A SNP marker related to chicken four-week-old weight trait and application thereof

By resequencing and GWAS analysis of the weight records of four-week-old chickens in a hybrid population, a SNP marker at the GRCg6a 104 locus was discovered. This marker-assisted selection breeding was used to solve the problem of the lack of clear molecular markers in broiler breeding, enabling early, rapid, and low-cost prediction and improvement of chicken weight traits.

CN118813811BActive Publication Date: 2025-11-21CHINA AGRI UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202410839508.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-06-26
Publication Date
2025-11-21
Estimated Expiration
2044-06-26

AI Technical Summary

Technical Problem

Current molecular breeding methods for broilers lack clear and significant molecular markers, making it difficult to effectively improve the weight traits of chickens.

Method used

By resequencing and GWAS analysis of a hybrid population of 1208 chickens with recorded weight at four weeks of age, an SNP marker was found at the rs738912011 locus in GRCg6a 104 of the genome. The A allele of this marker is dominant in high-weight chickens and G is dominant in low-weight chickens. This marker was used for marker-assisted selection breeding.

Benefits of technology

It enables early, rapid, and low-cost prediction of chicken weight, improving the efficiency and economic value of chicken breed improvement.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118813811B_ABST
    Figure CN118813811B_ABST
Patent Text Reader

Abstract

The application discloses a SNP marker (chr1: 170522602, located on the upstream of a SETDB2 gene) related to a four-week-old weight trait of a chicken and an application thereof. Four-week-old weights of individuals of a chicken crossbreeding population are determined and recorded, 1208 chickens are sequenced by using resequencing technology, and further whole genome correlation analysis is carried out, so that a SNP (chr1: 170522602) site affecting the four-week-old weight is obtained. The SNP frequencies of the SNP site in low-weight chicken species and high-weight chicken species in resequencing are counted, and it is found that the SNP site has significant differences in the low-weight chicken species and the high-weight chicken species. In the high-weight chicken, A is a dominant allele, and in the low-weight chicken, G is a dominant allele. In the population with low weight, by selecting individuals with the A allele of the site, the weight of the breeding population can be improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular biology, specifically to a SNP marker associated with the weight trait of four-week-old chickens and its application. Background Technology

[0002] Chicken is one of the main meat varieties in China, characterized by high protein, low fat, and low cholesterol. In recent years, my country's chicken production has continued to grow, and improving muscle yield and chicken quality has been a long-term focus for breeding scientists. Classical breeding methods have made significant contributions to the improvement of agricultural animal production traits. With the continuous advancement of genomics work and the extensive development of genetic markers, breeding scientists can select chickens with good yield and quality characteristics for breeding based on specific genetic markers. These genetic markers can help breeding scientists more accurately assess and select chickens for genetic potential, accelerating the breeding process.

[0003] SNPs (Single Nucleotide Polymorphisms) are one of the most common forms of genetic variation in genetics. SNPs are characterized by their large quantity, high frequency, and low mutation rate, playing a crucial role in genetic research and molecular selection breeding. However, current molecular breeding practices for broiler chickens still lack molecular markers with clearly defined functions and significant effects. Therefore, identifying high-efficiency, accurate molecular markers is a current research focus. If we can find SNP molecular markers associated with target traits in chickens and ultimately elucidate the molecular mechanisms underlying these sites, it will greatly promote genetic improvement in chickens and bring breakthrough progress to the field of poultry breeding. Summary of the Invention

[0004] To address the shortcomings of existing technologies, this invention aims to provide a SNP marker associated with the weight trait of chickens at four weeks of age and its application. Using resequencing technology, individuals from a hybrid population of 1208 chickens with only four-week-old weight records were sequenced and subjected to GWAS analysis. This revealed a SNP locus significantly associated with four-week-old weight: rs738912011 (chr1:170522602) located at GRCg6a 104 in the genome. This locus contains three genotypes: AA, GG, and AG. The SNP frequencies of this locus were statistically analyzed in other low-weight and high-weight chicken breeds during resequencing. Significant differences in SNP frequency distribution were found between low-weight and high-weight breeds. In high-weight chickens, A was the dominant allele, while in low-weight chickens, G was the dominant allele. Since high-weight chickens have a higher weight than low-weight chickens, this SNP locus can be used as a molecular marker for the selection of superior chicken breeds. In a low-weight population, the population's weight can be increased by selecting individuals with allele A.

[0005] To solve the above-mentioned technical problems, the technical solution provided by the present invention is as follows:

[0006] A molecular marker of SNP associated with the body weight of chickens at four weeks of age.

[0007] The SNP molecular marker is located at chr1:170522602 in GRCg6a 104 of the genome; the alleles of the SNP locus are A and G;

[0008] The economic trait is body weight at four weeks of age. In high-weight chickens, A is the dominant allele, while in low-weight chickens, G is the dominant allele.

[0009] Preferred,

[0010] The SNP molecular marker is located at the 101st base in the nucleotide sequence shown in SEQ ID NO.1.

[0011] The application of the above-mentioned SNP molecular markers in the detection of weight traits in four-week-old chickens.

[0012] Preferably, it includes the following steps:

[0013] (1) Detect the genotype of the sample chickens at the SNP locus;

[0014] (2) Select sample chickens with A / A genotypes for breeding superior strains.

[0015] Preferred,

[0016] Step (1) can be performed by direct sequencing, or by first amplifying the gene fragment containing the SNP molecular marker and then detecting it. For example, primers can be designed to amplify the fragment containing the SNP molecular marker from the sequence shown in SEQ ID No. 1, and then the alleles at that site can be detected.

[0017] The application of the above-mentioned SNP molecular markers in marker-assisted selection breeding is characterized by selecting chicken breeds with the genotype A / A for breeding.

[0018] Primer pairs for amplifying molecular markers containing the above-mentioned SNPs are characterized in that the primer pair sequences are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0019] The beneficial effects of this invention are:

[0020] This invention enables early, rapid, low-cost, and effective prediction of chicken weight by detecting SNP molecular markers, and has broad application prospects in chicken breed improvement, and can achieve excellent economic value. Attached Figure Description

[0021] The accompanying drawings are provided to further illustrate the invention and form part of the specification. They are used in conjunction with embodiments of the invention to explain the invention and do not constitute a limitation thereof. In the drawings:

[0022] Figure 1 shows the Manhattan plot of GWAS results for chickens at four weeks of age. Detailed Implementation

[0023] The preferred embodiments of the present invention will be described below with reference to the accompanying drawings. It should be understood that the following embodiments are given for illustrative purposes only and are not intended to limit the scope of the present invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from its spirit and essence.

[0024] This invention provides an SNP marker (chr1:170522602, located at...) associated with the weight trait of chickens at four weeks of age. SETDB2 (Upstream of the gene) and its applications, the SNP molecular marker is located at chr1:170522602 of GRCg6a 104 in the genome, and the SNP molecular marker is located at the 101st base in the nucleotide sequence shown in SEQ ID NO.1; the alleles of the SNP site are A and G;

[0025] The economic trait is the weight of chickens at four weeks of age. In high-weight chickens, allele A is the dominant allele, while in low-weight chickens, allele G is the dominant allele. In a lower-weight population, selecting individuals with allele A can increase the chickens' weight.

[0026] SEQ ID NO.1(chr1:170522502-170522702)

[0027] gctttgatttaaaaaacacaaggcaaaacaacaacaaaaaaagaagctctggtacaacatataatacaactcctagtagtgg gaacaccgcaagttcactgtatctagaaatttgtctgctacatcttcatttaattaaaatattttgtgcacgtagtttgatctgcatg caaacccacaaacaaagcccataaaaacggt

[0028] Example 1: Genome-wide association analysis of body weight in four-week-old chickens

[0029] 1. Test materials

[0030] Using individuals from a hybrid chicken population as the research subject, the body weight of 1208 individuals was measured at four weeks of age, and the measurement was strictly carried out in accordance with the internal standards of the chicken farm.

[0031] 2. Test Methods

[0032] 2.1 Phenotypic determination

[0033] When the chickens reach four weeks of age, place each chicken on a weighing device and wait for the chickens to remain relatively calm and balanced. Then record the displayed weight value and sex.

[0034] 2.2 Chicken whole-genome SNP genotyping method based on resequencing technology

[0035] Sequencing data were aligned to the GRCg6a 104 reference genome using GTX Align, and SNP loci were detected using Basevar. STITCH was used to estimate the genotype probability of all individuals. For SNP loci obtained through genotyping, they were filtered based on MAF < 0.05, locus call rate < 0.95, and info score < 0.4, retaining a total of 7,901,521 high-quality SNPs.

[0036] The specific amplification steps were as follows: Blood tissue samples from the hybrid population were collected, and DNA was extracted using a total DNA extraction kit from Beijing Tiangen Biotech Co., Ltd. The extracted DNA concentration and purity were determined by measuring the OD values ​​(OD260 / OD280 and OD260 / OD230 ratios) using a NanoDrop 2000 spectrophotometer. DNA integrity was then assessed using agarose gel electrophoresis. Using the genome of the hybrid population samples as a template, primers were designed using Oligo7 software, and sequence amplification was performed using Novizan 2 × Taq Master Mix. The reaction system was as follows: 95℃, pre-denaturation for 3 min; 95℃, denaturation for 15 s, 60℃, annealing for 15 s, 72℃, extension for 15 s, 30 cycles; 72℃, complete extension for 5 min. Finally, agarose gel electrophoresis was used to determine the fragment size of the product.

[0037] Primer pair sequences for amplifying fragments containing the above SNP sites:

[0038] F:GCTTTGATTTAAAAAACACA (SEQ ID NO.2)

[0039] R: ACCGTTTTTATGGGCTTTGT (SEQ ID NO.3)

[0040] 2.3 Genome-wide association analysis

[0041] Genome-wide association analysis was performed on the body weight phenotype of 1208 four-week-old chickens using fastGWA.

[0042] 2.4 SNP sites significantly associated with body weight trait

[0043] Detection of significant loci at the genomic level, with significant loci identified based on FDR < 0.05.

[0044] 3. Results and Analysis

[0045] This invention uses 1208 chickens from a hybrid population as subjects. Using resequencing technology, 7,901,521 SNPs were obtained and GWAS analysis was performed on the four-week-old body weight of the chickens. A SNP (chr1:170522602) that was significantly associated with the four-week-old body weight of the chickens was identified, as shown in Figure 1.

[0046] Example 2: Frequency distribution of SNP (chr1: 170522602) in different chicken breeds

[0047] 1. Experimental Materials

[0048] Low-weight chicken breeds: Bearded chicken (n=15), Daweishan miniature chicken (n=33) and Tibetan chicken (n=154).

[0049] High-weight chicken breeds: Lingnan yellow-feathered broiler (n=16), white-feathered broiler (n=20), Kobo chicken (n=33) and recessive white-feathered chicken (n=113).

[0050] 2. Experimental Methods

[0051] 2.1 Data Collection

[0052] The whole-genome resequencing data from the above three low-weight chicken breeds and four high-weight chicken breeds were downloaded from the NCBI SRA database (https: / / ncbi.nlm.nih.gov / sra).

[0053] 2.2 SNP typing using GATK

[0054] The above resequencing samples were constructed into gVCFs based on the GRCg6a104 reference genome using the GTX server gtx wgs command. Then, the gtx gi and gtx joint commands were used to perform joint variant detection on all gVCF samples and obtain genotype VCF files.

[0055] 2.3 SNP Filtration and Quality Control

[0056] After the combined variant detection was completed, SNPs were extracted using the SelectVariants tool in the GATK software package. Subsequently, the whole genome resequencing data were quality controlled using the VariantFiltration tool in the GATK software package according to the following hard filtering parameters: MQ < 40.0, FS > 60.0, SOR > 3.0, MQRankSum < -12.5, ReadPosRankSum < -8.0, QUAL < 30. After the above quality control, a total of 44,272,587 resequencing SNPs were obtained.

[0057] 2.4 Calculate the allele frequency of chr1:170522602 in different chicken breeds.

[0058] The allele frequencies of chr1:170522602 in different chicken breeds were calculated using vcftools --freq2.

[0059] 3 Results and Analysis

[0060] The SNP frequency distribution of SNP (chr1: 170522602) in different low-weight and high-weight chicken breeds is shown in Table 1. Significant differences exist between the two breeds. In high-weight chickens, A is the dominant allele, while in low-weight chickens, G is the dominant allele.

[0061] Table 1. SNP frequencies (chr1:170522602) in different low-weight and high-weight chicken breeds.

[0062] ;

[0063] Analysis revealed a SNP molecular marker (chr1:170522602) associated with the weight trait of chickens at four weeks of age. In a low-weight population, breeding individuals with alleles A / A could increase the weight of the breeding population.

[0064] The contents not described in detail in this specification are existing technologies known to those skilled in the art.

[0065] Finally, it should be noted that the above descriptions are merely preferred embodiments of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. An application of an SNP molecular marker in the detection of body weight traits in four-week-old chickens, characterized in that, The SNP molecular marker is located at chr1:170522602 in the GRCg6a genome; The alleles for the SNP locus are A and G.

2. The application according to claim 1, characterized in that, Includes the following steps: (1) Detect the genotype of the sample chickens at the SNP locus; (2) Select sample chickens with A / A genotypes for breeding superior strains.

3. The application according to claim 2, characterized in that, Step (1) can be performed by direct sequencing or by first amplifying the gene fragment containing the SNP molecular marker and then detecting it.

Citation Information

Patent Citations

  • Haplotype molecular marker related to chicken weight traits and application

    CN110951889A