A molecular marker for identifying the body weight of Zhongwei goats and its application

Abstract

The present invention belongs to the technical field of genetic breeding, and specifically relates to a molecular marker for identifying the weight of a Zhongwei goat and an application thereof. The molecular marker comprises a site one, and the site one is located at the 101bp of the nucleotide sequence shown in SEQ ID NO.1, where a mutation from C to T occurs in the base. The present invention provides a SNP site that affects the weight of a Zhongwei goat, and the weight of offspring can be increased by selecting an individual with a CC genotype as a father or a mother.

Description

Technical Field

[0001] The invention relates to the technical field of genetic breeding, and in particular to a molecular marker for identifying the weight of Zhongwei goats and an application thereof. Background Art

[0002] Zhongwei goats are a breed known for producing white fur. Over the past 30 years, shifts in livestock industry demand and changing breeding conditions have reduced the core population of Zhongwei goats to fewer than 5,000 individuals. The small number of goats in the core production areas, low reproductive rates, and the deterioration of excellent genetic traits have become challenges in preserving this breed's genetic resources. Zhongwei goats offer exceptionally high-quality cashmere and wool, and their fur is pure white, lustrous, and neatly curved, with beautiful spikes. Furthermore, Zhongwei goat meat boasts a delicate texture, evenly distributed fat, no mutton smell, a high lean meat percentage, and a delicious flavor, making it a popular choice among consumers. Therefore, increasing the growth rate of Zhongwei goats and breeding them for heavier weight are pressing challenges in their conservation efforts. As weight is a key growth trait, identifying molecular markers influencing weight in Zhongwei goats at the genomic level is crucial. Summary of the Invention

[0003] In order to solve the above technical problems, the present invention provides a molecular marker for identifying the weight of Zhongwei goats and its application.

[0004] A molecular marker for identifying the body weight of Zhongwei goats, the molecule comprising site 1;

[0005] The first site is located at the 101st bp of the nucleotide sequence shown in SEQ ID NO. 1, where the base undergoes a C to T mutation;

[0006] SEQ ID NO.1 is specifically: ATGGCATCACTGACTCAATGGACATGAGTCTG GGTGAACTCCGGGAGTTGGTGATGGACAGGGAGGCCTGGCATGTTGCAA TTCATGGAGTCGCAAAGAGT[C / T]AGACACGACTGAGTGACTGAACTGAA CTGAACTGAACAACTTTGAGAATGCTCCTGATGAGGGCTCAAGAGGACCTGCGAAACATGCCATTGGAAACTGA, which shows the sequences of 100 bp upstream and downstream of the mutation site, wherein C in [C / T] is the mutation site, T is the site after mutation, and [C / T] is represented by "N".

[0007] The molecular marker is used to identify the body weight of Zhongwei goats.

[0008] Preferably, the site 1 on chromosome 1 of Zhongwei goats is detected, and a mutation from C to T at the site 1 results in a Zhongwei goat with a large body weight.

[0009] The molecular marker is used in screening Zhongwei goats with large body weight.

[0010] Preferably, the Zhongwei goats selected in which the mutation from C to T occurs at the first site are heavy-weight Zhongwei goats.

[0011] The application of the molecular marker in the genetic breeding of Zhongwei goats.

[0012] Preferably, the mutation from C to T at site 1 results in a Zhongwei goat with a large body weight.

[0013] A genetic method for producing large-weight Zhongwei goats, which increases the weight of offspring by selecting individuals with the genotype of TT at locus 1.

[0014] Compared with the prior art, the present invention has the following beneficial effects:

[0015] The present invention provides a SNP site that affects the weight of Zhongwei goats. By selecting a CC genotype individual as the father or mother, the weight of the offspring can be increased. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Figure 2 is the variation characteristics of the Zhongwei goat population, where a is the genome-wide distribution of detected variants on 29 chromosomes of the Zhongwei goat, with the X-axis representing the 29 autosomes and the Y-axis representing the number of variants; b is the genome-wide annotation of genetic variation in the Zhongwei goat, with the X-axis representing various functional regions and the Y-axis representing the number of genetic variants within different functional regions; c is the statistical result of the variant functional annotation in the CDS region, with the X-axis representing various functions and the Y-axis representing the number of genetic variants within each function;

[0017] Figure 2 For principal component analysis plots, the first three explained variance percentages PC1, PC2, and PC3 are used as X, Y, and Z axes;

[0018] Figure 3 The figure shows the distribution of SNPs in a 1Mb window of chromosome after quality control. The left Y-axis indicates the chromosome name, and the upper X-axis indicates the window size.

[0019] Figure 4 Manhattan plots and QQ-plots show the GWAS results and statistical results of the 40-day-old body weight of Zhongwei goats. Genome-wide significant SNPs are shown in red. A is the GWAS result, and B is the statistical result.

[0020] Figure 5Manhattan Plots and QQ-plots show the GWAS results and statistical results of the body weight of Zhongwei goats at 6 months of age. Genome-wide significant SNPs are shown in red. Among them, A is the GWAS result and B is the statistical result. DETAILED DESCRIPTION

[0021] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited by the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention. The experimental methods described in the embodiments of the present invention are all conventional methods unless otherwise specified.

[0022] Example 1

[0023] Source of experimental animals and phenotypes:

[0024] All goats in this study were obtained from the Zhongwei Goat Breeding Farm in Ningxia Hui Autonomous Region. Phenotypes for body weight at 40 days of age and 6 months of age were recorded (Table 1). Ear tissue samples were collected from 240 Zhongwei goats. All samples were immediately stored in liquid nitrogen after collection and transported to the laboratory for long-term storage at -80°C.

[0025] Table 1 Description of body weight traits of Zhongwei goats

[0026] Traits describe Measuring equipment weight Live weight of the sheep in the morning on an empty stomach, expressed in kilograms (kg) scales

[0027] 1. Genomic DNA Extraction and Quality Inspection

[0028] DNA was extracted from ear tissue samples using the phenol-chloroform method. A NanoDrop 2000 spectrophotometer was used to measure DNA concentration, the absorption wavelength ratio of the highest absorption peaks of nucleic acids, proteins, and phenolic substances at 260 nm / 280 nm, and the absorption wavelength ratio of the highest absorption peak of carbohydrates at 260 nm / 230 nm. DNA quality was evaluated using 1% agarose gel.

[0029] 2. Library Construction and Sequencing

[0030] After processing, qualified genomic DNA samples were randomly fragmented into 350bp fragments using a Covaris ultrasonic disruptor. The DNA fragments were then subjected to end-repair, poly A addition, sequencing adapters, purification, and PCR amplification to complete library preparation. After library construction, preliminary quantification was performed using Qubit 2.0, and the effective concentration of the library was accurately quantified using qPCR to ensure library quality. After passing the library quality test, sequencing was performed using the BGI-T7 sequencing platform in PE150 mode.

[0031] 3. Identification, screening and annotation of variant sites

[0032] Fastp software version V0.20.0 was used to filter the raw reads data into clean reads data, and a genome index was established for the reference genome. The quality-controlled clean reads data were aligned with the goat reference genome ARS1, GCF_001704415.1, using Burrows-WheelerAligner software version V0.7.17. The aligned sam files were converted into bam files and sorted using SAMtools software version V1.8-20. The MarkDuplicates program in the GenomeAnalysis Toolkit software version V3.8 was used to remove duplicate data from the sorted bam files to obtain the final bam files. The final bam files were indexed, and the HaplotypeCaller module in the GATK software was used for SNP variation detection. After obtaining the vcf file, it was filtered using the VariantFiltration module. The ANNOVAR software package is used to perform functional annotation on the detected gene variants. Based on the position of the variant site on the reference genome and the gene position information on the reference genome, the region where the variant site occurs in the genome, including intergenic regions, intron regions or CDS regions, as well as the impact of the variant, can be obtained.

[0033] Whole genome resequencing was performed on 240 individuals of Zhongwei goat to establish a genotype database, generating a total of 20370.47Gb of raw reads. After variant detection and strict quality control, a total of 2,780,588,176 SNPs were identified in the Zhongwei goat population, such as Figure 1 Then, all detected variants of Zhongwei goat were annotated using the gene annotation file downloaded from the Ensembl database. It was found that the most variants were found in the intergenic regions and intronic regions, accounting for 99.07% and 0.82% respectively, as shown in Figure 1. Figure 1As shown in b, only 0.02% of them are located in coding regions, including 300,044 synonymous mutations and 283,664 non-synonymous mutations. Figure 1 These potential functional variants provide valuable genetic resources for exploring the genetic structure and functional genes of Zhongwei goats.

[0034] 4. Data Quality Control and Population Stratification Correction

[0035] The obtained genotyping data were quality controlled using Plink V1.90 software, and individuals with genotype detection rates < 98%, SNPs with detection rates < 98%, SNPs with minimum allele frequencies < 5%, and those with Hardy-Weinberg equilibrium test P values ​​< 10 were excluded. -6 The first three principal components were calculated using the "-pca 3" parameter of Plink V1.90 software and used as covariates to correct the population stratification phenomenon of Zhongwei goats. The PCA diagram was drawn using R language V3.6.0. The results are shown in the figure below. Figure 2 As shown, there is population stratification in the experimental samples and the genetic correlation between individuals is high. The first three principal components need to be used as covariates to correct the population stratification phenomenon of Zhongwei goats.

[0036] A total of 28,353,421 SNPs were included in the quality control, and were filtered by SNP detection rate, Hardy-Weinberg equilibrium, minimum allele frequency, and individual detection rate. The filtering conditions were -geno 0.02, -maf 0.05, and -hwe 1e -6 , -mind 0.1. A total of 15,958,716 SNPs were obtained for subsequent analysis. These sites were evenly distributed on the 29 pairs of autosomes of goats. Figure 3 shown.

[0037] 5. Genome-wide association analysis

[0038] The association analysis between SNP and body weight was performed using the fastGWA-mlm model in GCTAV1.94.0beta software.

[0039] y=X snp β snp +X c β c +g+e

[0040] where y is an n×1 phenotype vector; X snp is the genotype vector, whose effect is β snp ;X c is the correlation matrix with fixed covariates, including gender and the first three PCAs. Its corresponding coefficient is β c; g is the vector of total genetic effects captured by the SNP-derived genetic relationship matrix; π is the SNP-derived GRM vector with all off-diagonal elements set to 0; e is the residual vector.

[0041] Because the Bonferroni correction method is too strict to determine the significance threshold of GWAS, the threshold of genome-wide significant association in this study was adjusted to P = 1 × 10 -6 The genomic expansion factor λ of the test statistic was calculated by the slope of the linear regression between the observed quantile and the theoretical quantile in R language V3.6.0. The λ value of the weight trait at 40 days of age was calculated to be 1.063, and the λ value of the weight trait at 6 months of age was 1.049, indicating that there was no genomic expansion. Based on the resequencing data of 240 Zhongwei, 147 significant SNP sites associated with the weight trait at 40 days of age were detected. These sites were located on chromosomes 1, 5, 13, 17, 19, 20, and 26, as shown in Tables 2 and 3. Figure 4 As shown in Table 3 and Table 4, 32 significant SNP sites associated with weight traits at 6 months of age were detected, which were located on chromosomes 1, 2, 6, 10, and 21, respectively. Figure 5 shown.

[0042] Table 2 Significant SNPs associated with body weight at 40 days of age

[0043]

[0044]

[0045]

[0046] Table 3 Significant SNPs associated with weight at 6 months of age

[0047]

[0048]

[0049] VI. SNPs Affecting Height, Length, and Chest Girth in Zhongwei Goats

[0050] Further research on SNPs that reached the genome-wide significance level revealed that the C→T mutation at position 25286476 on chromosome 1 of the Zhongwei goat genome can significantly affect the weight trait of the Zhongwei goat.

[0051] The association analysis between the SNP locus 25286476 on chromosome 1 of the Zhongwei goat genome and body weight traits is as follows:

[0052] Table 4 Polymorphism at position 25286476 on chromosome 1 of the Zhongwei goat genome

[0053] Number of individuals genotype Body weight at 40 days (kg) Weight at 6 months (kg) 45 CC <![CDATA[6.3278 a ]]> <![CDATA[14.6778 a ]]> 123 CT <![CDATA[5.8687 b ]]> <![CDATA[13.2927 b ]]> 72 TT <![CDATA[5.4958 b ]]> <![CDATA[12.6528 b ]]>

[0054] Note: Different letters indicate significant differences, p < 0.05; the same letter indicates no significant differences, p > 0.05.

[0055] As shown in Table 4, the individuals with CC genotype have the largest weight, while the individuals with TT genotype have the smallest weight.

[0056] In the genome-wide association analysis using a mixed linear model, the SNP molecular marker at position 25286476 on chromosome 1 of the Zhongwei goat genome reached a genome-wide significant level, indicating that the marker was significantly associated with the weight trait of the Zhongwei goat.

[0057] Table 5 SNP gene frequency and genotype frequency at position 25286476 on chromosome 1 of the Zhongwei goat genome

[0058]

[0059] Further research on SNPs that reached the genome-wide significance level revealed that the C→T mutation at position 25286476 on chromosome 1 of the Zhongwei goat genome can significantly affect the weight trait of the Zhongwei goat.

[0060] It can be seen from this that the C→T mutation at position 25286476 on chromosome 1 of the Zhongwei goat genome can be used to select a large-weight Zhongwei goat breed, and by selecting individuals with the CC genotype as the father or mother, the weight of the offspring can be increased.

[0061] It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that the two endpoints of each numerical range and any numerical value between the two endpoints can be selected. In order to avoid redundancy, the present invention describes preferred embodiments.

[0062] Although the preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0063] Obviously, those skilled in the art may make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if such changes and modifications fall within the scope of the claims and their equivalents, the present invention is intended to include such changes and modifications.

Claims

1. The application of molecular markers in identifying the body weight of Zhongwei goats is characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1; when the 102 bp of the nucleotide sequence shown in SEQ ID NO.1 is C, the weight of the Zhongwei goat is greater than when the 102 bp of the nucleotide sequence shown in SEQ ID NO.1 is T.

2. The application of molecular markers in screening Zhongwei goats with large body weight is characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1; when the 102 bp of the nucleotide sequence shown in SEQ ID NO.1 is C, the weight of the Zhongwei goat is greater than when the 102 bp of the nucleotide sequence shown in SEQ ID NO.1 is T.

3. A genetic breeding method for heavy-weight Zhongwei goats, characterized in that: By selecting individuals with the genotype CC at the 102 bp of the nucleotide sequence shown in SEQ ID NO.1 as parents, the weight of offspring can be increased.

Images