SNP Molecular Markers Related to Wheat Salt Tolerance and Their Applications
By developing SNP molecular markers in the 5’UTR region of the chromosome TraesCS2B02G377100 gene in wheat 2B, combined with KASP marking technology, the problem of indistinguishable salt tolerance in wheat varieties was solved, and efficient and low-cost breeding selection and early prediction were achieved.
Patent Information
- Application Number
- CN202411259530.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-10
- Publication Date
- 2025-08-05
- Estimated Expiration
- 2044-09-10
AI Technical Summary
The prior art is difficult to efficiently distinguish and select the salt tolerance of wheat varieties, resulting in high breeding costs and low efficiency, and the detection methods are greatly affected by the environment.
The SNP molecular marker of the base polymorphism site C/T of the 5’UTR region of the chromosome TraesCS2B02G377100 gene of wheat 2B was developed, and specific primers were designed, and genotype identification was performed through KASP marking technology, and CC or TC wheat plants were screened as individuals with strong salt tolerance.
It significantly improves the accuracy and efficiency of wheat breeding selection, reduces breeding costs, is fast and does not affect the environment, and can predict and screen wheat varieties with strong salt tolerance in the early stage.
Smart Images
Figure CN118834995B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of molecular genetic breeding, in particular to SNP molecular markers related to wheat salt tolerance and applications thereof. Background Art
[0002] Wheat is an important food crop worldwide and also in my country. Its yield is closely linked to national food security and people's living standards. Soil salinization is one of the major abiotic stresses facing wheat production. For example, in my country's northern winter wheat region, the wheat planting area and total wheat production typically account for over 60% of the national total. However, wheat production areas overlap significantly with soil salinization zones, such as the coastal saline-alkali zone (1.005 million hectares) and the Huanghuaihai saline-alkali zone (670,000 hectares), severely impacting wheat yields. Therefore, breeding new salt-tolerant wheat varieties and fully utilizing saline-alkali land resources have become urgent challenges for sustainable agricultural development.
[0003] Salt tolerance varies significantly between different genotypes of the same wheat variety or between different wheat varieties. This is because wheat salt tolerance is a complex quantitative trait controlled by multiple genes. With the rapid development of molecular biology, genome-wide association studies (GWAS) are becoming a new and effective genetic testing method. Compared with traditional QTL mapping, GWAS can use genome-wide mapped SNPs as molecular markers to analyze complex traits. In addition, GWAS has higher mapping resolution, more alleles, a wider reference population, and less research time required to establish associations. It has been successfully applied to the discovery of candidate genes for important agronomic traits in rice, potato, wheat, soybean, and other crops.
[0004] Numerous studies have demonstrated the effectiveness and reliability of GWAS for identifying molecular markers and candidate genes associated with complex quantitative traits. Oyiga et al. conducted genome-wide association analysis using 150 germplasm accessions and identified 187 single-nucleotide polymorphisms (SNPs) associated with salt tolerance. Yu et al. conducted genome-wide association analysis using 307 germplasm accessions and identified 117 loci associated with salt tolerance at the seedling stage, distributed on chromosomes 1A, 3B, and 6B, respectively, explaining 1.98%–8.92% of the phenotypic variation. Chaurasia et al. conducted genome-wide association analysis using 135 germplasm accessions and identified 42 QTNs associated with salt tolerance. Hu et al. conducted genome-wide association analysis using 191 germplasm accessions and identified 389 SNPs associated with salt tolerance, with a phenotypic explanation rate of 9.14–50.45%.
[0005] These studies demonstrate that GWAS has become an important method for studying the mechanisms of genetic variation in wheat traits and molecular-assisted breeding techniques. It is a powerful tool for studying the inheritance of complex quantitative traits. Further development of molecular markers based on this approach can quickly and easily identify relevant crop traits. This method can be used to identify molecular markers and candidate genes associated with salt tolerance in wheat, and the results can provide an effective reference for the selection and breeding of new wheat lines. Summary of the Invention
[0006] The purpose of the present invention is to provide a SNP molecular marker related to salt tolerance of wheat and its application, so as to solve the problems existing in the above-mentioned prior art.
[0007] To achieve the above object, the present invention provides the following solutions:
[0008] One of the technical solutions of the present invention is a SNP molecular marker related to wheat salt tolerance, which is located in the 5'UTR region of the TraesCS2B02G377100 gene on wheat chromosome 2B; located at position 540424987 on wheat chromosome 2B, with a base polymorphic site C / T.
[0009] The second technical solution of the present invention is a specific primer, which includes upstream primers as shown in SEQ ID NO.2 and SEQ ID NO.3 and a downstream primer as shown in SEQ ID NO.4.
[0010] The third technical solution of the present invention is a product for identifying salt tolerance of wheat, comprising the specific primers.
[0011] The fourth technical solution of the present invention is the application of the SNP molecular marker or the specific primer in wheat breeding.
[0012] The fifth technical solution of the present invention is a method for identifying the salt tolerance of wheat using the SNP molecular marker, extracting the genomic DNA of the wheat to be tested, detecting the genotype of the SNP molecular marker, and the salt tolerance of wheat plants with genotype CC or TC is significantly higher than that of individuals with genotype TT.
[0013] The sixth technical solution of the present invention is a method for screening salt-tolerant wheat, which comprises extracting genomic DNA of the wheat to be tested, detecting the genotype of the SNP molecular marker, and finding that the salt tolerance of wheat plants with genotype CC or TC is significantly higher than that of individuals with genotype TT.
[0014] Based on the above technical solution, the present invention has the following technical effects:
[0015] The present invention discovered a SNP molecular marker related to wheat salt tolerance. This molecular marker can be applied to wheat salt tolerance breeding, greatly reducing breeding costs, improving breeding selection efficiency, and being able to significantly distinguish the salt tolerance of different wheat germplasm resources. The detection method is convenient and rapid and is not affected by the environment. BRIEF DESCRIPTION OF THE DRAWINGS
[0016] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0017] Figure 1 This is a Manhattan plot of the genome-wide association analysis of salt tolerance in wheat according to the present invention. The horizontal axis represents the chromosome location of each SNP, and the vertical axis represents the negative logarithm (base 10) of the P value of each SNP under the MLM model. wsnp_Ex_c8894_14858193 is a significant SNP.
[0018] Figure 2 This is a QQ plot of the whole-genome association analysis of wheat salt tolerance in an embodiment of the present invention. The horizontal axis represents the negative logarithm of the expected SNP site P value with base 10, and the vertical axis represents the negative logarithm of the actual SNP site P value with base 10.
[0019] Figure 3 This is the KASP typing diagram of the embodiment of the present invention, where red dots represent CC genotype, blue dots represent TT genotype, and green dots represent TC genotype.
[0020] Figure 4 This is a violin analysis diagram of the D values of three wheat genotypes in the embodiment of the present invention. DETAILED DESCRIPTION
[0021] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0022] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each smaller range between any intermediate value within a stated value or stated range and any other stated value or intermediate value within the stated range is also encompassed by the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.
[0023] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.
[0024] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the present invention. The present description and examples are intended to be illustrative only.
[0025] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.
[0026] The technical solutions described in the present invention, unless otherwise specified, are all conventional solutions in the art, and the reagents or raw materials used, unless otherwise specified, are purchased from commercial channels or are publicly available.
[0027] The wheat materials used in the present invention were obtained from the Key Laboratory of Arid Alkali Wheat of Hebei Province (Crop Genetics and Breeding Research Institute of Cangzhou Academy of Agriculture and Forestry Sciences). The biochemical reagents used in the present invention were all commercially available.
[0028] The present invention provides a SNP molecular marker related to salt tolerance in wheat. The SNP molecular marker is located in the 5'UTR region of the TraesCS2B02G377100 gene on wheat chromosome 2B. The SNP molecular marker is located at position 540424987 on wheat chromosome 2B and has a base polymorphic site C / T.
[0029] The embodiment of the present invention also provides specific primers, including upstream primers shown as SEQ ID NO.2 and SEQ ID NO.3 and a downstream primer shown as SEQ ID NO.4.
[0030] An embodiment of the present invention also provides a product for identifying salt tolerance of wheat, comprising the specific primers.
[0031] The embodiments of the present invention also provide applications of the SNP molecular marker or the specific primer in wheat breeding.
[0032] The embodiment of the present invention also provides a method for identifying salt tolerance of wheat using the SNP molecular marker, extracting genomic DNA of the wheat to be tested, detecting the genotype of the SNP molecular marker, and the salt tolerance of wheat plants with genotype CC or TC is significantly higher than that of individuals with genotype TT.
[0033] The present invention also provides a method for screening salt-tolerant wheat. The method comprises extracting genomic DNA of the wheat to be tested, detecting the genotype of the SNP molecular marker, and finding that the salt tolerance of wheat plants with genotype CC or TC is significantly higher than that of individuals with genotype TT.
[0034] Example 1
[0035] (1) Test materials
[0036] A natural population consisting of 275 wheat germplasm resources was used as the test material. This population has a wide range of origins, rich genetic variation, and large differences in salt tolerance, making it suitable for genome-wide association analysis of salt tolerance-related traits.
[0037] Table 1275 wheat germplasm information
[0038]
[0039]
[0040] (2) Characteristic determination
[0041] Saline-alkali soil experiment: From 2020 to 2021, seedlings were planted at the Zhongjie Bojie Seed Industry experimental site in Huanghua City (38°24′N, 117°31′E, 5.4m above sea level). Two rows of each variety were planted, 1.5m long, with a row spacing of 0.25m. Sixty seeds were sown per row, with three replicates. The base fertility of the experimental site was 12.31g / kg organic matter, 1.19g / kg total nitrogen, 34.46mg / kg available phosphorus, and 198.32mg / kg available potassium. The total salt content was 0.27-0.36%, and the pH was 8.94. Sowing took place on October 9th, and all other management procedures were the same as for the field.
[0042] A field experiment was conducted from 2020 to 2021 at the Qianying Experimental Station of the Cangzhou Academy of Agricultural and Forestry Sciences. Each variety was planted in two rows, 1.5 m long and 0.25 m apart. Sixty seeds were sown per row, with three replicates. The base fertility of the experimental site was 13.12 g / kg organic matter, 1.79 g / kg total nitrogen, 38.74 mg / kg available phosphorus, 202.17 mg / kg available potassium, 0.07% total salt, and a pH of 6.84. Planting was done on October 9th, and all other management procedures were the same as for the field. This experiment is designated as CK.
[0043] Seedling surveys were conducted after the return of salt stress in spring. Tillering numbers per plant were manually determined, and aboveground dry and fresh weights were measured using a 1 / 10,000 balance. Fifteen plants of each variety were sampled, with three replicates. They were oven-dried at 105°C for 30 minutes, dried at 80°C to constant weight, digested with concentrated H₂SO₄-H₂O₂, and ion content was determined using an AA3 continuous flow analyzer. The salt tolerance index for each phenotypic trait was calculated using formula (1). If the measured trait showed a decreasing trend under salt stress, the membership function value was calculated using formula (2); otherwise, it was calculated using formula (3). The D value was calculated using formula (4). The D value served as the phenotypic data for the GWAS analysis.
[0044] (1) Salt tolerance index = (measured value of salt treatment / measured value of control) × 100%;
[0045] (2)U(X j )=(X j -X jmin ) / (X jmax -X jmin ), j=1,2,3……
[0046] (3)U(X j )=1-[(X j -X jmin ) / (X jmax -X jmin )],j=1,2,3……
[0047] (Four)
[0048] The salt tolerance traits of wheat under salt stress were characterized by the number of tillers per plant (NT), aboveground fresh weight (SFW), aboveground dry weight (SDW), aboveground K + Content (SKC), aboveground Na + Content (SNaC) and aboveground Ca 2+ The salt tolerance index of each salt tolerance trait is calculated based on the salt content (SCaC). Because traits often have different measurement units, they will result in different change trends. Therefore, to prevent changes in a single trait from affecting the overall results, it is necessary to first calculate the salt tolerance coefficient of a specific indicator. Then, using the membership function method, the salt tolerance coefficient of each material is expanded to the closed interval [0,1] so that the different indicator data can be calculated uniformly. Finally, the D value is calculated as the evaluation index of wheat salt tolerance. D values greater than 0.449 indicate high salt tolerance; between 0.419-0.449 indicate salt tolerance; between 0.379-0.419 indicate moderate salt tolerance; between 0.349-0.379 indicate salt-sensitive; and less than 0.349 indicates severe salt sensitivity.
[0049] Table 2 D values of 275 wheat germplasm resources
[0050]
[0051]
[0052]
[0053]
[0054]
[0055] (3) GWAS analysis and SNP molecular marker determination
[0056] Combined with the D value of wheat after salt stress measured above, the D value of salt tolerance-related traits was used as the relevant identification index, and the mixed linear model (PCA+K) in the GAPIT program package was used for genome-wide association analysis. The P value threshold was calculated according to the method described by Li et al. (P = 1 / n, n = the total number of SNPs used), and the standard for identifying significant SNPs was -log 10 P>4. The CMplot (https: / / cran.r-project.org / web / packages / CMplot / ) package in R was used to draw a Manhattan plot to visualize the sites. The results showed that a SNP marker wsnp_Ex_c8894_14858193 located on chromosome 2B was significantly associated with the D value. This SNP is located at the 527797394th base of chromosome 1. The threshold value is greater than 4. The SNP site is a C / T difference (see Figure 1 ).
[0057] The wheat salt tolerance-related SNP molecular marker wsnp_Ex_c8894_14858193 is located in the 5'UTR region of the TraesCS2B02G377100 gene on wheat chromosome 2B, specifically at the C / T base at position 540424987 on wheat chromosome 2B.
[0058] The sequence of the SNP molecular marker is shown in SEQ ID NO.1:
[0059] SEQ ID NO.1: TGGGGGCAGATTTTGGAGAACTCTTGGTCTAAGGTGTGAGAG ATTTGGAGGTATATTTTGGACAACTTGTGGCCTAAAGTGAGATAGGTCTGGAGGC AAA [T]TATTGTGTCCGTCAGCGTGCTAATTTGGGACATCGGATACAAATGAGGCAC AGCACACTTCTTTACTGGAGGACCGGAGACAGATAACGTTATGGTAGCC.
[0060] Note: The underlined positions are SNP sites.
[0061] (4) Haplotype analysis
[0062] Haplotype analysis was performed by combining the SNP marker wsnp_Ex_c8894_14858193 with the D values of 94 test materials. The results are as follows Figure 3 、 4 As shown in the figure, SNP typing was divided into three groups. The D value of the CC genotype was greater than that of the TC genotype, which was greater than that of the TT genotype. This indicates that wheat with the CC or TC genotype has stronger salt tolerance, while wheat with the TT genotype has weaker salt tolerance.
[0063] Example 2
[0064] (1) Acquisition of KASP primers
[0065] Based on the above SNP locus information and combined with the wheat genome sequence information, KASP marker primers were developed:
[0066] Specific primer LZH-KASP-F15′-3′ (SEQ ID NO. 2): GAAGGTGACCAAGTTCATGCTAAGTGAGATAGGTCTGGAGGCAAAT;
[0067] Specific primer LZH-KASP-F25′-3′ (SEQ ID NO. 3): GAAGGTCGGAGTCAACGGATTGTGAGATAGGTCTGGAGGCAAAC;
[0068] Universal primer LZH-KASP-R 3'-5' (SEQ ID NO. 4): CATGAAAGTGTGCGGCG ATATGGTA.
[0069] (2) DNA extraction of 94 wheat germplasm resources in Table 3
[0070] ① Sampling: Select young leaves during the vegetative stage to ensure they are fresh, tender, free of dryness or disease, and clean and dust-free. Use a hole punch to sample eight leaves of equal size to ensure consistent sampling. Add an NTC at a different location in each 96-well plate to distinguish between blank control plates. After sampling, quickly freeze the loaded 96-well plates in liquid nitrogen or store at -80°C.
[0071] ② Extraction: Grind the frozen leaves in a 96-well plate in a high-speed grinder at 1300 rpm for 3 minutes. Centrifuge the ground leaves and place them at the bottom of the plate. Add CTAB lysis buffer, vortex to mix, and incubate in an oven at 65°C for 30 minutes. Allow the incubated leaves to stand at room temperature, centrifuge, and extract with chloroform. Mix thoroughly, then centrifuge at 4000 rpm at 4°C for 15 minutes. Transfer the supernatant to a new 96-well plate and add 0.7x isopropanol to precipitate DNA. Centrifuge and discard the supernatant. Rinse twice with 75% ethanol. Air dry the DNA, dissolve it in 100 μL of 10 mM Tris-HCl, pH 8.0, and store in the refrigerator until use.
[0072] ③Quality inspection: KASP DNA sample OD concentration: ≥25ng / μL; sample concentration uniformity is good; purity: OD 260 / 230 >=1, 1.5<=260 / 280<=2.2; DNA solution has no obvious color or impurities.
[0073] (3)PCR
[0074] The PCR amplification system for LGC was 1.5 μL DNA, 0.75 μL 2× Master mix, 0.0417 μL primers, and 0.75 μL sterile water. The Dougals system was 0.8 μL DNA, 0.4 μL 2× Master mix, 0.022 μL primers, and 0.4 μL sterile water.
[0075] The procedure is as follows:
[0076] Denaturation at 94°C for 15 mins, denaturation at 94°C for 20 s, annealing / extension at 61-55°C for 60 s (0.6°C decrease per cycle), 10 cycles, denaturation at 94°C for 20 s, annealing / extension at 55°C for 60 s, 26 cycles.
[0077] (4) Fluorescence signal reading
[0078] After the KASP detection PCR reaction program is completed, the 96-well plate is placed on the Omega fluorescence signal reader and Araya to convert the fluorescence signal into analyzable values, and then the genotype analysis is performed using the analysis software KrakenTM provided by LGC.
[0079] (5) After the reaction is completed, the reaction products are sequenced for genotyping identification. The results show that the SNP site variation is as follows Figure 3 As shown in the figure, the marker can accurately and clearly cluster the test materials with the same genotype. At the same time, the negative control NTC does not produce any signal and is always clustered together. The marker has a good effect on distinguishing different genotypes.
[0080] Example 3
[0081] The efficiency of KASP markers was verified using 94 wheat germplasm resources as shown in Table 3. The D values were calculated and the germplasm was divided into groups according to genotype.
[0082] Table 3 D values of 94 wheat germplasm resources
[0083]
[0084]
[0085] As shown in Table 3, based on the 94 germplasm resources in Table 3, the efficiency of KASP marker was verified. There were 48 samples with CC genotype, and the D value was 0.40-0.499; there were 10 samples with TC genotype, and the D value was 0.360-0.399; there were 36 samples with TT genotype, and the D value was 0.225-0.359.
[0086] In summary, the present invention obtains the SNP molecular marker wsnp_Ex_c8894_14858193 related to wheat salt tolerance by using the method of whole genome association analysis. The SNP molecular marker is located in the 5'UTR region of the TraesCS2B02G377100 gene on wheat chromosome 2B, specifically at position 540424987, with a base polymorphic site C / T. By identifying the genotype of the SNP site, wheat with a genotype of CC is screened for salt tolerance. This is used as an auxiliary selection marker for salt tolerance in wheat breeding, which can effectively improve the accuracy of wheat variety selection. The present invention can be used for early prediction and screening of wheat salt tolerance, and helps to accelerate the breeding process of salt-tolerant wheat varieties.
[0087] Obviously, the above embodiments of the present invention are merely examples for the purpose of clearly illustrating the present invention and are not intended to limit the embodiments of the present invention. A person skilled in the art will be able to make other variations or modifications based on the above description. It is not necessary and impossible to enumerate all embodiments here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention shall be included within the scope of protection of the claims of the present invention.
Claims
1. Application of specific primers in wheat salt tolerance breeding, characterized in that: Specific primers were used to detect the genotype of SNP molecular markers in the wheat genomic DNA. Wheat plants with CC or TC genotypes showed significantly higher salt tolerance than those with TT genotypes. The specific primers include upstream primers as shown in SEQ ID NO.2 and SEQ ID NO.3 and a downstream primer as shown in SEQ ID NO.4; The SNP molecular marker is located on wheat chromosome 2B TraesCS2B02G377100 The 5'UTR region of the gene is located at position 540424987 on wheat chromosome 2B, and its bases are C / T.
2. A method for identifying salt tolerance of wheat, characterized in that: The genotype of the SNP molecular marker in the wheat genomic DNA was detected. The salt tolerance of wheat plants with genotype CC or TC was significantly higher than that of individuals with genotype TT. The SNP molecular marker is located on wheat chromosome 2B TraesCS2B02G377100 The 5'UTR region of the gene is located at position 540424987 on wheat chromosome 2B, and its bases are C / T.
3. A method for screening salt-tolerant wheat, characterized in that: The genotype of the SNP molecular marker in the wheat genomic DNA was detected. The salt tolerance of wheat plants with genotype CC or TC was significantly higher than that of individuals with genotype TT. The SNP molecular marker is located on wheat chromosome 2B TraesCS2B02G377100 The 5'UTR region of the gene is located at position 540424987 on wheat chromosome 2B, and its bases are C / T.