A lactic acid bacteria constitutive promoter, a recombinant vector and its application

Abstract

The present invention provides a lactic acid bacteria constitutive promoter, a recombinant vector and its application, belonging to the field of genetic engineering. The nucleotide sequence of the promoter PenoA provided by the present invention is shown in SEQ ID No.1. The promoter PenoA can initiate the efficient expression of downstream genes in lactic acid bacteria, and the expression intensity is 3.38 times that of the glyceraldehyde triphosphate dehydrogenase promoter PgapA (generally strong in prokaryotes), 32.61 and 51.40 times that of the commercial promoters Perm and PldhL, and is a super-efficient promoter. The promoter can be applied to Lactococcus lactis and Lactobacillus plantarum. The promoter provided by the present invention can be used for the efficient expression of endogenous or exogenous proteins in prokaryotes, such as interleukin 10. And after random mutation, a promoter library with a transcription intensity of 5.5%-430.28% is formed, which provides a favorable tool for the development of biological living drugs with intestinal probiotics as chassis cells.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering, and specifically relates to a lactic acid bacteria promoter, a recombinant vector and applications thereof. Background Art

[0002] Lactic acid bacteria is a general term for Gram-positive bacteria that use carbohydrates to produce lactic acid. Due to its long history of safe use in foods such as yogurt, cheese, pickles, and sausages, it is listed as a generally recognized as safe (GRAS) microorganism by the U.S. Food and Drug Administration.

[0003] In recent years, with the development of bacterial genomics and the enrichment of genetic manipulation tools, lactic acid bacteria have become the preferred chassis cells for synthesizing biotherapeutics such as cytokines and antigens. Compared with traditional antibody drug delivery systems, lactic acid bacteria oral drug delivery systems have the following advantages: First, lactic acid bacteria are food-grade strains and do not synthesize immunogenic lipopolysaccharides, which ensures the safety of the product. Second, lactic acid bacteria are normal intestinal flora, with the characteristics of acid and bile resistance and direct contact with intestinal mucosa. Presenting antigens and pharmaceutical molecules with lactic acid bacteria as carriers can promote intestinal mucosal immunity and facilitate the in situ release of products. Third, the metabolic pathway of lactic acid bacteria is simple, growth is not coupled with energy metabolism, and it is easy to control and divert carbon metabolic flows. Although lactic acid bacteria have many advantages as chassis cells, the existing technology has the problem of low protein expression efficiency, which greatly limits the application of the system. In synthetic biology research, the fine expression regulation of genes is a key factor in determining the research process; for prokaryotic microorganisms, promoter engineering is considered to be one of the most effective transcriptional regulation strategies because promoters significantly affect gene expression levels. The promoter is a key DNA sequence that RNA polymerase recognizes, binds to, and starts transcription, and plays an important role in regulating gene expression. Studies have shown that among the various sequences that control gene expression, promoters account for more than 45% of the influence. Therefore, screening highly active promoters is crucial to improving gene expression and realizing the clinical application of oral drug delivery systems using probiotics as carriers.

[0004] The Nisin controlled expression (NICE) system is currently the most classic system for lactic acid bacteria to express target genes. The strength of the inducible promoter is often higher than that of the constitutive promoter. The constitutive promoter is not controlled by any regulator or growth conditions. The expression level of the subsequent gene is usually constant at a certain level, and has the characteristics of no time and space specificity. The inducible promoter needs to add an inducer or change the growth conditions to start the expression of the subsequent gene. Although the constitutive promoter is low in cost, easy to use and not limited by the culture medium, its expression intensity is not high compared with the inducible promoter. However, based on the analysis of bacterial metabolic pathways, constitutive promoters with strong expression effects can also be screened out, such as the patent CN 111518801B describes a promoter PgapA of glyceraldehyde triphosphate dehydrogenase from lactic acid bacteria, and its expression effect is 2.22 times stronger than the NICE system.

[0005] However, in order to further improve the expression level of genes, it is still urgent to screen out promoters with stronger expression effects. At the same time, when multiple genes regulate the metabolic pathways of chassis cells, in order to avoid causing metabolic burden, it is often necessary to coordinate the expression of functional genes, and screening relatively weak promoters facilitates rational selection. Summary of the invention

[0006] Purpose of the invention: In order to solve the problem of low protein expression in the current lactic acid bacteria system, the present invention provides a constitutive promoter with ultra-high transcriptional activity. At the same time, based on the lactic acid bacteria constitutive promoter, the present invention also provides a recombinant vector comprising the promoter, its recombinant bacteria and applications. The recombinant vector or recombinant bacteria can efficiently initiate downstream gene expression, and can build a living biological drug platform based on intestinal probiotics for the delivery of different protein drugs, which has application potential in the treatment of different diseases.

[0007] Technical solution: In order to solve the above technical problems, the present invention provides a lactic acid bacteria constitutive promoter, the nucleotide sequence of which is selected from the following sequences:

[0008] (a) as shown in SEQ ID No.1 or the complementary sequence to SEQ ID No.1;

[0009] (b) a sequence as shown in SEQ ID No. 4 to SEQ ID No. 11 or a complementary sequence to that shown in SEQ ID No. 4 to SEQ ID No. 11;

[0010] (c) A sequence having a similarity of 90% or more to any of the sequences shown in SEQ ID No. 1 and SEQ ID No. 4 to SEQ ID No. 11.

[0011] The above sequence definition of the promoter should not be understood as a limitation on the promoter, and also includes a nucleotide sequence having at least 70% homology with the nucleotide sequence shown in SEQ ID No. 1; the promoter includes a nucleotide sequence obtained by modifying, replacing, deleting or adding one or more nucleotides on the basis of the sequence shown in SEQ ID No. 1. The present invention has no special limitation on the source of the promoter, and the promoter sequence synthesis method known in the art can be used.

[0012] The promoter structure has a conserved sequence TATAAT in the -10 region about 5-10 bp upstream of the transcription start site, a conserved sequence TTGAAA in the -35 region 17 bp away from the -10 region, and an upstream control element sequence of AGTTTAGGTTTGCGAAGATT in the -40 to -60 region upstream of the transcription start site.

[0013] Preferably, the similarities between the present invention and SEQ ID No. 1 are 92.8%, 92.4%, 92%, 91.6%, 91.2%, 90.8%, 90.8% and 91.2%.

[0014] The present invention also includes an expression cassette, a recombinant vector or a recombinant bacterium, which contains the promoter.

[0015] Wherein, the recombinant vector is obtained by introducing the promoter and reporter gene into a plasmid.

[0016] Wherein, the plasmid includes pTRKH3 plasmid.

[0017] Among them, the reporter gene includes a green fluorescent protein gene or a human interleukin 10 gene whose codons are optimized for lactic acid bacteria, the nucleotide sequence of the green fluorescent protein reporter gene is shown in SEQ ID No.2 or is a complementary sequence to SEQ ID No.2, and the nucleotide sequence of the human interleukin 10 gene is shown in SEQ ID No.3 or is a complementary sequence to SEQ ID No.3.

[0018] The present invention also includes a recombinant strain, which is obtained by introducing the recombinant vector into a host bacterium.

[0019] Wherein, the host bacteria include Lactococcus or Lactobacillus.

[0020] The present invention also includes the application of the lactic acid bacteria constitutive promoter, the expression cassette, the recombinant vector or the recombinant bacteria, and the recombinant vector or the recombinant strain in regulating the intensity of gene expression.

[0021] Wherein, regulating the gene expression intensity includes enhancing or weakening the gene expression intensity.

[0022] The genes include genes encoding lycopene, γ-aminobutyric acid or other functional metabolites and cytokines, antigens, antibodies or other protein or polypeptide drugs. Preferably, the lactic acid bacteria constitutive promoter of the present invention is PenoA promoter, and its sequence is shown in SEQ ID NO.1.

[0023] In one embodiment, the expression strength of the PenoA promoter is superior to other common endogenous promoters.

[0024] In one embodiment, the expression strength of the PenoA promoter is superior to that of the commercial promoters Perm and PldhL.

[0025] In one embodiment, the expression strength of the PenoA promoter is better than that of the glyceraldehyde 3-phosphate dehydrogenase promoter PgapA which is generally strong in prokaryotes.

[0026] The present invention also provides application of the promoter library in regulating gene expression intensity in the field of metabolic engineering.

[0027] In one embodiment, the application is to regulate the gene expression intensity in Lactobacillus plantarum WCFS1.

[0028] In one embodiment, the application is that the expression level of human interleukin by PenoA promoter is better than that of glyceraldehyde 3-phosphate dehydrogenase promoter PgapA which is generally stronger in prokaryotes.

[0029] In one embodiment, the application is to perform random mutation on the PenoA promoter, screen out 8 mutants, and finally obtain a transcription intensity ranging from 5.5% to 430.28% of PenoA to form a mutant library.

[0030] Beneficial effects: Compared with the prior art, the present invention has the following advantages: The present invention provides a lactic acid bacteria constitutive promoter, which does not require additional inducers and has a high transcription strength. The transcription strength is 3.38 times that of the glyceraldehyde triphosphate dehydrogenase promoter PgapA (a generally strong promoter in prokaryotes), and 32.61 and 51.40 times that of the commercial promoters Perm and PldhL. It is a super-efficient promoter that can be applied to Lactococcus lactis and Lactobacillus plantarum. The promoter provided by the present invention can be used for the efficient expression of endogenous or exogenous proteins in prokaryotes, such as human interleukin, and after random mutation, a promoter library with a transcription strength between 5.5% and 430.28% is formed, which provides a favorable tool for the development of biological living drugs with intestinal probiotics as chassis cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1This is the result diagram of PenoA promoter sequence predicted by BDGP online;

[0032] Figure 2 The result diagram of the -35 and -10 core regions of the PenoA promoter predicted by BPROM online;

[0033] Figure 3 This is a comparison of the effects of different endogenous promoters expressing green fluorescent protein in Lactococcus lactis MG1363. PldhB: lactate dehydrogenase promoter, Ppfk: fructose phosphokinase promoter, Padd: adenosine deaminase promoter, Pgs: GMP synthase promoter, Ppgi: phosphoglucose isomerase promoter, Ppgk: phosphoglycerate kinase promoter, PenoA: enolase promoter;

[0034] Figure 4 This is a comparison of the effects of the enolase promoter PenoA and the commercial promoter in expressing green fluorescent protein in Lactococcus lactis MG1363. Perm: commercial promoter of lactic acid bacteria, PldhL: commercial promoter of lactic acid bacteria;

[0035] Figure 5 This is a comparison of the fluorescent protein expression effects of the enolase promoter PenoA and the glyceraldehyde triphosphate dehydrogenase promoter PgapA in Lactococcus lactis MG1363;

[0036] Figure 6 This is a microscope observation of the fluorescent protein expression of the enolase promoter PenoA and the glyceraldehyde triphosphate dehydrogenase promoter PgapA in Lactococcus lactis MG1363;

[0037] Figure 7 This is a microscope observation of the fluorescent protein expression of the enolase promoter PenoA in Lactobacillus plantarum WCFS1;

[0038] Figure 8 This is a comparison chart of the expression effects of human interleukin by the enolase promoter PenoA and the glyceraldehyde triphosphate dehydrogenase promoter PgapA in Lactococcus lactis MG1363.

[0039] Fig. 9 This is a diagram showing the mutation types of the enolase promoter PenoA promoter and the effects on relative fluorescence intensity. DETAILED DESCRIPTION

[0040] The commercial Escherichia coli MC1061 of the present invention was purchased from Shanghai Weidi Biotechnology Co., Ltd. and used for plasmid construction.

[0041] Commercial Lactococcus lactis MG1363 was purchased from Beina Biotechnology and used as a host to express proteins to determine the promoter strength.

[0042] Lactobacillus plantarum WCFS1 was purchased from Baosai Biotechnology and used as a host to express proteins to determine the promoter strength.

[0043] The commercial plasmids pTRKH3-ermGFP and pTRKH3-ldhLGFP were purchased from Fenghui Biotechnology with catalog numbers ZT1973 and ZT1794, respectively.

[0044] Example 1

[0045] 1. Prediction of endogenous promoters in Lactococcus lactis

[0046] The genome of Lactococcus lactis MG1363 was analyzed online, e.g. Figure 1 As shown, the Berkeley Drosophila Genome Project promoter prediction software was used to predict a 250 bp sequence upstream of enolase (shown in SEQ ID NO.1), with scores > 0.9 (full score 1.0) in many places, indicating that the sequence is very likely to be the promoter of enolase, and the promoter was named PenoA; Figure 2 As shown, the BPROM promoter core region prediction software predicted that PenoA had a conserved sequence TAAAAT in the -10 region about 5-10 bp upstream of the transcription start site, and a conserved sequence TTGAAA in the -35 region 17 bp away from the -10 region, both scores were >60 (full score 100), and the upstream control element sequence located in the -40 to -60 region upstream of the transcription start site was AGTTTAGGTTTGCGAAGATT, which met the characteristics of a super strong promoter.

[0047] 2. Construction of promoter recombination vector

[0048] 2.1 Promoter gene amplification and recovery

[0049] The genome of Lactococcus lactis MG1363 was extracted using Novizan FastPure Bacteria DNA Isolation Mini Kit. Using the genome of Lactococcus lactis MG1363 as a template, primers were designed to amplify the lactate dehydrogenase promoter PldhB (upstream primer 3ldhB-F and downstream primer 3ldhB-R), phosphofructokinase promoter Ppfk (upstream primer 3pfk-F and downstream primer 3pfk-R), adenosine deaminase promoter Padd (upstream primer 3add-F and downstream primer 3add-R), GMP synthase promoter Pgs (upstream primer 3gs- F and downstream primer 3gs-R), phosphoglucose isomerase promoter Ppgi (upstream primer 3pgi-F and downstream primer 3pgi-R), Ppgk phosphoglycerate kinase promoter (upstream primer 3pgk-F and downstream primer 3pgk-R), glyceraldehyde triphosphate dehydrogenase promoter PgapA (upstream primer 3gapA-F and downstream primer 3gapA-R), enolase promoter PenoA (upstream primer 3enoA-F and downstream primer 3enoA-R), the amplification primer sequences are shown in Table 1. PCR amplification reactions were all amplified by high-fidelity DNA polymerase PrimeSTAR Max (TaKaRa), and the PCR reaction system was: 25 μL of 2× Primestar Max (TaKaRa), 1 μL of upstream primer, 1 μL of downstream primer, 22.5 μL of ddH2O, and 0.5 μL of template. The PCR reaction program was: 98°C for 10 s, 55°C for 15 s, 72°C for 5 s, 30 cycles; 72°C for 10 min; and incubation at 4°C. The PCR products were recovered using the Novizan FastPure Gel DNA Extraction Mini Kit (Vazyme) to obtain promoter fragments PldhB, Ppfk, Padd, Pgs, Ppgi, Ppgk, PgapA, and PenoA.

[0050] Table 1 Primer sequences

[0051]

[0052]

[0053] 2.2 Construction of recombinant plasmid expressing fluorescent protein

[0054] Using the pTRKH3-ermGFP plasmid as a template (purchased from Hunan Fenghui Biotechnology Co., Ltd., catalog number ZT1973), the above-mentioned promoter fragments PldhB, Ppfk, Padd, Pgs, Ppgi, Ppgk, PgapA and PenoA as primers, respectively, the recombinant vectors pTRKH3-ldhBGFP, pTRKH3-pfkGFP, pTRKH3-addGFP, PTRKH3-gsGFP, pTRKH3-pgiGFP, pTRKH3-pgkGFP, pTRKH3-gapAGFP and pTRKH3-enoAGFP were constructed by fusion PCR. The PCR amplification reactions were all amplified by the high-fidelity DNA polymerase PrimeSTAR Max (TaKaRa), and the PCR reaction system was: 12.5 μL of 2× Primestar Max (TaKaRa), 280ng promoter fragment as primer, 100ng plasmid as template, ddH2O filled to 25μL. PCR reaction program: 98℃1s, 98℃10s, 55℃45s, 72℃1min 30s, 30 cycles; 72℃10min; 4℃ insulation. The PCR product was treated with 1μL DpnI (Thermo Scientific) at 37℃ for 1h and transformed into E. coli MC1061. The transformation method is as follows: Take 100μL competent cell suspension from the -80℃ refrigerator and immediately put it on ice to melt. Add 10μL of DpnI digestion product, shake gently, and ice bath for 30min. Heat shock at 42℃ water bath for 90s, and quickly put it on ice for 3min. Add 500μL LB liquid culture medium to the tube and shake at 37℃ for 2h. Spread on LB screening plates containing erythromycin at a final concentration of 100 μg / mL and culture at 37°C for 48 hours. Randomly pick several single clones from the plate and culture them in 5 mL LB liquid culture medium containing erythromycin at a final concentration of 100 μg / mL at 37°C overnight. LB broth and agar medium were purchased from Haibo Biotechnology, with the catalog numbers HB0128 and HB0129, respectively.

[0055] 2.3 Verification of recombinant plasmid

[0056] The plasmid was extracted using Novizan FastPure Plasmid Mini Kit (Vazyme), and PCR verification was performed using the verification primers PTRKH3-VF and PTRKH3-VR. The primer sequences are shown in Table 1. After the expected results were met, they were sent for sequencing (Shanghai Qingke Biotechnology Co., Ltd.). The correct recombinant plasmids after sequencing were named pTRKH3-ldhBGFP, pTRKH3-pfkGFP, pTRKH3-addGFP, pTRKH3-gsGFP, pTRKH3-pgiGFP, pTRKH3-pgkGFP, pTRKH3-gapAGFP, and pTRKH3-enoAGFP.

[0057] 3. Construction of recombinant Lactococcus lactis strains

[0058] 50 ng of each of the above-mentioned recombinant plasmids pTRKH3-ldhBGFP, pTRKH3-pfkGFP, pTRKH3-addGFP, pTRKH3-gsGFP, pTRKH3-pgiGFP, pTRKH3-pgkGFP, pTRKH3-gapAGFP and pTRKH3-enoAGFP, as well as the commercial plasmids pTRKH3-ermGFP and pTRKH3-ldhLGFP commonly used in lactic acid bacteria were taken to transform the model Lactococcus lactis MG1363, and the recombinant strains 1363-ldhBGFP, 1363-pfkGFP, 1363-addGFP, 1363-gsGFP, 1363-pgiGFP, 1363-pgkGFP, 1363-gapAGFP and 1363-enoAGFP, 1363-ermGFP, and 1363-ldhLGFP were obtained.

[0059] The above electroporation method:

[0060] ① Activate Lactococcus lactis MG1363 in GM17 liquid medium overnight, transfer to SolI at a ratio of 2% and culture at 30°C until OD600 = 0.4. Collect bacterial cells by centrifugation at 4°C and 6000rpm for 10 minutes, wash the bacterial cells twice with SolII, and resuspend the bacterial cells in SolII with 1 / 50 of the original culture volume to prepare competent cells;

[0061] ② Add 50 ng of plasmid to the competent cells, pipette to mix well, and transfer them together to the pre-cooled electroporation cup.

[0062] ③ Set the electroporation parameters of the electroporator as follows: voltage 2000V, capacitance 20μF, resistance 200Ω. Place the electroporation cup into the electroporator and perform an electric shock.

[0063] ④ Aspirate the cells in the electroporation cup and add 1 mL of SGM17 liquid culture medium. After incubation at 30°C for 2 h, spread on a GM17 plate containing 10 μg / mL erythromycin and incubate at 30°C for 48 h.

[0064] The SolI formula is: 10 g / L glycine and 170 g / L sucrose are added to GM17 liquid culture medium.

[0065] SolII formula is: 170g / L sucrose, 10% glycerol.

[0066] The formula of SGM17 culture medium is: 76.3g / L sucrose, 4g / L magnesium chloride, and 22g / L calcium chloride are added to GM17 liquid culture medium.

[0067] M17 broth medium and agar medium were purchased from Haibo Biotechnology, with the item numbers HB0391 and HB0390 respectively. GM17 liquid medium was obtained by adding 0.5% glucose to M17 broth medium. GM17 plate was obtained by adding agar to GM17 liquid medium.

[0068] 4. Transcription intensity analysis

[0069] The constructed recombinant Lactococcus lactis 1363-ldhBGFP, 1363-pfkGFP, 1363-addGFP, 1363-gsGFP, 1363-pgiGFP, 1363-pgkGFP and 1363-enoAGFP were respectively cultured at 30°C in GM17 medium containing 10 μg / mL erythromycin until the logarithmic growth phase (about 8 h). 1 mL of the bacterial solution was taken and centrifuged at 10000 rpm for 3 min at 4°C to collect the bacteria. The bacteria were washed twice with PBS and finally resuspended with 1 mL of PBS. Lactococcus lactis MG1363 was named 1363 as a negative control, and the relative fluorescence intensity per unit OD was measured, where the excitation light was 485 nm and the emission light was 528 nm.

[0070] The results are as follows Figure 3 ,Depend on Figure 3 It can be seen that the transcription intensity of the recombinant strain 1363-enoAGFP containing the enolase promoter is significantly better than that of the recombinant strains containing other endogenous promoters.

[0071] Example 2

[0072] The recombinant strain 1363-enoAGFP containing the enolase promoter constructed in Example 1 was compared with the recombinant strains 1363-ldhLGFP and 1363-ermGFP containing commercial promoters, according to the transcription intensity analysis method described in Example 1.

[0073] The results are as follows Figure 4 ,Depend on Figure 4 It can be seen that the transcription intensity of the recombinant strain containing the enolase promoter is 32.61 and 51.40 times higher than that of the recombinant bacteria containing the commercial promoters Perm and PldhL, respectively.

[0074] Example 3

[0075] The recombinant strain 1363-enoAGFP containing the enolase promoter and the recombinant strain 1363-gapAGFP containing the glyceraldehyde 3-phosphate dehydrogenase promoter constructed in Example 1 were compared. The method was referred to the transcription intensity analysis method described in Example 1, and the measurement was performed every 3 hours.

[0076] The results are as follows Figure 5 ,Depend on Figure 5 It can be seen that after static culture at 30℃ for 12h in GM17 medium containing 10μg / mL erythromycin, the expression intensity of PenoA is 3.38 times that of PgapA. 10μL of bacterial solution in the logarithmic growth period (about 8h) was taken to make a sample and observed under a fluorescence microscope with a 40× objective lens. The results are as follows Figure 6 As shown, the brightness of 1363-enoAGFP is stronger than that of 1363-gapAGFP.

[0077] Example 4

[0078] The recombinant vector pTRKH3-enoAGFP containing the enolase promoter constructed in Example 1 was transformed into the competent cells of Lactobacillus plantarum WCFS1 to obtain the recombinant strain WCFS1-enoAGFP. The competent cell preparation and electroporation method were as follows: ① Activate Lactobacillus plantarum WCFS1 in MRS medium overnight, transfer to SolI at a volume percentage of 2% and culture at 37°C until OD600=0.4. Collect the bacterial cells by centrifugation at 4°C and 6000rpm for 10min, wash the bacterial cells twice with SM Buffer, and resuspend the bacterial cells in SM Buffer with a volume of 1 / 50 of the original culture volume to obtain competent cells; ② Add 50ng of plasmid to the competent cells, mix by blowing and suction, and transfer them together to the pre-cooled electroporation cup. ③ Set the electroporation parameters of the electroporation instrument as follows: voltage 2200V, capacitance 20μF, resistance 200Ω. Put the electroporation cup into the electroporation instrument and electroshock. ④ Aspirate the cells in the electroporation cup and add 1 mL of SMRS medium. Incubate at 37°C for 2 h, then spread on an MRS plate containing 10 μg / mL erythromycin and incubate at 37°C for 48 h.

[0079] SolI formula: 13.664 g sorbitol, 1.0 g glycine, add MRS liquid medium to 100 mL;

[0080] The formula of SM Buffer is: 32.6 g sucrose, 0.072 g magnesium chloride hexahydrate, add deionized water to make up to 100 mL;

[0081] The SMRS formula is: 13.664 g sorbitol, 0.112 g anhydrous calcium chloride, add MRS liquid culture medium to make up to 100 mL.

[0082] MRS liquid medium and agar medium were purchased from Thermo Scientific with catalog numbers CM0359B and CM0361B, respectively.

[0083] The constructed recombinant Lactobacillus plantarum WCFS1-enoAGFP was statically cultured in MRS medium containing 10 μg / mL erythromycin at 37°C until the logarithmic growth phase (about 8 hours). 10 μL of the bacterial solution was taken out to make a sample and observed under a 40× objective lens of a fluorescence microscope. The results are as follows: Figure 7 As shown, the PenoA promoter is expressed in Lactobacillus plantarum WCFS1.

[0084] Example 5

[0085] The enolase promoter and the glyceraldehyde 3-phosphate dehydrogenase promoter selected in Example 1 were used to express the codon-optimized human interleukin 10, the Accession number of which on NCBI is CAG46825.1, containing 574 bases, 178 amino acids, of which the first 18 amino acids are signal peptides, and the protein molecular weight is 19.5 kDa. The human interleukin 10 fragment was codon-optimized, and the optimized sequence is shown in SEQ ID No. 3. The optimized human interleukin 10 fragment was synthesized by GenScript Biotech Co., Ltd.

[0086] 5.1 Amplification and recovery of human interleukin-10 fragments

[0087] Two pairs of primers, enoA10-F (upstream primer), hIL10-R (downstream primer) and gapA10-F (upstream primer), hIL10-R (downstream primer), were used to amplify the optimized human interleukin 10 fragments, respectively. The primer sequences are shown in Table 1. Two PCR products were obtained after amplification. The PCR products were recovered using the Novezan FastPure Gel DNA Extraction Mini Kit (Vazyme).

[0088] 5.2 Construction of recombinant strain expressing human interleukin-10

[0089] The recovered PCR fragments were used as primers to construct recombinant plasmids PTRKH3-enoA-hIL10 and PTRKH3-gapA-hIL10 by fusion PCR. After the recombinant plasmids were verified to be correct, they were transformed into Lactococcus lactis MG1363 to construct recombinant strains 1363-enoAhIL10 and 1363-gapAhIL10. The recombinant plasmid construction method, verification method and construction method of Lactococcus lactis recombinant strains were all referred to the method described in Example 1.

[0090] 5.3 Western-Blot detection of human interleukin 10

[0091] (1) Sample preparation

[0092] The constructed recombinant Lactococcus lactis 1363-enoAhIL10 and 1363-gapAhIL10 were respectively cultured at 30°C in GM17 medium containing 10μg / mL erythromycin, cultured to the late logarithmic growth period (about 12h), and inoculated again at 2% in GM17 containing 10μg / mL erythromycin at 30°C to the logarithmic growth period (about 8h). The bacteria were collected by centrifugation at 6000rpm for 5min; the bacteria were ultrasonically broken, the broken bacteria were centrifuged, and the supernatant was collected; 80μL of the supernatant was mixed with 20μL 5×Loading buffer, and the metal bath was placed at 100℃ for 10min to obtain the loading samples of 1363-enoAhIL10 and 1363-gapAhIL10.

[0093] (2) Polyacrylamide gel electrophoresis (SDS-PAGE)

[0094] Using SuperPAGE TM Add 3 μL of marker, 20 μL of 1363-enoAhIL10 sample, and 20 μL of 1363-gapAhIL10 sample to each lane of the 12% precast gel, and perform electrophoresis at a constant voltage of 80 V until the junction of the concentrated gel and the separation gel, and adjust the voltage to 120 V. Continue electrophoresis until the target protein is at 2 / 3 of the separation gel or when the bromophenol blue is about 1.5 cm from the bottom of the gel.

[0095] (3) Transfer

[0096] Gently lay the PVDF membrane on the gel, then clamp the membrane surface and the gel surface with three layers of filter paper and sponge respectively, and use a glass rod to drive away bubbles. When placing the electrotransfer plate, remember that the PVDF membrane is at the anode. Add electrotransfer buffer, 250mA per transfer tank, transfer for 1.5-2.5h, and place the device in an ice-water mixture.

[0097] (4) Blocking and incubation

[0098] Rinse the electrotransferred PVDF membrane gently with TBST solution, then add 1× protein-free fast blocking solution. Primary antibody incubation: Add different concentrations of primary antibody according to the requirements of the corresponding antibody instructions and place at 4°C overnight. Wash the membrane: Use TBST three times, 10 minutes each time. Secondary antibody incubation: Prepare the corresponding secondary antibody for the primary antibody and incubate at 4°C for 1-2 hours. Wash the membrane: Wash three times with TBST, 10 minutes each time. Luminescence analysis: Use Omni-ECL TM Enhanced chemiluminescence detection kit was used for color development, and gel imaging analyzer and ImageLab software were used for photography.

[0099] SuperPAGE TM Precast gel, PVDF membrane, 1× protein-free rapid blocking buffer, TBST and Omni-ECL TM The enhanced chemiluminescence detection kit was purchased from Yamei; the primary antibody and secondary antibody were purchased from Proteintech.

[0100] The results are as follows Figure 8 As shown by Figure 8 It can be seen that the expression level of 1363-enoAhIL10 is higher than that of 1363-gapAhIL10. The protein areas of ImageJ grayscale analysis are 60246 and 10487, respectively. The expression level of 1363-enoAhIL10 is 5.74 times that of 1363-gapAhIL10.

[0101] Example 6

[0102] The nucleotide sequences of the -35 region and -10 region of the promoter PenoA were kept unchanged, and the nucleotide sequences between and before and after the core regions were randomly mutated by fusion PCR using the plasmid pTRKH3-enoAGFP as a template. The upstream primer for random mutation was enoLBF, and the downstream primer was enoLBR. The sequence is shown in Table 1. The construction and verification of the mutant plasmids were all based on the construction and verification methods of the recombinant plasmid described in Example 1. Finally, 8 mutant plasmids were obtained, and the sequences after mutation were sequenced to obtain the sequences shown in the sequence table SEQ ID No. 4 to SEQ ID No. 11.

[0103] The eight mutant plasmids were electrotransformed into Lactococcus lactis MG1363 to construct recombinant strains. The electrotransformation method was referred to the construction method of the recombinant strain of Lactococcus lactis described in Example 1. The recombinant strains were named 1363-mu1GFP (corresponding to SEQ ID No. 4), 1363-mu2GFP (corresponding to SEQ ID No. 5), 1363-mu3GFP (corresponding to SEQ ID No. 6), 1363-mu4GFP (corresponding to SEQ ID No. 7), 1363-mu5GFP (corresponding to SEQ ID No. 8), 1363-mu6GFP (corresponding to SEQ ID No. 9), 1363-mu7GFP (corresponding to SEQ ID No. 10) and 1363-mu8GFP (corresponding to SEQ ID No. 11). The above 8 recombinant strains containing mutant promoters and the original strain 1363-enoAGFP were inoculated into GM17 medium containing 10 μg / mL erythromycin and cultured at 30°C until the logarithmic growth phase (about 8 h). 1 mL of bacterial solution was taken and centrifuged at 10000 rpm at 4°C for 3 min to collect the bacteria. The bacteria were washed twice with PBS and finally resuspended with 1 mL of PBS to measure the relative fluorescence intensity per unit OD, where the excitation light was 485 nm and the emission light was 528 nm.

[0104] The results are as follows Fig. 9 ,Depend on Fig. 9 It can be seen that 1363-mu1GFP, 1363-mu2GFP, 1363-mu3GFP, 1363-mu4GFP, 1363-mu5GFP, 1363-mu6GFP, 1363-mu7GFP and 1363-mu8GFP all underwent different types of mutations around -10 and -35, and the fluorescence intensities after mutation were 36.01%, 5.5%, 10.82%, 183.25%, 8.9%, 4.88%, 430.28% and 21.64% of the original strain 1363-enoAGFP, respectively, obtaining a wider promoter transcription intensity spectrum.

Claims

1. A lactic acid bacteria constitutive promoter, characterized in that The nucleotide sequence of the promoter is shown in SEQ ID No.

10.

2. An expression cassette comprising the promoter according to claim 1.

3. A recombinant vector comprising the promoter according to claim 1.

4. The recombinant vector according to claim 3, characterized in that The recombinant vector is obtained by introducing the promoter and reporter gene into a plasmid.

5. The recombinant vector according to claim 4, characterized in that The plasmids include the pTRKH3 plasmid.

6. The recombinant vector according to claim 4, characterized in that The reporter gene includes a green fluorescent protein gene or a human interleukin 10 gene codon-optimized for lactic acid bacteria. The nucleotide sequence of the green fluorescent protein reporter gene is shown in SEQ ID No.2, and the nucleotide sequence of the human interleukin 10 gene is shown in SEQ ID No.

3.

7. A recombinant strain, characterized in that: The recombinant strain is obtained by introducing the recombinant vector described in any one of claims 3 to 6 into a host bacterium.

8. The recombinant strain according to claim 7, characterized in that The host bacteria include Lactococcus or Lactobacillus.

9. Use of the lactic acid bacteria constitutive promoter according to claim 1, the expression cassette according to claim 2, the recombinant vector according to any one of claims 3 to 6, or the recombinant strain according to claim 7 or 8 in enhancing gene expression intensity.

10. The use according to claim 9, characterized in that: The genes include genes encoding lycopene or gamma-aminobutyric acid.

Images