed. Applying nitrilase to feed enzyme preparation is an effective way to eliminate anti-nutritional substances in animal feed. However, there are few reports on nitrilase that can efficiently hydrolyze glucosinolate-derived nitrile compounds in rapeseed meal. SUMMARY

[0004] The technical problem to be solved by the present application is to provide application of a nitrilase mutant in hydrolysis of glucosinolate-derived nitrile compounds in rapeseed meal, which can efficiently hydrolyze 3-butenenitrile and 4-pentenenitrile.

[0005] To solve the above technical problem, the following technical solutions are adopted in the present application:

[0006] The nitrilase mutant PgNIT2-A190I is obtained by point mutation of alanine at position 190 to isoleucine from nitrilase PgNIT2 of Paraburkholderia graminis C4D1M.

[0007] The nitrilase mutant PgNIT2-A190I has the amino acid sequence of SEQ.ID.NO.1.

[0008] The nitrilase mutant PgNIT2-A190I has the amino acid sequence of SEQ.ID.NO.1.

[0009] The coding gene has the base sequence of SEQ.ID.NO.2.

[0010] The recombinant plasmid containing the coding gene.

[0011] The recombinant genetically engineered bacteria constructed from the recombinant plasmid.

[0012] The preparation method of the nitrilase mutant PgNIT2-A190I, the recombinant genetically engineered bacteria are cultured and induced to express the nitrilase mutant, and the obtained culture solution is separated and purified to obtain the nitrilase mutant PgNIT2-A190I.

[0013] The application of the nitrilase mutant PgNIT2-A190I in hydrolyzing canola meal glucosinolate-derived nitrile compounds.

[0014] The nitrile compounds are 3-butenenitrile and 4-pentenenitrile, and the reaction conditions of hydrolysis are pH 6.0-9.0 and temperature 30-50℃.

[0015] The reaction conditions of hydrolysis are pH 7.0 and temperature 45℃.

[0016] In view of the problem that the nitrilase for efficiently hydrolyzing canola meal glucosinolate-derived nitrile compounds is deficient, the inventors obtain a nitrilase mutant PgNIT2-A190I by site-directed mutagenesis, which is obtained by mutating alanine at position 190 of nitrilase PgNIT2 of Paraburkholderia graminis C4D1M to isoleucine. Accordingly, the inventors also design a recombinant plasmid for coding gene of the nitrilase mutant PgNIT2-A190I, and construct a corresponding recombinant genetically engineered bacteria. Studies show that, with 3-butenenitrile and 4-pentenenitrile as substrates, the enzyme activity of the nitrilase and the mutant PgNIT2-A190I of the application under pH 7.0 and 45℃ is 5.94 U / mg and 6.66 U / mg; 9.95 U / mg and 11.90 U / mg, respectively, and the nitrilase mutant of the application is significantly improved. Under various substrate concentrations, the hydrolysis capacity of the mutant PgNIT2-A190I of the application on 3-butenenitrile and 4-pentenenitrile is also higher than that of the nitrilase PgNIT2. Moreover, the mutant xylanase has good pH and temperature tolerance, and has production application potential in efficient hydrolysis of canola meal glucosinolate-derived nitrile compounds. BRIEF DESCRIPTION OF DRAWINGS

[0017] Figure 1 The figure is a comparison of the enzyme activity of the nitrilase PgNIT2 and the mutant PgNIT2-A190I.

[0018] Figure 2 The figure is a result graph of the optimal pH research of the nitrilase PgNIT2 and the mutant PgNIT2-A190I, in which (A) 3-butenenitrile is used as a substrate; (B) 4-pentenenitrile is used as a substrate.

[0019] Figure 3Figure for pH stability of nitrilase PgNIT2 and mutant PgNIT2-A190I, wherein: (A) with 3-butenenitrile as substrate; (B) with 4-pentenenitrile as substrate.

[0020] Figure 4 Figure for temperature optimum of nitrilase PgNIT2 and mutant PgNIT2-A190I, wherein: (A) with 3-butenenitrile as substrate; (B) with 4-pentenenitrile as substrate.

[0021] Figure 5 Figure for temperature stability of nitrilase PgNIT2 and mutant PgNIT2-A190I, wherein: (A) with 3-butenenitrile as substrate; (B) with 4-pentenenitrile as substrate.

[0022] Figure 6 Figure for hydrolytic capacity of nitrilase PgNIT2 and mutant PgNIT2-A190I, wherein: (A) with 100 mM 3-butenenitrile as substrate; (B) with 100 mM 4-pentenenitrile as substrate; (C) with 500 mM 3-butenenitrile as substrate; (D) with 500 mM 4-pentenenitrile as substrate. DETAILED DESCRIPTION

[0023] In the following examples, unless otherwise specified, the experimental methods are conventional methods; the test materials used are conventional biochemical reagent companies purchased; the quantitative tests are set up three biological repeats, and the results are taken as average value.

[0024] In the examples, the main raw materials and reagents are as follows:

[0025] 1. Strains and vectors:

[0026] Escherichia coli cloning strain DH5α, Escherichia coli expression strain BL21 (DE3), vector pET28a (+).

[0027] 2. Culture medium:

[0028] (1) LB liquid medium: 5 g of yeast powder, 10 g of peptone, 10 g of sodium chloride, deionized water to 1 L, natural pH.

[0029] (2) LB solid medium: 5 g of yeast powder, 10 g of peptone, 10 g of sodium chloride, 15 g of agar, deionized water to 1 L, natural pH.

[0030] 3. Reagents:

[0031] (1) Kanamycin: 1.0 g of kanamycin is dissolved in 10 mL of sterile water, and sterilized by 0.22 μm sterile filter membrane.

[0032] (2) 1M IPTG solution: 2.38g IPTG, dissolved in 20mL sterilized water, sterilized by 0.22μm filter membrane.

[0033] (3) Sodium phenolate solution: 12.5g sodium hydroxide, 25.0g phenol, deionized water to 1L, natural pH.

[0034] (4) Sodium nitroprusside solution: 1g sodium nitroprusside, deionized water to 100mL, 100 times dilution with deionized water before use, natural pH.

[0035] (5) Sodium hypochlorite solution: 19.4mL sodium hypochlorite solution, deionized water to 1L, natural pH.

[0036] (6) 500mM 3-butenenitrile solution: 4.00mL 3-butenenitrile, deionized water to 100mL.

[0037] (7) 500mM 4-pentenenitrile solution: 4.85mL 4-pentenenitrile, deionized water to 100mL.

[0038] (8) Lysis Buffer solution: 0.68g imidazole, 17.53g sodium chloride, 5.99g sodium phosphate monobasic, deionized water to 1L, pH adjusted to 8.0.

[0039] (9) 20, 40, 60, 80, 100, 150, 250mM imidazole solution: 1.36, 2.72, 4.09, 5.44, 6.81, 10.21, 17.02g imidazole, 17.53g sodium chloride, 5.99g sodium phosphate monobasic, deionized water to 1L, pH adjusted to 8.0.

[0040] Example 1, Construction of recombinant expression strain of PgNIT2

[0041] A nitrile hydrolase from Paraburkholderia graminis C4D1M was retrieved from NCBI database and named PgNIT2 (amino acid sequence GenBank accession number WP_006050412, mRNA sequence accession number NZ_ABLD01000011). PgNIT2 gene was synthesized by Shanghai Generay Biotech Co., Ltd. and cloned into expression vector pET28a to obtain recombinant expression vector pET28a-PgNIT2. E. coli expression strain BL21(DE3) was transformed, and the transformants with correct sequences were selected for subsequent expression experiments.

[0042] Example 2, Construction of recombinant expression of mutant PgNIT2-A190I

[0043] The construction steps of the recombinant plasmid containing the mutant nitrilase gene are divided into four steps:

[0044] In the first step, the primers PgNIT2-A190I-F and PgNIT2-A190I-R with a length of about 35 bp are designed, the mutation base is located in the middle of the primer, and the primers PgNIT2-F and PgNIT2-R with a length of about 40 bp are designed with Bam HI enzyme cutting sites at both ends of the PgNIT2 sequence, and pET28a-PgNIT2 plasmid as the template (directly constructed by Shengong Biotechnology Co., Ltd.), two fragments with overlapping fragments at the mutation site are amplified.

[0045] The primers used above are as follows:

[0046] PgNIT2-F: CAGCAAATGGGTCGCGGATCCATGAAAGTTGTCAAAGCCGCC

[0047] PgNIT2-R: CTCGAGTGCGGCCGCAAGCTTTCAGCGCGAACCTGCAAC

[0048] PgNIT2-A190I-F: GATGTACCCCGGCTCTATATTTGGCGAGGGGTTTG

[0049] PgNIT2-A190I-R: CAAACCCCTCGCCAAATATAGAGCCGGGGTACATC

[0050] The PCR amplification system: 2 μL of forward primer, 2 μL of reverse primer, 2 μL of DNA template, 25 μL of 2×Phanta Max Master Mix, and 19 μL of ddH2O.

[0051] The PCR amplification program: pre-denaturation at 95℃ for 3 minutes; denaturation at 95℃ for 30 seconds, annealing at 65℃ for 15 seconds, extension at 72℃ for 30 seconds, 30 cycles of reaction; extension at 72℃ for 10 minutes.

[0052] In the second step, the two fragments are subjected to fusion PCR to obtain the PgNIT2 full-length sequence with specific site mutation;

[0053] The PCR amplification system: 6.25 μL of each of the two fragments, and 12.5 μL of 2×Phanta Max Master Mix.

[0054] The PCR amplification program: pre-denaturation at 95℃ for 3 minutes; denaturation at 95℃ for 30 seconds, annealing at 60℃ for 15 seconds, extension at 72℃ for 1 minute, 20 cycles of reaction; extension at 72℃ for 10 minutes.

[0055] Third step, using primers PgNIT2-F and PgNIT2-R with Bam HI enzyme cutting site to amplify the full-length mutant gene, using the fusion product of the second step as the DNA template.

[0056] PCR amplification system: 2 μL forward primer, 2 μL reverse primer, 2 μL DNA template, 25 μL 2×Phanta Max Master Mix, 19 μL ddH2O.

[0057] PCR amplification program: pre-denaturation 95℃, 3 min; denaturation 95℃, 30 s, annealing 65℃, 15 s, extension 72℃, 1 min, 30 cycles of reaction; extension 72℃, 10 min.

[0058] Fourth step, using homologous recombination enzyme C112 (Nanjing Novozyme Bio-Technology Co., Ltd.) to connect the full-length mutant gene PCR product with the linearized pET28a vector, and transfer into the E. coli cloning strain DH5α competent.

[0059] In this study, pET-28a(+) was used as a heterologous expression vector, and Bam HI site was selected as the integration site of the exogenous fragment. After linearizing the pET-28a(+) vector using restriction enzyme Bam HI (Nanjing Novozyme Bio-Technology Co., Ltd.), the linearized vector fragment was purified and recovered using a DNA recovery purification kit. After verifying the band size of the enzyme cutting product, the gel was purified and recovered.

[0060] Enzyme cutting reaction system: 5 μg pET-28a(+) vector, 5 μL endonuclease Bam HI, 5 μL 10×Fast digest buffer, ddH2O to 50 μL, 37℃ reaction for 30 min.

[0061] Homologous recombination reaction: the purified PCR amplified fragment (X) and the purified linearized vector fragment (Y) were mixed with C112 recombinase in a molar volume ratio of 2:1, the total reaction volume was 10 μL, and the reaction was carried out at 37℃ for 30 min.

[0062] PCR system: X μL target DNA fragment, Y μL linearized plasmid vector, 2 μL 5×CE II buffer, 1 μL C112 recombinase, ddH2O to 10 μL. 37℃ reaction for 30 min.

[0063] The recombinant product was transferred into E. coli competent DH5α, and cultured overnight in a 37℃ constant temperature incubator. Single colonies were picked for colony PCR. After identifying the correct size of the PCR product by agarose gel electrophoresis,

[0064] Further pick single colony access to the containing 10 mL LB liquid medium (containing 25 μg / mL kanamycin) in the finger bottle, the overnight culture, after extracting the plasmid to entrust Sheng Gong Bioengineering Co., Ltd. to carry out sequencing, through the sequencing result verification, determine that the mutant nitrilase gene has been cloned into the vector pET-28a, mutant PgNIT2-A190I is successfully constructed, and subsequent protein expression is carried out.

[0065] Example 3, preparation of recombinant nitrilase

[0066] (1) pick the correct recombinant transformant to 10 mL LB liquid medium (containing kanamycin 50 mg / mL), 37℃, 220 rpm overnight culture.

[0067] (2) 2 mL of overnight culture was transferred to 200 mL of LB liquid medium (containing kanamycin 50 mg / mL), 37℃, 220 rpm culture to OD 600 about 0.6-0.8, 0.1 mL of 1M IPTG was added, 16℃, 100 rpm culture for 24 hours.

[0068] (3) collect the bacterial liquid, 4℃, 8000 rpm centrifugal 10 min, collect the bacterial body. The collected cells were resuspended with Lysis Buffer solution, and the bacterial body was broken by ultrasonic wave disrupter.

[0069] (4) collect the bacterial liquid after breaking, 4℃, 8000 rpm centrifugal 10 min, take the supernatant for protein purification. With 20 mM, 40 mM, 60 mM, 80 mM, 100 mM, 150 mM, 250 mM concentration of imidazole eluent, add eluent in turn to collect protein.

[0070] (5) take 32 μL sample, add 8 μL protein loading buffer, mix well, boil in boiling water for 10 min, centrifuge briefly and perform SDS-PAGE electrophoresis. According to the electrophoretic band, the optimal elution volume is determined and the fusion protein with higher purity is collected. The protein concentration is determined by Brandford method.

[0071] Example 4, analysis of enzymatic properties of recombinant nitrilase

[0072] The phenol-sodium hypochlorite method was used to measure the enzyme activity of the recombinant nitrilase obtained in Example 3. The specific method is as follows:

[0073] The reaction system used pH 7.0 citric acid-disodium hydrogen phosphate buffer, the reaction substrate was 500 mM 3-butenenitrile and 4-pentenenitrile, the reaction system volume was 1 mL, and the reaction was carried out in a 45℃ water bath for 30 min. After the reaction was completed, 100 μL 2M HCl was added to terminate the reaction.

[0074] Take 100 μL of the reaction solution into a 10 mL test tube, add 1 mL of sodium phenolate, 1.5 mL of sodium nitrosoferricyanide, and 1.5 mL of sodium hypochlorite in sequence, and bring the volume to 5 mL with deammoniated water. Mix by inverting and place in a 27°C metal water bath for 15 min. Take 200 μL and place it in a 96-well microplate, and measure the absorbance at 630 nm.

[0075] Enzyme activity unit (U) definition: The amount of enzyme that produces 1 μmol of ammonia per minute at 45℃ and pH 7.0.

[0076] (1) Enzyme activities of nitrile hydrolases PgNIT2 and PgNIT2-A190I

[0077] like Figure 1 As shown, using 3-butenonitrile and 4-pentenonitrile as substrates, the enzyme activities of nitrile hydrolase and mutant PgNIT2-A190I at pH 7.0 and 45℃ were 5.94 U / mg and 6.66 U / mg, and 9.95 U / mg and 11.90 U / mg, respectively.

[0078] (2) Optimal pH and pH stability of nitrile hydrolases PgNIT2 and PgNIT2-A190I

[0079] Purified nitrile hydrolase PgNIT2 and its mutant PgNIT2-A190I were subjected to enzymatic reactions at different pH values ​​to determine their optimal pH. The buffers used were citrate-disodium hydrogen phosphate buffer (pH 5.0–8.0), Tris-hydrochloric acid buffer (pH 8.0–9.0), and glycine-sodium hydroxide buffer (pH 9.0–10.0). The results are as follows: Figure 2 As shown, using 3-butenonitrile and 4-pentenonitrile as substrates, the optimal pH for both PgNIT2 and its mutant PgNIT2-A190I is 7.0, and they can maintain more than 80% of their enzyme activity within the pH range of 6.0 to 8.0.

[0080] like Figure 3 As shown, within the pH range of 6.0–9.0, and after treatment at 4°C for 12 h, both nitrile hydrolases PgNIT2 and PgNIT2-A190I maintained more than 60% of their enzyme activity.

[0081] (3) Optimal temperature and temperature stability of nitrile hydrolase PgNIT2 and PgNIT2-A190I

[0082] The enzyme activities of purified nitrile hydrolases PgNIT2 and PgNIT2-A190I were measured at pH 7.0 and under different temperatures (30-60℃). Figure 4As shown in Fig. 2, the optimal reaction temperature of both the nitrilase PgNIT2 and PgNIT2-A190I was 45 °C.

[0083] As shown in Fig. 3, both the nitrilase PgNIT2 and PgNIT2-A190I could maintain more than 90% of the enzyme activity at 30-40 °C, and more than 50% of the enzyme activity after 1 h at 45 °C. Figure 5 (4) Hydrolytic ability of nitrilases PgNIT2 and PgNIT2-A190I

[0084] The hydrolytic ability of the purified nitrilases PgNIT2 and PgNIT2-A190I with 100 mM and 500 mM 3-butenenitrile and 4-pentenenitrile as substrates at pH 7.0 and 45 °C was shown in Fig. 4. The nitrilase PgNIT2 reacted with 100 mM 3-butenenitrile and 4-pentenenitrile for 2 h, and the hydrolysis rates were 77.1% and 78.4%, respectively. The nitrilase reacted with 500 mM substrates for 2 h, and the hydrolysis rates were 60.7% and 76.5%, respectively.

[0085] Figure 6 The mutant nitrilase PgNIT2-A190I reacted with 100 mM 3-butenenitrile and 4-pentenenitrile for 2 h, and the hydrolysis rates were 89.4% and 94.5%, respectively. The nitrilase reacted with 500 mM substrates for 2 h, and the hydrolysis rates were 91.22% and 94.8%, respectively.

[0086] The mutant nitrilase PgNIT2-A190I reacted with 100 mM 3-butenenitrile and 4-pentenenitrile for 2 h, and the hydrolysis rates were 89.4% and 94.5%, respectively. The nitrilase reacted with 500 mM substrates for 2 h, and the hydrolysis rates were 91.22% and 94.8%, respectively.​

Claims

1. A mutant nitrilase, PgNIT2-A190I, characterized in that, The amino acid sequence of the nitrilase mutant is shown as SEQ ID NO.

1.

2. A gene encoding the nitrilase mutant PgNIT2-A190I according to claim 1.

3. The genetic code according to claim 2, wherein, The base sequence of the gene is shown as SEQ ID NO.

2.

4. A recombinant plasmid containing the gene according to claim 3.

5. A recombinant genetically engineered bacterium constructed from the recombinant plasmid according to claim 4.

6. A method for producing the nitrilase mutant PgNIT2-A190I according to claim 1, characterized in that: The recombinant genetically engineered bacterium according to claim 5 is cultured and induced to express the nitrilase mutant, and the obtained culture solution is separated and purified to obtain the nitrilase mutant PgNIT2-A190I.

7. The use of the nitrilase mutant PgNIT2-A190I according to claim 1 in hydrolyzing the nitrile compound derived from rapeseed meal glucosinolate, which is 3-butenenitrile or 4-pentenenitrile.

8. Use according to claim 7, characterized in that: The reaction conditions for the hydrolysis are pH 6.0-9.0 and temperature 30-50°C.

9. Use according to claim 8, characterized in that: The reaction conditions for the hydrolysis are pH 7.0 and temperature 45°C.

Citation Information

Patent Citations

  • Nitrilase mutant and application thereof in catalytic synthesis of 2-chloronicotinic acid

    CN117603950A

  • Bioactive process for biogeneration of functional carbohydrates from dairy by-products

    US20240018176A1