Application of BTR1 protein in enhancing plant disease resistance or cultivating transgenic plants with disease resistance

Abstract

The present invention relates to the field of genetic engineering technology, and particularly to the application of BTR1 protein in improving the disease resistance of plants or cultivating transgenic plants with disease resistance. The present invention provides the application of BTR1 protein in improving the disease resistance of plants or cultivating transgenic plants with disease resistance. The amino acid sequence of the BTR1 protein is as shown in SEQ ID NO.2, and the pathogens of the disease resistance include one or more of oomycetes, bacteria and viruses. The present invention introduces the bacterial BTR1 protein into plant disease resistance and discovers its role in plant disease resistance. Expressing the BTR1 protein in plants can improve the resistance of plants to oomycetes, bacteria and viruses, achieve combined disease resistance, and help plants achieve disease-resistant cultivation and breeding. The present invention expands the screening range of plant R genes and effectively reduces the time and effort of traditional R gene screening methods.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and particularly to the application of BTR1 protein in improving plant disease resistance or cultivating transgenic plants with disease resistance. Background Art

[0002] During the growth and development process of plants, they are often invaded by various pathogens (oomycetes, bacteria, viruses), causing inestimable losses to agricultural production. At present, the means of chemical control and agricultural control cannot effectively control the occurrence of diseases, and they are costly and cause great environmental pollution. Therefore, it is of great significance for crop breeding and agricultural production to deeply explore disease-resistant genes, especially gene resources with broad-spectrum resistance to pathogenic bacteria, so as to improve plant disease resistance.

[0003] Searching for a broad-spectrum disease-resistant gene in plants not only requires rich germplasm resources, but also the disease-resistant genes mined by traditional methods can only resist one or a few physiological races and cannot achieve combined disease resistance against large categories such as oomycetes, bacteria, viruses, etc. Summary of the Invention

[0004] To solve the above problems, the present invention provides the application of BTR1 protein in improving plant disease resistance or cultivating transgenic plants with disease resistance. The present invention discovers that expressing BTR1 protein in plants can improve the resistance of plants to oomycetes, bacteria and viruses and achieve combined disease resistance.

[0005] To achieve the above object, the present invention provides the following technical solutions:

[0006] The present invention provides the application of BTR1 protein in improving plant disease resistance or cultivating transgenic plants with disease resistance, wherein the amino acid sequence of the BTR1 protein is as shown in SEQ ID NO.2, and the pathogens of the disease resistance include one or more of oomycetes, bacteria and viruses.

[0007] Preferably, the oomycetes include Phytophthora capsici; the bacteria include Pseudomonas syringae pv. tomato; the virus includes Turnip mosaic virus.

[0008] Preferably, the plant includes tobacco.

[0009] Preferably, the nucleotide sequence of the coding gene of the BTR1 protein is as shown in SEQ ID NO.1.

[0010] The present invention provides a recombinant vector for improving plant disease resistance, and the recombinant vector comprises an original vector and a target gene sequence inserted into the original vector; the target gene sequence comprises a coding sequence encoding a BTR1 protein; the amino acid sequence of the BTR1 protein is as shown in SEQ ID NO.2.

[0011] Preferably, the target gene sequence is as shown in SEQ ID NO.3.

[0012] Preferably, the original vector comprises a pCAMBIA1300 vector.

[0013] The present invention provides an engineered bacterium for improving plant disease resistance, which comprises the recombinant vector described in the above technical solution.

[0014] Preferably, the initial strain for constructing the engineered bacterium comprises Agrobacterium tumefaciens GV3101.

[0015] The present invention provides a method for improving plant disease resistance, which comprises introducing the recombinant vector or the engineered bacterium into a plant; the recombinant vector is the recombinant vector described in the above technical solution; the engineered bacterium is the engineered bacterium described in the above technical solution.

[0016] Beneficial effects:

[0017] The present invention provides the application of the BTR1 protein in improving plant disease resistance or cultivating transgenic plants with disease resistance. The amino acid sequence of the BTR1 protein is as shown in SEQ ID NO.2, and the pathogens of the disease resistance include one or more of oomycetes, bacteria and viruses. The present invention introduces the bacterial BTR1 protein into plant disease resistance and discovers its role in plant disease resistance. Expressing the BTR1 protein in plants can improve the resistance of plants to oomycetes, bacteria and viruses, achieve combined disease resistance, and help plants achieve disease-resistant cultivation and breeding. The present invention expands the screening range of plant R genes and effectively reduces the time and effort of traditional R gene screening methods. Description of the drawings

[0018] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments.

[0019] Figure 1 It is the detection result of the burst of reactive oxygen species and the expression level of disease resistance-related genes in Nicotiana benthamiana induced by BTR1; wherein, a is the DAB staining result, and the scale bar is 1 cm; b is the determination result of reactive oxygen species; c is the detection result of the expression level of disease resistance-related genes, **** indicates P<0.0001;

[0020] Figure 2Results of the analysis of the resistance of tobacco with transient expression of BTR1 to TuMV virus; among them, a is the photographing result under ultraviolet light, and the scale bar is 1 cm; b is the expression levels of the coat protein CP gene of TuMV virus and the GFP gene, **** indicates P < 0.0001;

[0021] Figure 3 Results of the analysis of the resistance of tobacco with transient expression of BTR1 to the bacterium Pto DC3000 HopQ1:Luc; among them, a is the result of the Luc fluorescence intensity; b is the result of the bacterial biomass at the inoculation site, *** indicates P < 0.001, **** indicates P < 0.0001;

[0022] Figure 4 Results of the analysis of the resistance of tobacco with transient expression of BTR1 to Phytophthora capsici; among them, a is the result of the lesion area, and the scale bar is 1 cm; b is the result of the relative biomass of Phytophthora capsici measured by qPCR, **** indicates P < 0.0001. Detailed implementation mode

[0023] The present invention provides the application of BTR1 protein in improving plant disease resistance or cultivating transgenic plants with disease resistance. The amino acid sequence of the BTR1 protein is as shown in SEQ ID NO.2, and the pathogens of the disease resistance include one or more of oomycetes, bacteria and viruses. In the present invention, the oomycetes preferably include Phytophthora capsici; the bacteria preferably include Pseudomonas syringae; the virus preferably includes Turnip mosaic virus (denoted as TuMV virus); the plant preferably includes tobacco; the nucleotide sequence of the coding gene of the BTR1 protein is preferably as shown in SEQ ID NO.1.

[0024] The BTR1 protein has adenosine tetraphosphate (ppApp) synthase activity. In the present invention, the BTR1 protein is expressed in plants, and this protein can help plants improve the immune response, inhibit the invasion of pathogens into normal cells of other plants to limit the further spread of pathogens, and achieve the purpose of plant disease resistance. The present invention applies the system of bacteria resisting external competitors to plants, helps plants achieve disease-resistant cultivation and breeding, expands the screening range of plant R genes, and effectively reduces the time and energy of traditional R gene screening methods. In addition, the present invention can achieve broad-spectrum disease resistance by only using the BTR1 gene, reducing the cultivation cost of transgenic plants.

[0025] Based on the above advantages, the present invention provides a recombinant vector for improving plant disease resistance. The recombinant vector includes an original vector and a target gene sequence inserted into the original vector. The target gene sequence includes a coding sequence encoding the BTR1 protein. The amino acid sequence of the BTR1 protein is shown in SEQ ID NO.2. In the present invention, the target gene sequence is preferably shown in SEQ ID NO.3. The original vector preferably includes the pCAMBIA1300 vector. The target gene sequence of the original vector is preferably inserted between the Hind III restriction enzyme cleavage sites of the pCAMBIA1300 vector.

[0026] Previous experiments found that the direct and separate expression of the bacterial BTR1 protein would cause the death of Agrobacterium, making it impossible to successfully construct a stable transformation vector in plants. In the present invention, an intron in plants is inserted into the coding sequence of the optimized BTR1 gene as a synthesis template for the target gene (shown in SEQ ID NO.3), so that the BTR1 gene containing the intron can only be normally expressed in plants to achieve plant disease resistance.

[0027] Based on the above advantages, the present invention provides an engineered bacterium for improving plant disease resistance, including the recombinant vector described in the above technical solution. In the present invention, the initial strain for constructing the engineered bacterium preferably includes Agrobacterium tumefaciens GV3101.

[0028] Based on the above advantages, the present invention provides a method for improving plant disease resistance, by introducing the recombinant vector or the engineered bacterium into plants. The recombinant vector is the recombinant vector described in the above technical solution. The engineered bacterium is the engineered bacterium described in the above technical solution. In the present invention, the pathogens of the disease resistance preferably include one or more of oomycetes, bacteria, and viruses. The oomycetes preferably include Phytophthora capsici. The bacteria preferably include Pseudomonas syringae. The viruses preferably include Turnip mosaic virus. The plants preferably include tobacco.

[0029] To further illustrate the present invention, the following describes in detail the application of the BTR1 protein provided by the present invention in improving plant disease resistance or cultivating transgenic plants with disease resistance in conjunction with the drawings and examples, but they should not be construed as limiting the protection scope of the present invention.

[0030] Example 1 Sequence optimization of bacterial Tas1 Protein (BTR1) for plants

[0031] The bacterial BTR1 protein (NCBI Sequence ID: HCK4322968.1) was optimized for plant codons. The optimization results are as follows:

[0032] The coding sequence of BTR1 optimized for plants is shown in SEQ ID NO.1, specifically as follows:

[0033] 5'-ATGGTGGCTGCACTCGTTGGCGTGGTTGCGATCGGAGGCTTGATGA TGGGCGGAATGGCACTGCTCGGAGACTTGGGCGATAGGCTCGGCCCAGGCTACAGGGACCTCTTCCAGGGCGTTGCAGGTATGGCGTTGCTTGGCTTCGGACCGAAGATGGCGAGGCTTGGCAATGCTCCGAAAGGCGCACCAAAGACGCAAGTGCCAAAGGGCTTCGAGAAGGTGTACGGCAAGGCACCAGCTGCAAAGGCTGAGATCGACGCTGTGGCAGATGGACTTGCTGCCAAGCACGGAGGTAGGGTTGCCAAGGCGCCAATCAAGAGCAGGGAGAGGGCAATGCAGAAGATCAACAACGACTACAAGGGCGATCCAACCAAGATCAAAGACCTCGCCAGAAACACCATCATCGTGGAGGGAGACAAGGTGAACACCGTGGCAGCTGAGCTCGCCAATAGAGGCGCTAAGGTGAAGGTGATCGACGGCAATGCCGATCCACTCGGCTACTCTGGCGTGAACTCCACCATGAACACCAAGGCAGGCATCCCTGGAGAGATCCAGGTGAATTCGCCGGAGATGATCTACGCCAAAGAGTCGGAAGACATGGCACGCATTCTGCTCGGCAACGACACCTACGACGCAGTTGCAGCCAAGGCTGGAGTTCCAGGCGGACAAGGCCACAAGTACTACGAAGACTGGAGGGTTCTCGATCCGAAGTCTCCAGAAGCTCAGGCAATCGCCGAGAAGTCCAGAGCCTACTACGACGCCGTTCGCAAGGGAAACGGCAACTAG-3';

[0034] The amino acid sequence of the BTR1 protein is shown in SEQ ID NO.2 and is as follows:

[0035] MVAALVGVVAIGGLMMGGMALLGDLGDRLGPGYRDLFQGVAGMALLGFGPKMARLGNAPKGAPKTQVPKGFEKVYGKAPAAKAEIDAVADGLAAKHGGRVAKAPIKSRERAMQKINNDYKGDPTKIKDLARNTIIVEGDKVNTVAAELANRGAKVKVIDGNADPLGYSGVNSTMNTKAGIPGEIQVNSPEMIYAKESEDMARILLGNDTYDAVAAKAGVPGGQGHKYYEDWRVLDPKSPEAQAIAEKSRAYYDAVRKGNGN*;

[0036] Preliminary experiments found that the direct and single expression of bacterial BTR1 protein would lead to the death of Agrobacterium, and it was impossible to successfully construct an instantaneous expression vector in plants. In the present invention, an intron in plants (shown as SEQ ID NO.4) was inserted into the coding sequence of the optimized BTR1 gene as a synthesis template for the target gene (shown as SEQ ID NO.3), so that the BTR1 gene containing the intron could only be normally expressed in plants, achieving plant disease resistance. The specific sequence is as follows:

[0037] SEQ ID NO.3:

[0038] 5'-ATGGTGGCTGCACTCGTTGGCGTGGTTGCGATCGGAGGCTTGATGA TGGGCGGAATGGCACTGCTCGGAGACTTGGGCGATAGGCTCGGCCCAGGCTACAGGGACCTCTTCCAGGGCGTTGCAGGTATGGCGTTGCTTGGCTTCGGACCGAAGATGGCGAGGCTTGGCAATGCTCCGAAAGGCGCACCAAAGACGCAAGTGCCAAAGGGCTTCGAGAAGGTGTACGGCAAGGCACCAGCTGCAAAGGCTGAGATCGACGCTGTGGCAGATGGACTTGCTGCCAAGCACGGAGGTAGGGTTGCCAAGGCGCCAATCAAGAGCAGGGAGAGGGCAATGCAGAAGATCAACAACGACTACAAGGGCGATCCAACCAAGATCAAAGACCTCGCCAGAAACACCATCATCGTGGAGGGAGACAAGGTGAACACCGTGGCAGCTGAGCTCGCCAATAGAGGCGCTAAGGTGAAGGTGATCGACGGCAATGCCGATCCACTCGGCTACTCTGGCGTGAACTCCAGTAAGTTTCTGCTTCTACCTTTGATATATATATAATAATTATCATTAATTAGTAGTAATATAATATTTCAAATATTTTTTTCAAAATAAAAGAATGTAGTATATAGCAATTGCTTTTCTGTAGTTTATAAGTGTGTATATTTTAATTTATAACTTTTCTAATATATGACCAAAATTTGTTGATGTGCAGCCATGAACACCAAGGCAGGCATCCCTGGAGAGATCCAGGTGAATTCGCCGGAGATGATCTACGCCAAAGAGTCGGAAGACATGGCACGCATTCTGCTCGGCAACGACACCTACGACGCAGTTGCAGCCAAGGCTGGAGTTCCAGGCGGACAAGGCCACAAGTACTACGAAGACTGGAGGGTTCTCGATCCGAAGTCTCCAGAAGCTCAGGCAATCGCCGAGAAGTCCAGAGCCTACTACGACGCCGTTCGCAAGGGAAACGGCAACTAG-3';

[0039] SEQ ID NO.4:

[0040] 5'-GTAAGTTTCTGCTTCTACCTTTGATATATATATAATAATTATCATTAATT AGTAGTAATATAATATTTCAAATATTTTTTTCAAAATAAAAGAATGTAGTATA TAGCAATTGCTTTTCTGTAGTTTATAAGTGTGTATATTTTAATTTATAACTTTT CTAATATATGACCAAAATTTGTTGATGTGCAG-3'.

[0041] Example 2: Bacterium BTR1 induces tobacco cell death and has the immune characteristics of plant disease-resistant genes

[0042] S1. Vector construction:

[0043] Amplify the BTR1 fragment: Using the synthesized BTR1 fragment (shown in SEQ ID NO.3) as a template, perform PCR amplification with P1300-BTR1-F and P1300-BTR1-R to obtain the BTR1 fragment; using the synthesized BTR1 fragment (shown in SEQ ID NO.3) as a template, perform PCR amplification with P1300-BTR1-F and P1300-BTR1-GFP-R to obtain the BTR1-GFP fragment; using the extracted rice cDNA as a template, perform PCR amplification of the full length of the Xa23 gene with primers P1300-Xa23-F and P1300-Xa23-R to obtain the Xa23 gene fragment. The primer sequences are as follows:

[0044] P1300-BTR1-F: 5'-ATCGACTCTAGAAAGCTTATGGTGGCTGCACTCGTT GGC-3', SEQ IDNO.5;

[0045] P1300-BTR1-R: 5'-CACCATGGTCTCAAGCTTCTAGTTGCCGTTTCCCTT GCGA-3', SEQ IDNO.6;

[0046] P1300-BTR1-GFP-R: 5'-CACCATGGTCTCAAGCTTGTTGCCGTTTCCCTT GCGA-3', SEQ IDNO.7;

[0047] P1300-Xa23-F: 5'-ATCGACTCTAGAAAGCTTATGGTGGCTGCACTCGTTG GC-3', SEQ IDNO.8;

[0048] P1300-Xa23-R: 5'-CACCATGGTCTCAAGCTTGTTGCCGTTTCCCTTGCGA-3', SEQ ID NO.9;

[0049] The reaction conditions were: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 sec, annealing at 58°C for 30 sec, extension at 72°C for 40 sec, for 34 cycles; extension at 72°C for 5 min.

[0050] Homologous recombination ligation: The pCAMBIA1300 vector was digested with Hind III, and the digested product was ligated with the amplified BTR1 fragment to construct a tobacco expression vector, which was then transformed into Escherichia coli DH5α to obtain the recombinant vector pCAMBIA1300-BTR1; The pCAMBIA1300 vector was digested with Hind III, and the digested product was ligated with the amplified BTR1-GFP fragment to construct a tobacco expression vector, which was then transformed into Escherichia coli DH5α to obtain the recombinant vector pCAMBIA1300-BTR1-GFP; The pCAMBIA1300 vector was digested with Hind III, and the digested product was ligated with the amplified Xa23 gene fragment to construct a tobacco expression vector, which was then transformed into Escherichia coli DH5α to obtain the recombinant vector pCAMBIA1300-Xa23.

[0051] S2. Immune feature analysis:

[0052] 1. Transient expression of BTR1 in Nicotiana benthamiana induces a hypersensitive (HR) response in plants: This experiment was divided into 4 groups, BTR1-GFP (recombinant vector pCAMBIA1300-BTR1-GFP), BTR1 (recombinant vector pCAMBIA1300-BTR1), EV (pCAMBIA1300 empty vector) and the positive control Xa23 (recombinant vector pCAMBIA1300-Xa23) that induces the HR response; The pCAMBIA1300 empty vector was used as a negative control and contains the eGFP gene. The experimental steps were as follows:

[0053] The recombinant vector pCAMBIA1300-BTR1-GFP, the recombinant vector pCAMBIA1300-BTR1, the pCAMBIAsuper1300 empty vector and the recombinant vector pCAMBIA1300-Xa23 were separately transferred into Agrobacterium tumefaciens GV3101. After shaking culture for 16 h, the 4 kinds of bacterial cells were resuspended with an infection solution (10 mM MgCl2, 10 mM MES and 100 μM acetosyringone) respectively, and the OD of the 4 kinds of bacterial cells was adjusted 600nmAll are 1. The four resuspended bacterial suspensions (BTR1-GFP, BTR1, EV, and positive control Xa23) were respectively injected into the leaves of four-week-old Nicotiana benthamiana. 24 h after injection, the tobacco leaves were observed and photographed under white light and ultraviolet (UV) light. The results are shown in Figure 1 a in

[0054] 2. BTR1 induces the burst of reactive oxygen species (ROS) in Nicotiana benthamiana - DAB staining: This experiment was divided into four groups. BTR1, BTR1-GFP, EV, and positive control Xa23 were respectively injected into the leaves of four-week-old Nicotiana benthamiana. 15 h after injection, the injected tobacco leaves were immersed in 20 ml of DAB staining solution, horizontally shaken in the dark for 8 h, then placed in 95% ethanol for decolorization, and horizontally shaken for 48 h, and photographed under white light. The results are shown in Figure 1 a in

[0055] 3. BTR1 induces the burst of ROS in Nicotiana benthamiana - ROS determination: This experiment was divided into four groups, namely the BTR1 / chitin group (i.e., BTR1 and chitin in Figure 1 b in Figure 1 ), the EV / chitin group (i.e., WT and chitin in Figure 1 b in Figure 1 ), the BTR1 / mock group (i.e., BTR1 and mock in

[0056] Resuspend the bacteria using a method similar to Step 1 in S2. Inject Agrobacterium containing the recombinant vector pCAMBIA1300 - BTR1 and the empty vector pCAMBIA1300 into the leaves of 4 - week - old Nicotiana benthamiana respectively. After 7 h, collect small discs of Nicotiana benthamiana leaves with a size of 3 mm×3 mm and immerse them in distilled water overnight in a 96 - well plate. Discard the distilled water, and add 100 μL of the mixed solution to each well. Add 100 μL of distilled water to each well in the BTR1 / mock group and the EV / mock group as a control; the mixed solution consists of the following components: 50 μM luminol (Wako), 10 μg / mL horseradish peroxidase, and 6 mM chitin (GLPBIO). Measure the chemiluminescence at intervals of 500 ms in a SPARK - 10M microplate reader (TECAN) for 60 minutes. The results are shown in Figure 1 b in

[0057] As can be seen from Figure 1 b in Figure 1 , after induction with chitin, it was found that the reactive oxygen species in tobacco expressing the BTR1 gene increased sharply, significantly higher than that in the material not expressing the BTR1 gene, indicating that BTR1 expression can induce the production of reactive oxygen species, and the total amount of reactive oxygen species is much higher than that of Control Group 1 and Control Group 2.

[0058] 4. Detection of disease - resistance - related genes: Experimental method: This experiment was divided into two groups, that is, injecting Agrobacterium containing the expression plasmid of BTR1 into Nicotiana benthamiana as the experimental group and injecting Agrobacterium containing the empty - vector expression plasmid into Nicotiana benthamiana as the EV control (the method refers to Step 1 in S2), and at least three biological replicates were performed for each sample.

[0059] RNA extraction and reverse - transcription quantitative PCR analysis: Collect the tobacco leaves containing BTR1 and the control EV 15 h after Agrobacterium injection, and quickly place them in liquid nitrogen for freezing. After grinding in liquid nitrogen, it is used for RNA extraction. Use the RNAprep Pure Plant Kit (TianGen Biotech; China) to extract total RNA from the samples. Use DNase I (Thermo Scientific) to purify the RNA from the total RNA. Use the HiScript II First Strand cDNA Synthesis Kit (Vazyme) to synthesize complementary DNA (cDNA). Use the SYBR Green mixture (Vazyme) to perform qRT - PCR on a Bio - Rad CFX96 real - time system and a C1000 thermal cycler (Bio - Rad), with NbActin as the internal reference gene, and the primer sequences are as follows:

[0060] LOX - F: 5'-AAAACCTATGCCTCAAGAAC - 3', SEQ ID NO.10;

[0061] LOX-R: 5'-ACTGCTGCATAGGCTTTGG-3', SEQ ID NO.11;

[0062] NPR1-F: 5'-ACATCAGCGGAAGCAGTAG-3', SEQ ID NO.12;

[0063] NPR1-R: 5'-GTCGGCGAAGTAGTCAAAC-3', SEQ ID NO.13;

[0064] PAL-F: 5'-GTTATGCTCTTAGAACGTCGCCC-3', SEQ ID NO.14;

[0065] PAL-R: 5'-CCGTGTAATGCCTTGTTTCTTGA-3', SEQ ID NO.15;

[0066] PR1a-F: 5'-CCCATAACACAGCTCGTGCA-3', SEQ ID NO.16;

[0067] PR1a-R: 5'-CGACCCACATCTCAACGGC-3', SEQ ID NO.17;

[0068] PR1b-F: 5'-GTGGACACTATACTCAGGTG-3', SEQ ID NO.18;

[0069] PR1b-R: 5'-TCCAACTTGGAATCAAAGG-3', SEQ ID NO.19;

[0070] PR2b-F: 5'-AGGTGTTTGCTATGGAATGC-3', SEQ ID NO.20;

[0071] PR2b-R: 5'-CTGTACCCACCATCTTGC-3', SEQ ID NO.21;

[0072] PR4-F: 5'-GAGGAATCAGGCGATAGAGAAAAGG-3', SEQ ID NO.22;

[0073] PR4-R: 5'-CGAGGTAGGTATCACAACAATTATTCATG-3', SEQ ID NO.23;

[0074] NbActin-F: 5'-TCATCCGTGGAGAAGAGCTACG-3', SEQ ID NO.24;

[0075] NbActin-R: 5'-CCACTGAGGACAATGTTTCCGTAC-3', SEQ ID NO.25;

[0076] Adopt 2 -ΔΔCT methods to calculate the expression levels of each gene. The results are shown in Figure 1 c in.

[0077] The results showed that the expression levels of disease-resistant genes such as lysine oxidase gene (LOX), pathogenesis-related gene non-expressor 1 (NPR1), phenylalanine ammonia-lyase gene (PAL), and pathogenesis-related protein family genes against environmental stress in plants (PR1b, PR2b, PR1a, PR4) in tobacco samples injected with BTR1-expressing were significantly increased, significantly higher than those in the control group, indicating that the expression of BTR1 activated the expression of plant disease-resistant genes, demonstrating that the BTR1 gene has the immune characteristics of plant R genes.

[0078] It can be seen from Figure 1 that the bacterial BTR1 protein has the basic characteristics of plant disease-resistant proteins.

[0079] Example 3 Analysis of the resistance of transiently expressed BTR1 tobacco to TuMV virus

[0080] The TuMV infectious clone vector carrying GFP (denoted as TuMV) was transformed into Agrobacterium tumefaciens strain GV3101 and cultured with shaking at 28 °C for 16 h; the construction method of the TuMV infectious clone vector carrying GFP can be found in the literature [Kim SH, Qi D, Ashfield T, Helm M, Innes RW. Using decoys to expand the recognition specificity of a plant disease resistance protein. Science. 2016 Feb 12; 351(6274): 684-7. doi: 10.1126 / science.aad3436. PMID: 26912853.]. The bacterial cells containing TuMV were resuspended with an infection solution (10 mM MgCl2, 10 mM MES, and 100 μM acetosyringone), and the OD 600 was adjusted to 0.5 to obtain TuMV bacterial cells.

[0081] Mix the TuMV cells with the bacterial suspensions of Agrobacterium tumefaciens containing BTR1 and the empty vector EV (for the preparation methods of the two bacterial suspensions, see step 1 in Example 2S2, with an OD 600 of 0.5) in equal volumes to obtain two mixed bacterial suspensions; inject the two mixed bacterial suspensions into the two young leaves above the wild-type tobacco (WT) cultured for one month for transient expression. The tobacco with transient expression of BTR1 is used as the experimental group, and the tobacco with transient expression of the empty vector EV is used as the control group. Nine days post inoculation (dpi), take pictures under ultraviolet (UV) light, and the results are shown in Figure 2 a, where Tas1 is the experimental group. At the same time, extract the systemic leaves above the injected tobacco leaves and perform qPCR to measure the expression level of the TuMV virus coat protein CP gene. NbActin is used as the internal reference gene, and the primer sequences for amplifying the internal reference gene are shown in SEQ ID NO.24 and SEQ ID NO.25, and the sequences of the remaining primers are as follows:

[0082] TuMV-CP-F: 5'-CACGCCGGAGCAGACGGATC-3', SEQ ID NO.26;

[0083] TuMV-CP-R: 5'-CTGATCGTCGCCGTCCATCATC-3', SEQ ID NO.27;

[0084] TuMV-GFP-F: 5'-GAAGCGGCACGACTTCTTCAAGAG-3', SEQ ID NO.28;

[0085] TuMV-GFP-R: 5'-GCCGAGGATGTTTCCGTCCTCC-3', SEQ ID NO.29;

[0086] Use the 2 -ΔΔCT method to calculate the expression levels of each gene. Each group was performed with at least three biological replicates. The results are shown in Figure 2 b.

[0087] Figure 2 The result in a of Figure 2 shows that the content of TuMV-GFP in the systemic leaves of the tobacco with transient expression of BTR1 is significantly lower than that of the control group. The result in b of

[0088] also shows that the expression level of the TuMV coat protein CP gene is also significantly lower than that of the control group. In summary, the tobacco expressing the BTR1 protein has significant resistance to the TuMV virus.

[0089] Example 4 Resistance analysis of tobacco with transient expression of BTR1 to the bacterium Pto DC3000 HopQ1:Luc

[0089] The recombinant vector pCAMBIA1300-BTR1 constructed in Example 2 was transformed into Agrobacterium tumefaciens strain GV3101 and cultured with shaking at 28 °C for 16 h. The bacterial cells were resuspended using an infection solution (10 mM MgCl2, 10 mM MES, and 100 μM acetosyringone), and the OD of Agrobacterium was adjusted 600 to 0.5. The Agrobacterium of the EV vector (OD 600 = 0.5) and the Agrobacterium of pCAMBIA1300-BTR1 were respectively injected into both ends of the leaves of wild-type tobacco (WT) that had been cultured for one month. After 12 h of injection, Pseudomonas syringae pv. tomato Pto DC3000 HopQ1:Luc was inoculated, and the inoculation amount was OD 600 = 5×10 -4 . The bacterium Pto DC3000 HopQ1:Luc is disclosed in the literature [Chakravarthy S, Worley JN, Montes-Rodriguez A, Collmer A. Pseudomonas syringae pv. tomato DC3000 polymutants deploying coronatine and two type III effectors produce quantifiable chlorotic spots from individual bacterial colonies in Nicotiana benthamiana leaves. Mol Plant Pathol. 2018 Apr;19(4):935-947. doi:10.1111 / mpp.12579. Epub 2017 Sep 25. PMID:28677296; PMCID:PMC6637995.]. The tobacco with transient expression of BTR1 was used as the experimental group, and the tobacco with transient expression of EV was used as the control group. One day after inoculation, the intensity of Luc fluorescence was observed and photographed for statistics. At the same time, the tobacco leaves at the inoculation site were collected, and the bacterial biomass at the inoculation site was detected by plating. The method included: the tobacco leaves at the inoculation site were broken and centrifuged, and the supernatant was taken. The supernatant was diluted 10-fold, 100-fold, 1000-fold, and 10000-fold in gradients and plated for counting. Each group was repeated at least three times biologically. The results are shown in Figure 3 .

[0090] Figure 3 . The result a in Figure 3 showed that the Luc fluorescence intensity of the tobacco with transient expression of BTR1 was significantly lower than that of the control group. The result b in Figure 3 showed that the number of bacteria Pto DC3000 HopQ1:Luc in the tobacco with transient expression of BTR1 after inoculation was significantly lower than that of the control group. In summary, the tobacco expressing the BTR1 protein has significant resistance to the bacterium Pto DC3000 HopQ1:Luc.

[0091] Analysis of the Resistance of Transiently Expressed BTR1 Tobacco to Phytophthora capsici in Example 5

[0092] The recombinant vector pCAMBIA1300-BTR1 constructed in Example 2 was transformed into Agrobacterium tumefaciens strain GV3101 and cultured with shaking at 28 °C for 16 h. The bacterial cells were resuspended with the infection solution, and the OD of Agrobacterium was adjusted 600 to 0.5, and the Agrobacterium with the EV vector (OD 600 = 0.5) was respectively injected into both ends of the leaves of wild-type tobacco (WT) cultured for one month. After 12 h of injection, Phytophthora capsici LT263 was inoculated. The Phytophthora capsici LT263 is preserved in the laboratory of Teacher Dou Daolong at Nanjing Agricultural University and is publicly available in the literature [Sha G, Sun P, Kong XJ, Han XY, Sun QP, Fouillen L, et al. Genome editing of a rice CDP-DAG synthase confers multipathogen resistance. Nature, 2023, 618(7967): 1017-1023. https: / / doi.org / 10.1038 / s41586-023-06205-2].

[0093] One day after inoculation, photos were taken under ultraviolet (UV) light and the lesion area was counted. The results are shown in Figure 4 a in. At the same time, RNA was extracted from the inoculated tobacco leaves, and qPCR was performed to determine the relative biomass of Phytophthora capsici. NbActin was used as the internal reference gene. The amplification primer sequences of the internal reference gene are shown in SEQ ID NO.24 and SEQ ID NO.25, and the sequences of the remaining primers are as follows:

[0094] CAP-Fw: 5'-TTTAGTTGGGGGTCTTGTACC-3', SEQ ID NO.30;

[0095] CAP-Rv1: 5'-CCTCCACAACCAGCAACA-3', SEQ ID NO.31;

[0096] The 2 -ΔΔCT method was used to calculate the expression levels of each gene. At least three biological replicates were performed for each group. The results are shown in Figure 4 b in.

[0097] Figure 4 The result in a in shows that the infection area of Phytophthora capsici in BTR1 transiently expressed tobacco is significantly lower than that of the control group. Figure 4The b result in [specific context] shows that the biomass of Phytophthora capsici after inoculating tobacco with transient expression of BTR1 is significantly lower than that of the control group. In summary, tobacco expressing the BTR1 protein has significant resistance to Phytophthora capsici.

[0098] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, not all of them. People can also obtain other embodiments based on this embodiment without creative efforts, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Use of the BTR1 protein in enhancing plant disease resistance, wherein the amino acid sequence of the BTR1 protein is as shown in SEQ ID NO.2, and the nucleotide sequence of the coding gene of the BTR1 protein is as shown in SEQ ID NO.1; the pathogen of the disease resistance is Turnip mosaic virus ( Turnip mosaic virus ); the plant is tobacco.

2. A method for improving plant disease resistance, characterized in that, Introduce the recombinant vector or engineered bacterium into a plant; the recombinant vector includes an original vector and a target gene sequence inserted into the original vector; the target gene sequence includes the coding sequence of the BTR1 protein; the amino acid sequence of the BTR1 protein is as shown in SEQ ID NO.2; The target gene sequence is as shown in SEQ ID NO.3; the engineered bacterium includes the recombinant vector; the pathogen of the disease resistance is Turnip mosaic virus; the plant is tobacco.

3. The method according to claim 2, wherein The original vector includes the pCAMBIA1300 vector.

4. The method according to claim 2, wherein The initial strain for constructing the engineered bacterium includes Agrobacterium tumefaciens GV3101.

Images