BnaWRKY25 gene and application thereof in regulating growth and development of brassica napus seedlings

By regulating the BnaWRKY25 gene using CRISPR/Cas9 gene editing and gene overexpression technology, the problem of traditional breeding methods being unable to promote the growth and development of rapeseed seedlings was solved, resulting in a significant improvement in rapeseed seedling growth and breeding efficiency.

CN118813635BActive Publication Date: 2026-04-28HUAZHONG AGRI UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
HUAZHONG AGRI UNIV
Filing Date
2024-05-24
Publication Date
2026-04-28

AI Technical Summary

Technical Problem

Traditional breeding methods are difficult to effectively promote the growth and development of rapeseed seedlings and are difficult to target and regulate key genes, resulting in low breeding efficiency and susceptibility to environmental influences.

Method used

By using CRISPR/Cas9 gene editing and gene overexpression technologies, the expression level of the BnaWRKY25 gene was regulated to construct gene-edited and overexpression materials for Brassica napus, thereby increasing or decreasing root length, leaf size, and mesophyll cell number in rapeseed seedlings.

Benefits of technology

It can significantly improve the growth and development of rapeseed seedlings, promote the yield and quality of rapeseed, improve breeding efficiency, provide new germplasm resources, and reduce environmental impact.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118813635B_ABST
    Figure CN118813635B_ABST
Patent Text Reader

Abstract

The present application relates to BnaWRKY25 gene and its application in regulating the growth and development of Brassica napus seedling stage. A plurality of BnaWRKY25 genes are isolated and identified, and the expression of the BnaWRKY25 gene is regulated through gene overexpression technology and CRISPR / Cas9 gene editing technology, and it is found that the BnaWRKY25 gene positively regulates the root length, leaf size and mesophyll cell number of the oilseed rape seedling stage, and can be used for promoting the growth of the oilseed rape seedling stage, laying a foundation for the yield and quality improvement of the oilseed rape, providing a new germplasm resource for the breeding of the oilseed rape, greatly improving the breeding efficiency, and accelerating the breeding process.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering breeding technology, specifically involving the BnaWRKY25 gene and its application in regulating the growth and development of Brassica napus seedlings. Background Technology

[0002] Rapeseed (Brassica napus) is the most widely planted oilseed crop in my country and a major source of domestic vegetable oil. In 2022, the rapeseed planting area was 7,253,000 hectares, accounting for 55.2% of the total oilseed planting area. Besides its oilseed value, rapeseed and its straw also have feed value, being high in protein and calcium (Liu et al., 2019). Rapeseed yield and quality directly affect the supply of edible oil and feed. The seedling growth and development are fundamental to the overall yield and quality of rapeseed throughout its growth period. The quality of seedling growth directly impacts root development, nutrient absorption capacity, and leaf photosynthetic efficiency, which is crucial for accumulating sufficient nutrients during the early stages of growth and development, and also affects later seed development and yield formation.

[0003] Traditional breeding methods are insufficient to effectively promote the growth and development of rapeseed seedlings. While traditional methods rely on hybridization and selection to improve seedling growth, these methods are inefficient, time-consuming, labor-intensive, and susceptible to environmental factors. Furthermore, traditional methods struggle to target and regulate key genes related to seedling growth and development. However, genetic engineering techniques can target and regulate these key genes, effectively improving seedling growth and development. For example, overexpressing genes that promote seedling growth or knocking out genes that inhibit it can significantly improve seedling growth and development traits.

[0004] BnaWRKY25 is an important transcription factor in rapeseed. Studies have shown that overexpression of the BnaWRKY25 gene can enhance the resistance of rapeseed to salt stress (Jiang and Deyholos 2009). However, research on the regulation of rapeseed seedling growth and development by BnaWRKY25 has not been reported. CRISPR / Cas9 gene editing technology can precisely modify the genome by targeting specific DNA sequences. This technology has broad application prospects in crop breeding, providing new opportunities for crop breeding. Gene overexpression technology is a technique that modifies crops by increasing the expression level of specific genes. Similarly, gene overexpression technology can help us develop crops with higher yields, better quality, and greater sustainability. Summary of the Invention

[0005] The present invention provides a BnaWRKY25 gene, the nucleotide sequence of which is shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 and / or SEQ ID NO:5.

[0006] This invention provides vectors, plasmids, and / or cells containing the BnaWRKY25 gene described above.

[0007] This invention provides the application of the above-mentioned BnaWRKY25 gene or vector, plasmid and / or cell in regulating plant growth.

[0008] Furthermore, the plant includes Brassica napus, and the growth includes seedling growth.

[0009] Furthermore, the seedling growth includes root length, leaf size, number of mesophyll cells, and / or IAOx content during the seedling stage.

[0010] This invention provides a method for regulating plant growth, including regulating the expression level of the BnaWRKY25 gene in plants.

[0011] Furthermore, the regulation includes overexpression, RNAi, CRISPR, ZFN, and / or TALEN.

[0012] Furthermore, the plant includes Brassica napus, the growth includes seedling growth, and the nucleotide sequence of the BnaWRKY25 gene is shown as any two or more of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 and / or SEQ ID NO:5.

[0013] This invention provides a method for promoting the growth of rapeseed seedlings by increasing the expression level of the BnaWRKY25 gene in rapeseed. The nucleotide sequence of the BnaWRKY25 gene is shown in any two or more of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 and / or SEQ ID NO:5.

[0014] Furthermore, a BnaWRKY25 overexpression vector was obtained through homologous recombination, and the BnaWRKY25 gene expression was initiated by the 35S promoter. The vector was then transferred into Brassica napus using Agrobacterium-mediated genetic transformation.

[0015] Beneficial effects:

[0016] 1. Enhancing the growth and development of rapeseed seedlings: Overexpression of the BnaWRKY25 gene significantly increased root length, leaf size, and mesophyll cell number in rapeseed seedlings; conversely, gene editing to knock out the BnaWRKY25 gene significantly reduced root length, lateral root number, leaf size, and mesophyll cell number in rapeseed seedlings. This indicates that the BnaWRKY25 gene positively regulates the growth and development of rapeseed seedlings.

[0017] 2. Promote rapeseed yield and quality improvement: By regulating the expression of the BnaWRKY25 gene through gene overexpression technology and CRISPR / Cas9 gene editing technology, which is not affected by the environment, the growth and development of rapeseed seedlings can be regulated, thus laying the foundation for improving rapeseed yield and quality.

[0018] 3. This invention not only elucidates the function of the BnaWRKY25 gene, providing new germplasm resources for the breeding of Brassica napus, but also greatly improves breeding efficiency and accelerates the breeding process. Attached Figure Description

[0019] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0020] Figure 1 A schematic diagram of the pKSE401-BnaWRKY25 vector is shown, in which: Figure 1 a is the backbone of pKSE401, which contains a Cas9 gene promoted by the 35S promoter, an EGFP (green fluorescent tag) gene promoted by the 35S promoter, an expression cassette promoted by the U6 promoter, a kanamycin resistance gene, and a BsaI restriction site. Figure 1 b represents the sgRNA expression element set, U6-26 and U6-29 are promoters, and gRNA-Sc is the gRNA backbone.

[0021] Figure 2 The diagram shows the construction of the BnaWRKY25 overexpression vector and the identification and analysis of its transcriptional level, where: Figure 2 a is a schematic diagram of the construction of the BnaA04.WRKY25 overexpression vector; Figure 2 b represents the identification of transcriptional levels in BnaA04.WRKY25 overexpression materials.

[0022] Figure 3 The gene editing status of the bnawrky25 mutant is as follows: Figure 3 a is a schematic diagram of the target location of the bnawrky25 mutant; Figure 3b represents the gene editing details of the bnawrky25 mutant, where L5 is a heterozygous mutant with simultaneous editing of four copies of BnaA05.WRKY25, BnaC03.WRKY25, BnaC04.WRKY25a, and BnaC04.WRKY25b, and L7 is a heterozygous mutant with simultaneous editing of four copies of BnaA04.WRKY25, BnaA05.WRKY25a, and BnaC04.WRKY25b. L12 is a heterozygous mutant with simultaneous editing of five copies of BnaA04.WRKY25, BnaA05.WRKY25, BnaC03.WRKY25, BnaC04.WRKY25a, and BnaC04.WRKY25b; L13 is a heterozygous mutant with simultaneous editing of five copies of BnaA04.WRKY25, BnaA05.WRKY25, BnaC03.WRKY25, BnaC04.WRKY25a, and BnaC04.WRKY25b; and L13 is a heterozygous mutant with simultaneous editing of five copies of BnaA04.WRKY25, BnaA05.WRKY25, BnaC03.WRKY25, BnaC04.WRKY25a, and BnaC04.WRKY25b.

[0023] Figure 4 Phenotypic diagrams of the bnawrky25 mutant after two weeks of germination, including: Figure 4 a shows the seedling phenotypes of Brassica napus Westar and bnawrky25 mutants two weeks after germination; Figure 4 b is a statistical chart of cotyledon area; Figure 4 c is the graph showing the determination of IAOx content; Figure 4 d is a root length statistics chart; Figure 4 e is a statistical graph of the number of lateral roots.

[0024] Figure 5 Phenotypic analysis of the bnawrky25 mutant after three weeks of germination, including: Figure 5 a shows the seedling phenotypes of Brassica napus Westar and bnawrky25 mutants three weeks after germination; Figure 5 b is a statistical chart of root length;

[0025] Figure 5 c shows the distribution of mesophyll cells in the second true leaf; Figure 5 d is a statistical graph showing the number of cells in the mesophyll cells of the second true leaf.

[0026] Figure 6 Phenotypic results of BnaWRKY25 overexpression materials at 9 days of germination, including: Figure 6 a is the phenotypic diagram of the Brassica napus Westar and BnaWRKY25 overexpression materials 9 days after germination; Figure 6 b is a statistical chart of root length; Figure 6 c is a statistical chart of hypocotyl length; Figure 6 d is the cotyledon size phenotype; Figure 6e is a statistical graph of cotyledon area; Figure 6 f is a graph showing the determination of IAOx content.

[0027] Figure 7 Phenotypic images of BnaWRKY25 overexpression materials after three weeks of germination, including: Figure 7 a shows the seedling phenotypes of Brassica napus Westar and BnaWRKY25 overexpression materials three weeks after germination; Figure 7 b is a statistical chart of root length; Figure 7 c shows the distribution of mesophyll cells in the second true leaf; Figure 7 d is a statistical graph showing the number of cells in the mesophyll cells of the second true leaf. Detailed Implementation

[0028] The following embodiments are only used to more clearly illustrate the technical solutions of the present invention, and are therefore merely examples and should not be used to limit the scope of protection of the present invention. It should be noted that, unless otherwise stated, the technical or scientific terms used in this application should have the ordinary meaning understood by those skilled in the art. Unless specifically stated, the reagents, methods, and equipment used in this invention are conventional reagents, methods, and equipment in this technical field. Unless specifically stated, the reagents and materials used in the following embodiments are commercially available.

[0029] The purpose of this invention is to overcome the shortcomings and deficiencies of existing technologies and provide a method for improving the growth and development of rapeseed seedlings by regulating the BnaWRKY25 gene. This objective is achieved as follows:

[0030] I. Constructing knockout and overexpression materials of the BnaWRKY25 gene in Brassica napus.

[0031] (I) Construction of knockout material for the BnaWRKY25 gene in Brassica napus:

[0032] (1) Five homologous sequences of WRKY25 were identified in the rapeseed genome: named BnaA04.WRKY25, BnaA05.WRKY25, BnaC03.WRKY25, BnaC04.WRKY25a and BnaC04.WRK25b, respectively, and their nucleotide sequences are shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.5;

[0033] (2) Based on the characteristics of the five copies of the BnaWRKY25 gene, four sgRNAs based on CRISSPR / Cas9 were designed. The nucleotide sequences of sgRNA1, sgRNA2, sgRNA3 and sgRNA4 are shown in SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8 and SEQ ID NO.9, respectively. The primer sequences Bnawrky25-T1-BsF, Bnawrky25-T1-F0, P5-DT0-BsR2, Bnawrky25-T2-BsF2, Bnawrky25-T2-F0, P5-DT0-BsR3, Bnawrky25-T3-BsF3, Bnawrky25-T3-F0, Bnawrky25-T4-R0 and Bnawrky25-T4-BsR are shown in Table 1.

[0034] Table 1

[0035]

[0036]

[0037] (3) Construct a four-target gene editing vector pKSE401-BnaWRKY25, and use Agrobacterium-mediated transformation to transfer the pKSE401-BnaWRKY25 vector into the recipient material Westar to obtain BnaWRKY25 gene-edited plants.

[0038] (4) Screen positive seedlings from transgenic offspring, amplify them using specific primers, and send the PCR products to Annoroad Biotechnology Co., Ltd. for sequencing. Compare the sequencing results to determine the editing format.

[0039] (II) Construction of overexpression materials for the BnaWRKY25 gene in Brassica napus:

[0040] (1) The P1300-mcherry-BnaA04.WRKY25 overexpression vector was obtained by homologous recombination, and the BnaA04.WRKY25 gene was expressed by the 35S promoter. Then, it was transformed into wild-type Westar by Agrobacterium-mediated genetic transformation.

[0041] (2) Hygromycin was used to screen positive seedlings in transgenic offspring, and qRT-PCR was used to detect the relative gene expression level of BnaA04.WRKY25 in positive seedlings.

[0042] II. Examination of the growth and development phenotype of BnaWRKY25 transgenic seedlings

[0043] BnaWRKY25 was edited using CRISPR / Cas9 to obtain five mutants, L12 and L13 (mutations occurred in all five copies of BnaA04.WRKY25, BnaA05.WRKY25, BnaC03.WRKY25, BnaC04.WRKY25a, and BnaC04.WRKY25b). Overexpression lines L2 and L4 of BnaA04.WRKY25 were then obtained via homologous recombination. After harvesting seeds from the T0 generation, hydroponics was performed to examine the phenotypes of the T1 generation seedlings, including root length, number of lateral roots, leaf size, and number of mesophyll cells.

[0044] The following detailed description is provided through specific embodiments.

[0045] Example 1: Construction of the CRISPR / Cas9 system for directed mutagenesis of Brassica napus BnaWRKY25 vector

[0046] (1) Determine the sgRNA target sequence for gene editing.

[0047] Based on previous research results, the inventors isolated and identified five homologous sequences of WRKY25, whose nucleotide sequences are shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.5.

[0048] sgRNAs were designed based on the BnaWRKY25 gene sequence mentioned above, and gene editing target sequences with low off-target rates were finally screened and identified: sgRNA1 (nucleotide sequence as shown in SEQ ID NO.6, GGG is a PAM sequence), sgRNA2 (nucleotide sequence as shown in SEQ ID NO.7, AGG is a PAM sequence), sgRNA3 (nucleotide sequence as shown in SEQ ID NO.8, AGG is a PAM sequence), and sgRNA4 (nucleotide sequence as shown in SEQ ID NO.9, AGG is a PAM sequence).

[0049] (2) Expression box construction

[0050] PCR amplification was performed using pCBC-DT1T2 diluted 100-fold as a template. The primers for amplifying the first target site were: Bnawrky25-T1-BsF, Bnawrky25-T1-F0, and P5-DT0-BsR2; the primers for amplifying the second target site were: Bnawrky25-T2-BsF2, Bnawrky25-T2-F0, and P5-DT0-BsR3; and the primers for amplifying the third and fourth target sites were: Bnawrky25-T3-BsF3, Bnawrky25-T3-F0, Bnawrky25-T4-R0, and Bnawrky25-T4-BsR. Their nucleotide sequences are shown in Table 1. The PCR product was purified and recovered, and the following enzyme digestion-ligation system was established: PCR fragment (626-bp), 2 μL; pKSE401-GFP, 2 μL; 10×NEB T4 Buffer, 1.5 μL; 10×BSA, 1.5 μL; BsaI (NEB), 1 μL; T4 DNALigase (NEB), 1 μL; ddH2O, 6 μL; reaction conditions: 37℃, 5 h; 50℃, 5 min; 80℃, 10 min.

[0051] (3) Construction of the four-target gene editing vector pKSE401-BnaWRKY25

[0052] Five μL of the ligation product was transformed into competent *E. coli* cells DH5α. Kanamycin-resistant colonies were screened on LB agar plates and sent to Qingke Biotechnology Co., Ltd. for sequencing to confirm sequence accuracy. For clones with correct sequencing, plasmids were extracted and transformed into *Agrobacterium* competent cells GV3101 for *Agrobacterium*-mediated genetic transformation. A schematic diagram of the vector pKSE401-BnaWRKY25 is shown below. Figure 1 As shown.

[0053] Example 2: Construction of overexpression material for the BnaWRKY25 gene in Brassica napus

[0054] The overexpression vector P1300-mcherry-BnaA04.WRKY25 was obtained through homologous recombination. A schematic diagram of the vector is shown below. Figure 2 As shown in a. Homologous recombination primers P1300-WRKY25-F (5'-tggatccatcgatagtactgtcgacatgtcttccacctctttcaccg-3') and P1300-WRKY25-R (5'-cttgctcaccatggtacctgagcgacgtggcgc-3') were designed based on the CDS sequence of BnaA04.WRKY25 to drive the expression of the BnaA04.WRKY25 gene with a 35S promoter, and then transformed into wild-type Westar using Agrobacterium-mediated genetic transformation.

[0055] Example 3 Agrobacterium-mediated genetic transformation of rapeseed

[0056] (1) Sowing

[0057] Soak rapeseed seeds in 75% alcohol for 3-5 minutes, disinfect with 50% 84 disinfectant for 10 minutes, rinse with sterile water 4-5 times, sow on M0 medium, and incubate at 24℃ in the dark for 5-6 days.

[0058] (2) Activation and preparation of Agrobacterium

[0059] Four days after inoculation, 100 μL each of kanamycin, rifampin, and gentamicin were added to 100 mL of liquid LB medium. 10 mL of the medium was transferred to a sterile centrifuge tube, inoculated with Agrobacterium, and cultured at 28°C with shaking at 250 rpm for 18-24 h to allow Agrobacterium to reach the logarithmic growth phase. At this point, 3 mL of the bacterial culture was transferred to 100 mL of triple-antibiotic liquid medium and cultured under the same conditions until OD600 = 0.6-0.8. The cultured bacterial culture was centrifuged at 4000 rpm for 10 min, the supernatant was discarded, and the culture was resuspended in an equal volume of DM and activated on ice.

[0060] (3) Infection and co-culture of explants

[0061] Hypocotyls of 6-day-old seedlings were excised using sterile forceps and a scalpel in DM liquid medium, each explant measuring 0.8-1 cm in length. The explants were placed in a dish containing the working bacterial solution and incubated for 8-15 minutes, shaking the dish several times during incubation. After incubation, the explants were transferred to sterile filter paper, excess infection solution was aspirated, and then the explants were placed on M1 medium using sterile forceps and incubated at 22°C in the dark for 24-48 hours.

[0062] (4) Inducing callus

[0063] After co-culture, the cells were transferred to M2 medium to induce callus formation and cultured in a greenhouse at 22°C for about 20 days under 16 hours of light and 8 hours of darkness.

[0064] (5) Induced differentiation

[0065] The callus was transferred to M3 medium and cultured under the same conditions for 2 weeks, then subcultured once until green shoots appeared.

[0066] (6) Rooting culture and transplanting

[0067] Once the buds have differentiated and the growth points are clearly visible, carefully cut the buds from the callus tissue using sterile forceps and a scalpel, avoiding the inclusion of excess callus tissue and preventing damage to the growth points. Then, transfer them to M4 medium for rooting. After rooting, transfer the plantlets to potting soil, cover them with a film for about a week, and then remove the film. After normal growth, perform molecular analysis.

[0068] Example 4: Inspection of BnaWRKY25 knockout material editing

[0069] (1) DNA extraction from transgenic plants: DNA was extracted using the CTAB method.

[0070] Take about 1-2cm 2 Young leaves of Arabidopsis thaliana or rapeseed were placed in 2 mL centrifuge tubes, and steel balls and 250 μL of 2% CTAB were added. The mixture was then thoroughly ground in a grinder (3 min for Arabidopsis thaliana, 6 min for rapeseed). After grinding, another 250 μL of 2% CTAB was added. The mixture was then placed in a 65℃ water bath for 30-60 min, mixing every 5-10 min. After the homogenate cooled to room temperature, an equal volume of a 24:1 solution (chloroform and isoamyl alcohol in a 24:1 volume ratio) was added, and the mixture was shaken for 10-15 min. The mixture was then centrifuged at 12000 rpm for 10 min. 500 μL of the supernatant was transferred to a new 1.5 mL centrifuge tube, and 500 μL of ice-cold ethanol was added. The mixture was then placed in a -20℃ freezer and allowed to stand for 30 min. The centrifuge tube was then centrifuged at 12000 rpm for 10 min, the supernatant was discarded, and 500 μL of ethanol was added. Let stand in 75% ethanol for 5 minutes, then discard the ethanol. You can repeat the washing once. Then, let the centrifuge tube containing DNA air dry overnight at room temperature. Add 200 μL of sterile ddH2O to dissolve the DNA and let it dissolve overnight at room temperature. After diluting the DNA stock solution, it can be used for various PCR operations.

[0071] (2) Identification of positive seedlings

[0072] PCR amplification was performed using primers Cas9-F (5'-agaccgtgaaggttgtggac-3') and Cas9-R (5'-tagtgatctgccgtgtctcg-3'). Water and Westar were used as negative controls, and plasmid pKSE401-BnaWRKY 25 was used as a positive control. After amplification, agarose gel electrophoresis was performed. If a DNA band of the corresponding size was observed, the plant was identified as a positive plant with Cas9 protein.

[0073] (3) Identification of gene editing status

[0074] Hi-TOM high-throughput sequencing technology was used to detect the editing status of transgenic positive plants. First, specific primers containing the target DNA fragment were designed for the first round of PCR amplification. The distance between one end of the designed specific primer and the target site should be 20-80 bp, and should not exceed 120 bp. The target amplification primers W25A04-3F, W25A04-3R, W25C0417-2F, W25C0417-2R, W25C0417-3F, W25C0417-3R, W25C0448-2F, W25C0448-2R, W25C0448-3F, W25C0448-3R, W25C03-4F, W25C03-4R, W25A05-3F, and W25A05-3R have sequences shown in Table 2.

[0075] Table 2

[0076]

[0077] Then, the first-round PCR products were used as DNA templates and a set of universal primers for the second round of PCR amplification. The universal primers included 12 left primers, 8 right primers, and 4 pairs of index primers. The index primers were used to distinguish different PCR plate samples amplified with the same primers. The 12 left primers, F-1, F-2, F-3, F-4, F-5, F-6, F-7, F-8, F-9, F-10, F-11, and F-12, have sequences shown in Table 3.

[0078] Table 3

[0079]

[0080]

[0081] The sequences of the eight right primers RA, RB, RC, RD, RE, RF, RG and RH are shown in Table 4.

[0082] Table 4

[0083] Primer name Nucleotide sequence (5'-3') RA gactggagtt cagacgtgtg ctcttccgat ctctgtgcgt tgagttggat gctggatgg RB gactggagtt cagacgtgtg ctcttccgat ctctgtgtagt gagttggat gctggatgg RC gactggagtt cagacgtgtg ctcttccgat ctctgtacgc tgagttggat gctggatgg RD gactggagtt cagacgtgtg ctcttccgat ctctgtctcg tgagttggat gctggatgg RE gactggagtt cagacgtgtg ctcttccgat ctctgtgctct gagttggat gctggatgg RF gactggagtt cagacgtgtg ctcttccgat ctctgtagtct gagttggat gctggatgg RG gactggagtt cagacgtgtg ctcttccgat ctctgtcgact gagttggat gctggatgg RH gactggagtt cagacgtgtg ctcttccgat ctctgtgatg tgagttggat gctggatgg

[0084] The sequences of the four index primers 427-i5, 427-i7, 428-i5, 428-i7, 430-i5, 430-i7, 432-i5, and 432-i7 are shown in Table 5.

[0085] Table 5

[0086] Primer name Nucleotide sequence (5'-3') 427-i5 aatgatacgg cgaccaccga gatctacacg ccttcaaaca ctctttccct acacgacgc 427-i7 caagcagaag acggcatacg agattcacga aggtgactgg agttcagacg tgtgctctt 428-i5 aatgatacgg cgaccaccga gatctacaca ggaacctaca ctctttccct acacgacgc 428-i7 caagcagaag acggcatacg agatcttagc cagtgactgg agttcagacg tgtgctctt 430-i5 aatgatacgg cgaccaccga gatctacaca cgcattcaca ctctttccct acacgacgc 430-i7 caagcagaag acggcatacg agatgagaca tcgtgactgg agttcagacg tgtgctctt 432-i5 aatgatacgg cgaccaccga gatctacacg actagcaaca ctctttccct acacgacgc 432-i7 caagcagaagacggcatacgagataacaggctgtgactggagttcagacgtgtgctctt

[0087] The second round of PCR products were analyzed to determine their specificity and amplification intensity. Equal volumes of amplification products from different monoclonal strains were mixed, and the mixture was subjected to electrophoresis and gel recovery. After confirming normal recovery, the recovered products were sent to the company for next-generation sequencing. Finally, the mutation sequence was decoded and analyzed using the online Hi-TOM website (http: / / www.hi-tom.net / hi-tom / ) to determine the mutation type of each monoclonal strain at each target site, and the editing type is as follows: Figure 3 As shown.

[0088] Example 5: Detection of BnaA04.WRKY25 expression level in BnaWRKY25 overexpression materials

[0089] (1) Extraction of RNA from rapeseed leaves

[0090] Total RNA was extracted using TRIPure Reagent, a reagent from Beijing Adley Biotechnology Co., Ltd. 50-100 mg of rapeseed leaves were rapidly frozen in liquid nitrogen, then transferred to a pre-cooled liquid nitrogen mortar for grinding, with continuous addition of liquid nitrogen until a powder was formed. The powder was then transferred to a 2.0 mL RNase-free centrifuge tube, and an appropriate amount of TRIPure Reagent was added. The mixture was allowed to stand at room temperature for 5 min. Then, 1 / 5 volume of chloroform (presumably TRIPure Reagent) was added, vortexed to mix, allowed to stand at room temperature for 5 min, and centrifuged at 12000 rpm at 4°C for 15 min. The supernatant was transferred to a new 1.5 mL RNase-free centrifuge tube, and an equal volume of isopropanol was added. The mixture was allowed to stand at room temperature for 10 min, and centrifuged at 12000 rpm at 4°C for 10 min. The precipitate was washed with an equal volume of 75% ethanol (presumably TRIPure Reagent) at 7500 rpm. Centrifuge at 4℃ for 5 min; discard the supernatant and retain the precipitate, air dry and dissolve in RNase-free water; add 2 μL of the extracted RNA to 1 μL of 5× Loading buffer and mix well; check the integrity of the RNA by TAE agarose gel electrophoresis. If three clear bands are visible, the subsequent experiments can be carried out.

[0091] (2) Reverse transcription

[0092] This experiment used the reverse transcription kit from Yisheng Biotechnology Co., Ltd. 4 μL of RNase-free reagent was added to a 0.2 mL centrifuge tube. One Step RT SuperMix, 1 μL gDNA Remover Mix, 1 μg RNA, RNase-free H2O to bring the volume to 20 μL, mix gently and then reverse transcribe according to the following program: 30℃, 5 min; 55℃, 15 min; 85℃, 30 sec.

[0093] (3) qRT-PCR was used to detect the expression level of the BnaA04.WRKY25 gene in the overexpression material.

[0094] The reverse transcription product diluted 30-fold was used as a template for qRT-PCR. Primers qWRKY25A04-F (5'-tgcttccgctttgcaagagac-3') and qWRKY25A04-R (5'-ccatcgttagagttcctact cacca-3') were used. The rapeseed internal reference genes were Banactin-F (5'-ggaagctcctggaatccatgaga-3') and Banactin-R (5'-tctttgctcatacggtcagcaattcc-3'). This study used... The qPCR SYBRGree n Master Mix premix was prepared as follows: cDNA 4.6 μL; Forward Primer 0.2 μL; Reverse Primer 0.2 μL; 5 μL of SYBR Green Master Mix was used for qPCR. The instrument was a CFX96 Real-Time System (Bio-Rad). The reaction program was as follows: pre-denaturation 95℃ for 5 min; denaturation 95℃ for 10 sec; annealing 58℃ for 20 sec; extension 60℃ for 20 sec; 40-45 cycles; melting curve 95℃ for 15 sec; 60℃ for 1 min; 95℃ for 15 sec; 60℃ for 15 sec. Data were collected, and relative gene expression levels were analyzed using the 2-ΔΔCt method.

[0095] Example 6: Phenotypic observation of transgenic material plants

[0096] To further determine the gene function of BnaWRKY25 during the seedling stage, seeds of the five mutants L12 and L13 (mutated in BnaA04.WRKY25, BnaA05.WRKY25, BnaC03.WRKY25, BnaC04.WRKY25a and BnaC04.WRKY25b) and the T0 generation of overexpressing lines L2 and L4 were harvested and hydroponically cultured to examine the seedling phenotype of the T1 generation.

[0097] Phenotypic examination of mutant seedlings two weeks after germination, as follows: Figure 4As shown, the root length, number of lateral roots, and cotyledon size of the mutant material were significantly lower than those of the wild type. Compared with the wild type, the root length was shortened by about 32%, the number of lateral roots decreased by about 16%, and the cotyledon area was reduced by about 21.8%. Indole-3-acetaldehyde oxime (IAOx) is a precursor of auxin synthesis in the indole-acetaldehyde oxime pathway. The IAOx content in the cotyledons of the BnaWRKY25 mutant material two weeks after germination was measured using an enzyme-linked immunosorbent assay (ELISA) kit. The results showed that the IAOx content in the BnaWRKY25 mutant was reduced by about 25.2%. The phenotypic examination of the mutant seedlings three weeks after germination is as follows. Figure 5 As shown, comparisons of both above-ground and below-ground parts reveal that the BnaWRKY25 mutant plants are significantly smaller than the wild type, with root length reduced by approximately 25.6%. Further examination of the size of palisade mesophyll cells in the mutant after three weeks of germination reveals that, for the same leaf area, the palisade mesophyll cells in the BnaWRKY25 mutant are more loosely arranged and fewer in number than in the wild type. This reduction in mesophyll cell count may contribute to the smaller leaves in the BnaWRKY25 mutant. In conclusion, BnaWRKY25 can regulate root and leaf development in Brassica napus seedlings.

[0098] Phenotypic examination was conducted on overexpressing plants that had germinated for 9 days. Figure 6 As shown, the root lengths of both L2 and L4 overexpression lines were longer than those of the wild type. Compared to the wild type, the root length of L2 increased by approximately 15.2%, and that of L4 increased by approximately 33.2%. Furthermore, the hypocotyl length of L4 increased by 35.5% compared to the wild type, but there was no significant difference in hypocotyl length between L2 and the wild type. Phenotypic analysis of the overexpression materials after 14 days of germination revealed that the cotyledon size of both L2 and L4 was larger than that of the wild type, increasing by approximately 15.6%. The IAOx content in the BnaWRKY25 overexpression materials after two weeks of germination was measured using an enzyme-linked immunosorbent assay (ELISA) kit. Compared to the wild type, the IAOx content of both overexpression lines was increased, with the IAOx content of L2 increasing by approximately 30.7% and that of L4 increasing by approximately 52.8%. Phenotypic analysis of the overexpression materials after three weeks of germination is shown below. Figure 7 As shown, the root length of the L2 and L4 overexpression lines was not statistically different from that of the wild type, but the true leaves were larger. The mesophyll cells of the L4 line were more densely arranged, and the number of mesophyll cells increased by 21.9% compared with the wild type. These results indicate that overexpression of BnaWRKY25 can enhance the proliferation capacity of mesophyll cells and promote the development of roots and leaves in rapeseed seedlings.

[0099] In summary, this invention, through overexpression and gene editing to knock out the BnaWRKY25 gene, found that the BnaWRKY25 gene positively regulates the growth and development of rapeseed seedlings, providing new germplasm resources for the breeding of Brassica napus, while greatly improving breeding efficiency and accelerating the breeding process.

[0100] appendix

[0101] I. The culture medium involved in this invention is as follows:

[0102] (1)LB: Peptone 10g / L+Yeast extract 5g / L+NaCl 10g / L;

[0103] (2) M0: MS 2.2g / L + sucrose 10g / L + Agar 6g / L;

[0104] (3) DM: MS 4.4 g / L + sucrose 30 g / L + AS 100 μmol / L;

[0105] (4) M1: MS 4.4g / L + sucrose 30g / L + D(-)-Mannitol 18g / L + 2,4-D 1mg / L + Kinetin 0.3mg / L + AS 100μmol / L + Agar 6g / L;

[0106] (5) M2: MS 4.4g / L + sucrose 30g / L + D(-)-Mannitol 18g / L + 2,4-D 1mg / L + Kinetin 0.3mg / L + STS 30mg / L + TMT 300mg / L + Kan 50mg / L + Agar 6g / L;

[0107] (6) M3: MS 4.4g / L + glucose 10g / L + xylose 0.25g / L + MES 0.6g / L + TZ (trans-zeatin) 2mg / L + IAA (indoleacetic acid) 0.1mg / L + TMT (termethin) 300mg / L + Kan (kanamycin) 50mg / L + Agar 6g / L;

[0108] (7)M4: MS 4.4g / L + sucrose 10g / L + TMT (termethin) 100mg / L + Kan (kanamycin) 25mg / L + Agar 10g / L.

[0109] III. The hormones and antibiotics involved in this invention are as follows:

[0110] (1) STS: Prepare 0.1 mol / L sodium thiosulfate (Na2S2O3) and silver nitrate (AgNO3) separately, and then mix Na2S2O3 and AgNO3 in a volume ratio of 4:1. Prepare 100 mL of STS solution by adding 20 mL of AgNO3 solution to 80 mL of Na2S2O3 solution. Prepare before use, filter to sterilize, and store in a brown bottle;

[0111] (2) Kinetin: Take 0.03g of Kinetin, dissolve it in 1mol / L HCl, and add water to make up to 100mL (in a fume hood);

[0112] (3) 2,4-D: 1 mg / mL stock solution, weigh 0.25 g 2,4-D, add a small amount of 95% ethanol and 1 mol / L NaOH, and add water to make up to 250 mL;

[0113] (4) AS: 100 mmol / L stock solution, weigh 0.392 g AS and dissolve it in dimethyl sulfoxide (DMSO), add water to make up to 20 mL, filter and sterilize with a 0.22 μm filter head, dispense and store at -20℃;

[0114] (5) TZ: 2 mg / mL stock solution, take 0.04 g TZ and dissolve it in a small amount of 3 mol / L KOH solution, add water to make up to 20 mL, filter and sterilize with a 0.22 μm filter head, dispense and store at -20℃;

[0115] (6) IAA: 1 mg / mL stock solution, weigh 100 mg IAA and dissolve it in a small amount of 95% alcohol, add water to make 100 mL, filter and sterilize with a 0.22 μm filter head, dispense and store at -20℃;

[0116] (7) TMT: 0.3g / mL, directly dissolved in water, then sterilized by vacuum filtration with a 0.22μm filter head, dispensed, and stored at -20℃;

[0117] (8) Kan (Kanamycin): 0.1g / mL stock solution, weigh 10g of kanamycin and dissolve it in water, make up to 100mL, filter and sterilize with a 0.22μm filter head, dispense and store at -20℃.

[0118] All the above culture media were adjusted to pH 5.8-6.0. Except for 2,4-D and Kinetin, which were added before sterilization, all other hormones (including STS and AS) were added before pouring the plates after the culture media had cooled to about 60°C.

[0119] The above detailed embodiments describe the implementation of the present invention; however, the present invention is not limited to the specific details described in the above embodiments. Within the scope of the claims and technical concept of the present invention, various simple modifications and changes can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

Claims

1. The application of the BnaWRKY25 gene or vectors, plasmids, and / or Agrobacterium containing the BnaWRKY25 gene in regulating plant growth, characterized in that, The nucleic acid sequence of the BnaWRKY25 gene is shown in SEQ ID NO:1; the regulation is to promote the increase of root length, leaf size, mesophyll cell number and / or IAOx content in the seedling stage of the plant, and the plant is Brassica napus.

2. A method for promoting the seedling growth of Brassica napus, characterized in that, To increase the expression level of the BnaWRKY25 gene in rapeseed, the nucleic acid sequence of the BnaWRKY25 gene is shown in SEQ ID NO:

1.

3. The method according to claim 2, characterized in that, The BnaWRKY25 overexpression vector was obtained through homologous recombination, and the BnaWRKY25 gene expression was initiated by the 35S promoter. The vector was then transferred into Brassica napus through Agrobacterium-mediated genetic transformation.

Citation Information

Patent Citations

  • Application and method of brassica napus BnaWRKY25.C04 gene

    CN116286876A