A low-temperature-resistant heterotrophic nitrification aerobic denitrification strain and its application

Abstract

The present invention specifically discloses a strain of low-temperature resistant heterotrophic nitrification aerobic denitrification bacterial strain and its application. The strain name is Klebsiella pneumoniae (Klebsiella pneumoniae) TYF-CJJ-P06, which is preserved in the General Microbiological Center (CGMCC) of China Microorganism Culture Collection Administration Committee, and the preservation name is TYF-CJJ-P06, and its preservation number is: CGMCC NO.29832, classified and named as Klebsiella pneumoniae, and the preservation date is January 17, 2024, and the preservation address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, China, Postal Code: 100101. The strain is a strain of heterotrophic nitrification-aerobic denitrifying bacteria, which can efficiently remove the inorganic nitrogen pollution in the water body, and still has good denitrification performance under low temperature stress, is strong to low temperature tolerance, and has greater potential in the application of inorganic nitrogen pollution control in the various water bodies such as medium and high concentration domestic sewage, livestock and poultry breeding wastewater or industrial organic wastewater in cold areas of China.

Description

Technical Field

[0001] The invention belongs to the technical field of microbial denitrification, and particularly relates to a low-temperature-resistant heterotrophic nitrification aerobic denitrification bacterial strain and its application in wastewater denitrification. Background Art

[0002] Nitrogen pollution in my country's waters is a complex and pressing environmental issue. With the acceleration of industrialization and urbanization, as well as the impact of agricultural activities, large amounts of nitrogen are entering water bodies through industrial wastewater, domestic sewage, and agricultural non-point source pollution, leading to a widespread increase in nitrogen levels in water bodies. This nitrogen pollution primarily manifests itself in the forms of ammonia nitrogen, nitrite nitrogen, and nitrate nitrogen. These are among the main causes of eutrophication in water bodies, triggering ecological problems such as algal blooms and excessive algae growth. In severe cases, they can also lead to hypoxia in water bodies, compromising water quality and the health of aquatic ecosystems.

[0003] Nitrogen pollution in water bodies mainly comes from two sources: human and natural. Natural sources refer to the degradation and utilization of nitrogen-containing substances by microorganisms themselves, lightning effects, and biological nitrogen fixation. Compared with human sources, natural sources produce less. Under the stable self-purification ability of the environment itself, the nitrogen in the water body is basically in a state of equilibrium and will not cause a large accumulation of nitrogen. Human sources are the discharge of nitrogen-containing wastewater into water bodies when humans carry out social activities for the purpose of production and life. They mainly include industrial, agricultural and domestic sewage. Industrial wastewater such as food brewing wastewater, coking wastewater, and printing and dyeing wastewater not only faces high nitrogen concentration and high organic load, but also has problems such as complex water quality, large pH changes, and high content of toxic pollutants.

[0004] Winters are long in most parts of northern my country, and water temperatures often fall below 15°C. Low temperatures significantly inhibit microbial denitrification activity, resulting in poor effluent quality at sewage treatment plants and difficulty meeting effluent standards. The optimal temperature for most denitrifying microbial strains or denitrification processes is in the mesophilic range (20-35°C), and resources for nitrifying and denitrifying microbial strains that can tolerate low temperatures (below 20°C) are still relatively scarce. Therefore, screening for strains that exhibit high denitrification performance even under low-temperature conditions is particularly important. Summary of the Invention

[0005] The present invention aims to solve the problem that current sewage biological denitrification technology has poor effect at low temperatures and low-temperature bacterial resources are insufficient, and aims to provide Klebsiella pneumoniae TYF-CJJ-P06 and its application in removing inorganic nitrogen pollution in water under low-temperature conditions.

[0006] In order to achieve the above-mentioned invention objectives, this application provides the following technical solutions:

[0007] First aspect:

[0008] The present application provides a low-temperature resistant heterotrophic nitrification-aerobic denitrifying bacterium (Klebsiella pneumoniae), the strain being Klebsiella pneumoniae (Klebsiella pneumoniae) TYF-CJJ-P06, which is deposited in the General Microbiology Center of the China Culture Collection Administration of Microorganisms, with a deposit number of CGMCC NO.29832 and a deposit date of January 17, 2024.

[0009] Preferably, the low-temperature resistant heterotrophic nitrification-aerobic denitrifying bacteria (Klebsiella pneumoniae) is used in sewage denitrification.

[0010] Preferably, the Klebsiella pneumoniae TYF-CJJ-P06 can efficiently remove one or a combination of ammonia nitrogen and nitrate nitrogen under low temperature conditions.

[0011] Preferably, the Klebsiella pneumoniae TYF-CJJ-P06 is capable of converting ammonia nitrogen and nitrate nitrogen into gaseous nitrogen under low temperature conditions;

[0012] Within 48 hours, NH4 + -N removal efficiency reached 95.58%, NH4 + The average removal rate of -N in 0 to 24 hours is 3.40 mg / L / h; - The removal rate of -N reached 93.08%;

[0013] Preferably, the microbial agent is prepared by fermentation of Klebsiella pneumoniae TYF-CJJ-P06.

[0014] Preferably, the preparation method of the microbial agent specifically comprises the following steps: inoculating Klebsiella pneumoniae TYF-CJJ-P06 into a nitrification medium, then placing it in a shaker at 30°C for activation, and after it grows to the logarithmic phase, inoculating 5% of the activated bacterial liquid by volume into 100 mL of nitrification medium and culturing for 48 hours at 30°C and 120r / min.

[0015] The present invention also provides an application of the above-mentioned denitrifying bacterial agent in denitrification in a water environment.

[0016] Preferably, the denitrifying bacterial agent can efficiently remove ammonia nitrogen, nitrate nitrogen or total nitrogen under low temperature conditions;

[0017] Wherein, the denitrifying bacteria agent can convert ammonia nitrogen and nitrate nitrogen into gaseous nitrogen;

[0018] The specific application method is: add the microbial agent to the water environment to be treated at an inoculum rate of 0.8-20% (v / v), and the water temperature is 5-35°C, thereby removing inorganic nitrogen pollutants in the water. The positive effects of the present invention are:

[0019] (1) The Klebsiella pneumoniae TYF-CJJ-P06 strain of the present invention can grow using ammonia nitrogen and nitrate nitrogen as the sole nitrogen source, respectively, and can achieve the simultaneous removal of ammonia nitrogen and nitrate nitrogen with high removal efficiency;

[0020] (2) The strain of the present invention still maintains good denitrification activity at low temperatures and can be used for sewage denitrification treatment in geographical areas in northern my country where the annual average temperature difference varies greatly;

[0021] (3) The culture medium components required for the activation and expansion of the strain of the present invention are simple, and the bacterial liquid preparation process is relatively easy, which is conducive to industrial production and subsequent applications. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the following is a brief introduction to the drawings required for use in the embodiments. It should be understood that the following drawings only show certain embodiments of the present application and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other relevant drawings can be obtained based on these drawings without creative work.

[0023] Figure 1 This is the phylogenetic tree of Klebsiella pneumoniae TYF-CJJ-P06;

[0024] Figure 2 This is a morphological characterization diagram of Klebsiella pneumoniae TYF-CJJ-P06;

[0025] Figure 3 This is the agarose gel electrophoresis diagram of the amplified product of 16S rDNA gene of Klebsiella pneumoniae TYF-CJJ-P06;

[0026] Figure 4 Schematic diagram of the denitrification performance of Klebsiella pneumoniae TYF-CJJ-P06 at low temperature (10°C) when ammonia nitrogen is used as the only nitrogen source;

[0027] Figure 5 Schematic diagram of the denitrification performance of Klebsiella pneumoniae TYF-CJJ-P06 at low temperature (10°C) with nitrate nitrogen as the sole nitrogen source, and a growth curve of the strain;

[0028] Figure 6Schematic diagram of the denitrification performance of Klebsiella pneumoniae TYF-CJJ-P06 at low temperature (10℃) using ammonia nitrogen and nitrate nitrogen as a mixed nitrogen source. DETAILED DESCRIPTION

[0029] The present application will be further described below in conjunction with specific embodiments. The following description is merely a few embodiments of the present application and does not limit the present application in any form. Although the present application discloses the preferred embodiments below, it is not intended to limit the present application. Any person skilled in the art who, without departing from the scope of the technical solution of the present application, makes slight changes or modifications using the above disclosed technical content is equivalent to an equivalent implementation case and falls within the scope of the technical solution.

[0030] Unless otherwise specified, the raw materials in the examples of this application were purchased from commercial channels and used directly without any special treatment.

[0031] Unless otherwise specified, the analytical methods in the examples all adopt conventional settings and conventional analytical methods of instruments or equipment.

[0032] Example 1

[0033] (1) Source of strain:

[0034] The strains screened by the laboratory were derived from activated sludge in the aerobic pool of Qingxu Hongbo Wastewater Treatment Plant and water samples collected from Fenhe Wetland.

[0035] (2) Culture medium:

[0036] Beef extract peptone medium: beef extract 5 g / L, peptone 10 g / L, NaCl 5 g / L, pH 7.0±0.2.

[0037] Denitrification medium: C6H5Na3O7·2H2O 5.719 g / L, KNO3 0.722 g / L, K2HPO4 0.200 g / L, MgSO4·7H2O 0.050 g / L, MnSO4·4H2O 0.010 g / L, FeSO4 0.010 g / L, NaCl 0.120 g / L, pH 7.0±0.2.

[0038] Nitrification medium: C6H5Na3O7·2H2O 5.719 g / L, (NH4)2SO4 0.472 g / L, K2HPO4 0.200 g / L, MgSO4·7H2O 0.050 g / L, MnSO4·4H2O 0.010 g / L, FeSO4 0.010 g / L, NaCl 0.120 g / L, pH 7.0±0.2.

[0039] Mixed culture medium: C6H5Na3O7·2H2O 5.719 g / L, NH4NO3 0.571 g / L, K2HPO4 0.200 g / L, MgSO4·7H2O 0.050 g / L, MnSO4·4H2O 0.010 g / L, FeSO4 0.010 g / L, NaCl 0.120 g / L, pH 7.0±0.2.

[0040] Solid culture medium is based on the above culture medium with 2%-2.5% agar added. All culture media need to be sterilized under high pressure at 121°C for 30 minutes before use, and cooled to room temperature before subsequent experiments.

[0041] (3) Main experimental instruments:

[0042] Constant temperature biochemical incubator, high-speed refrigerated centrifuge, constant temperature shaker, clean bench, vertical pressure steam sterilizer, full wavelength microplate reader, PCR instrument, electrophoresis instrument, etc.

[0043] Example 1: Screening of Klebsiella pneumoniae TYF-CJJ-P06.

[0044] (1) Enrichment of bacterial strains

[0045] 10 mL of each of the retrieved activated sludge and river water samples were inoculated into a conical flask containing 90 mL of sterilized beef extract peptone culture medium and cultured at 120 r / min and 30°C for 5 days.

[0046] (2) Isolation and preservation of bacterial strains

[0047] In a clean bench, the enriched culture fluid was diluted with sterile water in a gradient manner and spread onto a nitrification solid medium. After standing for 30 minutes, the plate was inverted and incubated in a 30°C incubator for at least 24 hours. Single colonies with different morphological characteristics were selected and inoculated into the nitrification liquid medium. After incubation at 120 rpm and 30°C for 24 hours, the plates were streaked and purified. After repeating this three times, the resulting single colonies were inoculated into the nitrification liquid medium and incubated under the same conditions for 24 hours. The resulting colonies were then inoculated into a paraffin slant culture medium and stored in a refrigerator at 4°C. Simultaneously, 500 μL of the bacterial culture was mixed with 50% glycerol in a 1:1 ratio and stored frozen at -80°C. The NH4+-N content in the culture fluid was measured to further screen for strains that could efficiently degrade ammonia nitrogen for further experiments.

[0048] (3) Rescreening of strains under low temperature conditions

[0049] The original culture medium was inoculated with 5% of the inoculum in the nitrification culture medium and the denitrification culture medium respectively. The initial concentration was adjusted to the same bacterial solution and sludge sample. The blank culture medium plus sludge was used as a control. The culture was carried out at 10 ° C and 120 r / min for 48 hours. The concentrations of NH4+-N and NO3--N were measured every 12 hours. Three parallel samples were set for each group. The strain TYF-CJJ-P06 with the best denitrification effect was finally determined as the target strain. Its colony morphology on the solid culture medium is as follows: Figure 2 shown.

[0050] Example 2

[0051] Molecular biological identification of strains

[0052] The purified strain was inoculated into the basal culture medium, cultured at 120 r / min and 30°C for more than 12 h, and the bacterial liquid was used as a template. The universal primer pair 27F / 1492R (upstream primer 27F: 5'AGAGTTTGATCCTGGCTCAG 3', downstream primer 1492R: 5TACGGCTACCTTGTACGACTT 3') was selected. The reaction conditions for PCR amplification were pre-denaturation at 95°C for 5 min, denaturation at 94°C for 30 s, annealing at 57°C for 30 s, and extension at 72°C for 90 s. The cycle was repeated 30 times starting from the second step, and then extended at 72°C for 5-10 min. Finally, the primers were stored at 4°C for 15 min.

[0053] The PCR amplification products were subjected to agarose gel electrophoresis. The results of agarose gel electrophoresis showed that the amplification product band at about 1500 bp was bright and there were no other mixed bands, such as Figure 3 shown.

[0054] The 16S rDNA product obtained by PCR amplification was commissioned to Sangon Biotech Co., Ltd. for first generation sequencing. The sequencing result is shown in SEQ ID NO.1. The obtained sequence was submitted to the NCBI website and compared with the strain data already in the GenBank database. BLAST (http: / / www.ncbi.nlm.nih.gov / blast / ) was then used to search for strains with high similarity. The homology between the strain and Klebsiella pneumoniae strain DSM 30104 was as high as 99%. MEGA11.0 software was then used to select the Neighbor Joining method to construct a phylogenetic tree, as shown in FIG. Figure 1 The strains were further analyzed for genus and species as shown.

[0055] Example 3

[0056] Denitrification performance test of Klebsiella pneumoniae TYF-CJJ-P06 at low temperature (10℃) with ammonia nitrogen as the only nitrogen source

[0057] The TYF-CJJ-P06 strain stored in a -80°C refrigerator in Example 1 was inoculated into a nitrification medium and then placed in a shaker at 30°C for activation. After it grew to the logarithmic phase, 5% of the activated bacterial solution was inoculated into 100 mL of NH4 + The strains were cultured in simulated wastewater with 100 mg / L of nitrifying agent N as the sole nitrogen source for 48 h at 10°C and 120 rpm. Samples were taken at 0, 12, 24, 36, and 48 h, and the heterotrophic nitrification performance of the strains was tested after centrifugation. The simulated wastewater formulation was consistent with the nitrification medium formulation described previously. The potential product NO3 produced during the degradation process was also detected. - -N and NO2 - -N content. Among them, NH4 + -N content was determined by Nessler's reagent spectrophotometry, which was used to test NO3 - -N content is tested by UV spectrophotometry to determine NO2 - The method used for -N content is N-(1-naphthyl)-ethylenediamine spectrophotometry.

[0058] like Figure 4 As shown, at 24h, the strain was sensitive to NH4 + -N removal efficiency reached 80.09% and NH4 + The removal efficiency of -N reached 95.58%, and the average removal rate from 0 to 24 hours was 3.40 mg / L / h.

[0059] When (NH4)2SO4 is used as the sole nitrogen source in the culture medium, the strain can effectively reduce the concentration of ammonia nitrogen, and there is basically no accumulation of nitrate nitrogen and nitrite nitrogen.

[0060] Example 4

[0061] Denitrification performance test of Klebsiella pneumoniae TYF-CJJ-P06 using nitrate as the only nitrogen source at low temperature (10℃)

[0062] The TYF-CJJ-P06 strain stored in a -80°C refrigerator in Example 1 was inoculated into a nitrification medium and then placed in a shaker at 30°C for activation. After it grew to the logarithmic phase, 5% of the activated bacterial solution was inoculated into 100 mL of NO3 -The strains were cultured in simulated wastewater with 100 mg / L of nitrate as the sole nitrogen source at a concentration of 100 mg / L for 48 h at 10°C and 120 rpm. Samples were taken at 0, 12, 24, 36, and 48 h, and the aerobic nitrification performance of the strains was tested after centrifugation. The simulated wastewater formulation was consistent with the denitrification medium formulation described previously. The possible NO2 degradation product was also detected. - -N content and OD 600 The value of NO3 - -N content is tested by UV spectrophotometry to determine NO2 - -N content was determined by N-(1-naphthyl)-ethylenediamine spectrophotometry, OD 600 The measurement method is to measure its absorbance at a wavelength of 600 nm using a full-wavelength microplate reader.

[0063] like Figure 5 As shown, the strain was in the adaptation stage from 0 to 12 h and grew slowly, while the strain grew rapidly from 12 to 36 h. The OD value of the strain at 36 h was 600 It reached 0.849 and decreased slightly at 48h.

[0064] like Figure 5 As shown, the strain was sensitive to NO3 at 24h. - -N removal efficiency reached 45.09% and NO3 - -N removal efficiency reached 92.15%. - -N degradation without NH4 + -N degrades quickly, but can still effectively degrade NO3 - -N. In addition, the strain is effective in removing NO3 - -N process basically does not produce NO2 - -N accumulation, indicating that NO3 - -N can be quickly converted into gas, thus achieving efficient denitrification.

[0065] Example 5

[0066] Denitrification test of Klebsiella pneumoniae TYF-CJJ-P06 at low temperature (10℃) using ammonia nitrogen and nitrate nitrogen as mixed nitrogen sources

[0067] The TYF-CJJ-P06 strain stored in a -80°C refrigerator in Example 1 was inoculated into a nitrification medium and then placed in a shaker at 30°C for activation. After it grew to the logarithmic phase, 5% of the activated bacterial solution was inoculated into 100 mL of NH4 + -N (concentration of 50 mg / L) and NO3 --N (concentration of 50 mg / L) was used as a mixed nitrogen source in simulated wastewater and cultured for 48 hours at 10°C and 120 r / min. Samples were taken at 0, 12, 24, 36, and 48 hours, and the supernatant was obtained after centrifugation and NH4 was measured. + -N, NO3 - -N and NO2 - -N concentration. The simulated wastewater formula is consistent with the mixed culture medium formula described above. Test NH4 + -N content was determined by Nessler's reagent spectrophotometry, which was used to test NO3 - -N content is tested by UV spectrophotometry to determine NO2 - The method used for -N content is N-(1-naphthyl)-ethylenediamine spectrophotometry.

[0068] like Figure 6 As shown, NH4 + -N, NO3 - When -N exists at the same time and the content is the same, the NH4 + -N content decreased rapidly, and the degradation rate reached 93.58%, while NO3 - -N was only consumed in small amounts, with a degradation rate of only 37.37%. After 24 hours, NH4 + -N has been basically consumed, NO3 - -N content began to decrease rapidly. At 48h, NO3 - -N removal rate reached 93.08%, therefore, in NH4 + -N, NO3 - In the presence of -N, strain TYF-CJJ-P06 preferentially utilizes NH4 + -N, and then use NO3 - -N, in addition, during the degradation process, NO2 - -N No obvious accumulation.

[0069] The above descriptions are merely a few embodiments of the present application and do not constitute any form of limitation to the present application. Although the present application discloses the preferred embodiments as above, they are not intended to limit the present application. Any technical personnel familiar with the present profession, without departing from the scope of the technical solution of the present application, using the technical content disclosed above to make slight changes or modifications are equivalent to equivalent implementation cases and fall within the scope of the technical solution.

Claims

1. A low-temperature resistant heterotrophic nitrification-aerobic denitrification bacterium, characterized by : The low-temperature resistant heterotrophic nitrification-aerobic denitrifying bacteria is Klebsiella pneumoniae ( Klebsiella pneumoniae )TYF-CJJ-P06, deposited in the General Microbiology Center of China Culture Collection Administration, its deposit number is: CGMCC NO. 29832, and the deposit date is January 17, 2024.

2. The Klebsiella pneumoniae according to claim 1 ( Klebsiella pneumoniae ) Application of TYF-CJJ-P06 in sewage denitrification; the Klebsiella pneumoniae ( Klebsiella pneumoniae )TYF-CJJ-P06 can effectively remove one or a combination of ammonia nitrogen and nitrate nitrogen at a water temperature of 10-35℃.

3. The use according to claim 2, characterized in that: The Klebsiella pneumoniae TYF-CJJ-P06 can convert ammonia nitrogen and nitrate nitrogen into gaseous nitrogen at 10°C; within 48 hours, the ammonia nitrogen removal efficiency reaches 95.58%, the average ammonia nitrogen removal rate from 0 to 24 hours is 3.40 mg / L / h; and the nitrate nitrogen removal rate reaches 93.08%.

4. A microbial agent for removing inorganic nitrogen pollutants in water, characterized in that: The microbial agent is composed of Klebsiella pneumoniae ( Klebsiella pneumoniae )TYF-CJJ-P06, deposited in the General Microbiology Center of China Culture Collection Administration, with the deposit number: CGMCC NO. 29832, the deposit date is January 17, 2024, and was obtained by fermentation.

5. The microbial agent for removing inorganic nitrogen pollutants in water according to claim 4, characterized in that: The preparation method of the microbial agent specifically comprises the following steps: Klebsiella pneumoniae ( Klebsiella pneumoniae TYF-CJJ-P06 was inoculated into nitrification medium and then placed in a shaker at 30°C for activation. After it grew to the logarithmic phase, 5% of the activated bacterial liquid was inoculated into 100 mL of nitrification medium at 30°C and cultured for 48 h at 120 r / min.

6. Use of the microbial agent for removing inorganic nitrogen pollutants in water as claimed in claim 4 in denitrification of a water environment; the microbial agent for removing inorganic nitrogen pollutants in water can efficiently remove ammonia nitrogen, nitrate nitrogen or total nitrogen at 10-35°C; wherein, The microbial agent can convert ammonia nitrogen and nitrate nitrogen into gaseous nitrogen; the specific application method is: adding the microbial agent to the water environment to be treated at an inoculation rate of 0.8-20% (v / v) and a water temperature of 10-35°C, thereby removing inorganic nitrogen pollutants in the water body.

Images