Method for improving thermal stability and acid stability of glucose oxidase, mutant GoxM12, gene and application

Abstract

The present invention relates to the field of genetic engineering, and in particular to a method for improving the thermal stability and acid stability of glucose oxidase, a mutant GoxM12, a gene and an application thereof. After site-directed mutagenesis of GoxM10, a mutant E361P / A419I / Q241E / R499E (GoxM12) with improved acid stability and thermal stability is obtained. The glucose oxidase mutant of the present invention has good enzymatic properties and can be applied to industries such as food and feed.

Description

Technical Field

[0001] The invention relates to the field of genetic engineering, and in particular to a method for improving the thermal stability and acid stability of glucose oxidase, a mutant GoxM12, a gene and an application thereof. Background Art

[0002] Glucose oxidase (Gox) is an aerobic dehydrogenase that can specifically oxidize β-D-glucose into gluconic acid and hydrogen peroxide. As a new feed enzyme preparation that replaces antibiotics, glucose oxidase has many functions, such as improving the balance of animal intestinal microecology and intestinal digestive environment, protecting intestinal health, improving feed utilization, promoting animal growth, and improving body immunity. It has been widely used in the feed industry.

[0003] In Chinese patent CN 108893453 A, the Aspergillus niger The glucose oxidase GOD was used as the parent, and after multiple mutations, a mutant GOD-M5 with improved thermal stability was obtained, but it still could not meet industrial requirements.

[0004] Chinese patent CN112301009A provides a Aspergillus niger A series of mutants of the glucose oxidase mutant GOD-M5 were synthesized. The thermal stability of the glucose oxidase mutants was significantly improved. After heat treatment at 80℃ for 2 min, the relative residual enzyme activity of GOD-M10 was increased by about 2.2 times compared with GODM5.

[0005] As a feed enzyme, it is required to maintain high enzyme activity under acidic and neutral pH conditions. However, the pH condition at which the glucose oxidase mutant GoxM10 exerts maximum enzyme activity is 6.0, and the enzyme activity is extremely low under pH stability conditions of pH 2.5-3.0.

[0006] Chinese patent CN114736879A provides a Aspergillus niger The mutant of glucose oxidase Gox, wherein the optimum temperature and optimum pH of mutant E361P / A419I are 40°C and pH 6.0 respectively, and the half-life at 65°C is 578 min, which is 1.5 times that of GoxM10. Aspergillus niger The optimal temperature and pH of mutant Q241E / R499E were 40 ℃ and 5.0, respectively. After treatment at pH 2.5 and 37 ℃ for 60 min, the enzyme activity of mutant Q241E / R499E was 15.89%, which was 144.46% higher than that of GoxM10.

[0007] In order to obtain Gox with improved thermal stability and acid stability, protein engineering technology is used to improve the thermal stability and acid stability of the highly thermally stable glucose oxidase mutant GoxM10, which becomes an important means to achieve this goal. Summary of the invention

[0008] In order to further optimize the Aspergillus niger The present invention was proposed and completed based on the enzymatic properties of the highly thermostable glucose oxidase mutant GoxM10.

[0009] The object of the present invention is to provide a glucose oxidase mutant with improved thermal stability and acid stability.

[0010] Another object of the present invention is to provide a gene encoding the above-mentioned glucose oxidase mutant.

[0011] Another object of the present invention is to provide a recombinant vector comprising the gene encoding the above-mentioned glucose oxidase mutant.

[0012] Another object of the present invention is to provide a recombinant strain comprising the above-mentioned glucose oxidase mutant encoding gene.

[0013] Another object of the present invention is to provide a method for preparing glucose oxidase with improved thermal stability and acid stability.

[0014] Another object of the present invention is to provide the application of the above-mentioned glucose oxidase mutant.

[0015] Another object of the present invention is to provide a method for improving the thermal stability and acid stability of glucose oxidase.

[0016] The invention mutates a high-thermostability glucose oxidase mutant GoxM10 to obtain a glucose oxidase mutant with improved thermal stability and acid stability, wherein the amino acid sequence of the parent glucose oxidase mutant GoxM10 is shown in SEQ ID NO:1.

[0017] SEQ ID NO: 1:

[0018] .

[0019] According to a specific embodiment of the present invention, the 241st amino acid of the glucose oxidase mutant GoxM10 is mutated from Gln to Glu, the 361st amino acid is mutated from Glu to Pro, and the 419th amino acid is mutated from Ala to Ile to obtain the mutant Q241E / E361P / A419I.

[0020] Furthermore, the 241st amino acid of the glucose oxidase mutant GoxM10 was mutated from Gln to Glu, the 361st amino acid was mutated from Glu to Pro, the 419th amino acid was mutated from Ala to Ile, and the 499th amino acid was mutated from Arg to Glu to obtain the mutant Q241E / R499E / E361P / A419I, i.e., the mutant GoxM12. The amino acid sequence of the glucose oxidase mutant GoxM12 is shown in SEQ ID NO:2.

[0021] As shown in SEQ ID NO: 2:

[0022] .

[0023] According to a specific embodiment of the present invention, the coding gene sequence of the glucose oxidase mutant GoxM12 is shown in SEQ ID NO:3.

[0024] SEQ ID NO:3:

[0025]

[0026] The method for improving the acid thermal stability of glucose oxidase according to the present invention comprises the following steps:

[0027] The glucose oxidase mutant GoxM10 was subjected to four point mutations: the 241st amino acid was mutated from Gln to Glu, the 499th amino acid was mutated from Arg to Glu, the 361st amino acid was mutated from Glu to Pro, and the 419th amino acid was mutated from Ala to Ile.

[0028] The present invention provides a recombinant vector comprising the coding gene of the glucose oxidase mutant.

[0029] The present invention also provides a recombinant strain comprising the coding gene of the above-mentioned glucose oxidase mutant. Preferably, the starting strain of the recombinant bacteria is specifically GS115 ( pPIC9 -goxm10) .

[0030] According to a specific embodiment of the present invention, the method for preparing glucose oxidase with improved thermal stability and acid stability is as follows:

[0031] (1) transforming a host cell with a recombinant vector containing a gene encoding a glucose oxidase mutant to obtain a recombinant strain;

[0032] (2) culturing the recombinant strain and inducing the expression of glucose oxidase;

[0033] (3) Purify the expressed glucose oxidase.

[0034] Beneficial effects of the present invention:

[0035] The present invention performs a triple-point mutation Q241E / E361P / A419I on GoxM10, and then performs a quadruple-point mutation Q241E / R499E / E361P / A419I to obtain a mutant GoxM12.

[0036] The purified GoxM10 and mutants were subjected to enzymatic reaction at pH 6.0 and 40°C to determine their enzyme activities. The enzyme activity of GoxM10 was 393.63 U / mg, and the enzyme activities of the mutant enzymes Q241E / E361P / A419I and GoxM12 of the present application were 336 U / mg and 480 U / mg, respectively, and GoxM12 was 22% higher than that of GoxM10.

[0037] The optimal temperature of GoxM10 and its mutants was 40 ℃; the optimal pH of GoxM10 and its mutants was 6.0.

[0038] After treatment at 75℃ for 12 min, the remaining enzyme activity of GoxM10 was equivalent to 36% of that before treatment; after treatment at 75℃ for 12 min, the remaining enzyme activities of mutants Q241E / E361P / A419I and GoxM12 were equivalent to 37% and 48% of that before treatment.

[0039] After treatment at pH 2.5 and 37°C for 60 min, the retained enzyme activities of mutants Q241E / E361P / A419I and GoxM12 were 12.87% and 15.32%, respectively, which were increased by 101% and 139% compared with M10.

[0040] In summary, for the mutants of the present application, the properties of the triple-point mutant Q241E / E361P / A419I are basically equivalent to those of GoxM10, while the acid stability and thermal stability of the mutant GoxM12 are significantly better than those of GoxM10.

[0041] The optimal response of the triple-point mutant Q241E / E361P / A419I and the quadruple-point mutant GoxM12 was consistent with that of GoxM10, both being 6.0. At pH 2.5 for 10, 20, 30, 40, 50 and 60 min, the relative residual enzyme activities of mutant GoxM12 were 62%, 41%, 33%, 24%, 20% and 15%, respectively, which were all higher than those of GoxM10; after treatment at pH 2.5 and 37℃ for 60 min, the retained enzyme activities of mutants Q241E / E361P / A419I and GoxM12 were 12.87% and 15.32%, respectively, which were 101% and 139% higher than those of M10; after treatment at pH 2.75 and 37℃ for 60 min, the retained enzyme activities of mutants Q241E / E361P / A419I and GoxM12 were approximately 35.26% and 42.96%, which were 47% and 79% higher than those of GoxM10, respectively.

[0042] Compared with the mutant parent GoxM10, the glucose oxidase mutant of the present invention effectively improves its acid stability without affecting the enzyme activity and thermal stability of the parent. After purification, the enzyme liquid mutants Q241E / E361P / A419I and GoxM12 retain enzyme activities of about 12.87% and 15.32% respectively after being treated at pH 2.5 and 37°C for 60 minutes, which are respectively increased by 101% and 139% compared with GoxM10. Therefore, the glucose oxidase mutant provided by the present invention can be well applied in the food and feed industries and has broad application prospects.

[0043] The present invention provides the application of the glucose oxidase mutant with improved thermal stability and acid stability, which can be specifically applied in the fields of food and feed.

[0044] The glucose oxidase mutant provided by the present invention can well meet the application in the fields of food and feed, and has a very broad application prospect. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 Shows the comparison of enzyme activities of the mutants of the present application and GoxM10;

[0046] Figure 2 Shows the comparison of the optimal reaction temperature of the mutants of the present application and GoxM10;

[0047] Figure 3 Shows the optimal reaction pH comparison between the mutants of the present application and GoxM10;

[0048] Figure 4 The thermal stability comparison between the mutant of the present application and GoxM10 treated at 75°C for 2-12 min is shown;

[0049] Figure 5 The comparison of acid stability of the mutants of the present application and GoxM10 treated at pH 2-8 is shown;

[0050] Figure 6 The comparison of acid stability between the mutant of the present application and GoxM10 treated at pH 2.5 for 10-60 min is shown. DETAILED DESCRIPTION

[0051] Experimental materials and reagents

[0052] 1. Strains and vectors: The expression host is Pichia pastoris GS115, the expression plasmid vector is pPIC9.

[0053] 2. Enzymes: endonucleases, ligases.

[0054] 3. Culture medium:

[0055] (1) Escherichia coli culture medium LB (1% peptone, 0.5% yeast extract, 1% NaCl, natural pH);

[0056] (2) Pichia pastoris medium YPD (Yeast Extract 1%, Trytone 2%, Glucose 2%, natural pH);

[0057] (3) BMGY medium (Yeast Extract 1%, Trytone 2%, YNB 10%, Biotin 0.1%, natural pH);

[0058] (4) BMMY medium (Yeast Extract 1%, Trytone 2%, Methanol 0.5%, YNB 10%, Biotin 0.1%, natural pH).

[0059] Note: The molecular biology experimental methods not specifically described in the following examples are all carried out with reference to the specific methods listed in the book Molecular Cloning Experiment Guide (3rd edition) by J. Sambrook, or according to the kits and product instructions.

[0060] Example 1. Preparation of recombinant strain GS115 (pPIC9-goxm10)

[0061] Amplification of the gene encoding the maternal hyperthermostable glucose oxidase mutant GoxM10 goxm10

[0062] Amplification by PCR goxm10 Gene fragment. The vector pPIC9 is obtained by inoculating the stored strains and then culturing them in a bottle. After amplification, the PCR product and the extracted plasmid are subjected to nucleic acid electrophoresis detection. goxm10 The band sizes of pPIC9 and pPIC9 were 1746 bp and 8088 bp respectively. EcoR I and Not After enzyme digestion, the PCR product and the enzyme digestion product are recovered and purified respectively.

[0063] The recycled goxm10 The pPIC9 gene fragment was recombined and connected using the kit recombinase, and then the recombinant product was transformed into E. coli Trans1-T1 competent cells and spread on LB (containing 100 μg / mL Ampicillin) for screening. Bgl II restriction endonucleases to recombinant plasmid pPIC9- goxm10 The product was digested by enzymes, and then electroporated into Pichia pastoris competent cells GS115 for induced expression to obtain the recombinant expression strain GS115 (pPIC9 -goxm10 ).

[0064] Example 2. Preparation of recombinant strain GS115 (pPIC9-goxm10-Q241E / E361P / A419I, pPIC9-goxm10-Q241E / R499E / E361P / A419I)

[0065] (1) Recombinant plasmid pPIC9- goxm10 -Q241E / E361P / A419I, pPIC9- goxm10 - Q241E / R499E / E361P / A419I construction

[0066] Design mutation primers according to the mutants and use plasmid pPIC9- goxm10 As a template, the mutant amino acid was introduced by a point mutation kit, and the PCR product containing the mutant amino acid was used Dpn The template was removed by digestion treatment, and the digested PCR product was transformed into E. coli Tans1-T1 competent cells, and sequenced and verified to obtain E. coli pPIC9- goxm10 -Q241E / E361P / A419I, pPIC9- goxm10 - Q241E / R499E / E361P / A419I. The primers used are as follows:

[0067] Q241E-F (SEQ ID NO:4)5'AGACCTAACTTGGAGGTTTTGACCGGTCAATACGT3',

[0068] Q241E-R (SEQ ID NO:5)5'ACCGGTCAAAACCTCCAAGTTAGGTCTTTTGGTAGT3';

[0069] R499E-F (SEQ ID NO:6)5'GATGCTGACTTGGAGGCTTGGGTTGAATACATTCC3',

[0070] R499E-R (SEQ ID NO:7)5'TTCAACCCAAGCCTCCAAGTCAGCATCGTAGGCCA3';

[0071] Gox-E361P-F (SEQ ID NO:8)5'TTCGGTGACTACACTCCAAAGGCTCACGAA3',

[0072] Gox-E361P-R (SEQ ID NO:9)5'CAATTCGTGAGCCTTTGGAGTGTAGTCACC3';

[0073] Gox-A419I-F (SEQ ID NO:10) 5'GACACTGCCGGTGAGATCTCCTTCGACGTC3',

[0074] Gox-A419I-R (SEQ ID NO: 11) 5'CCAGACGTCGAAGGAGATCTCACCGGCAGT3'.

[0075] Among them, the mutant plasmid pPIC9- goxm10-E361P After the sequencing was correct, the mutant plasmid pPIC9- goxm10-E361P / A419I After the sequencing was correct, the mutant plasmid pPIC9- goxm10-Q241E / E361P / A419I After the sequencing was correct, the mutant plasmid pPIC9- goxm10-Q241E / R499E / E361P / A419I .

[0076] (2) Construction of recombinant strain GS115 (pPIC9- goxm10 -Q241E / E361P / A419I, pPIC9- goxm10 -Q241E / R499E / E361P / A419I)

[0077] use Bgl Ⅱ The recombinant plasmid pPIC9- goxm10 -Q241E / E361P / A419I, pPIC9- goxm10 -Q241E / R499E / E361P / A419I were used for enzyme digestion, and the recovered products were transformed into Pichia pastoris competent cells GS115 by electroporation for induced expression to obtain the recombinant expression strain GS115 (pPIC9- goxm10 -Q241E / E361P / A419I, pPIC9- goxm10 -Q241E / R499E / E361P / A419I).

[0078] Example 3. Obtaining glucose oxidase GoxM10 and highly thermostable and acid-stable mutant enzyme protein Q241E / E361P / A419I (GoxM12)

[0079] 1. Inducible expression of GoxM10 and its mutants Q241E / E361P / A419I and Q241E / R499E / E361P / A419I (GoxM12)

[0080] The obtained recombinant expression strain GS115 (pPIC9 -goxm10 ) and GS115 (pPIC9- goxm10- Q241E / E361P / A419I, pPIC9 -goxm10-Q241E / R499E / E361P / A419I) were inoculated into YPD medium for seed culture. After culturing at 200 rpm and 30°C for 48 h, they were transferred to BMGY medium at a 1% inoculum amount and cultured at 200 rpm and 30°C for 48 h. After sufficient bacterial cells were enriched, the cells were collected and added to BMMY medium containing 1% methanol for induction of expression.

[0081] 2. Purification of GoxM10, Q241E / E361P / A419I, and GoxM12

[0082] The induced bacterial solution was centrifuged at 12000 rpm for 10 min, the supernatant was collected and concentrated, and then dialyzed with 10 mM disodium hydrogen phosphate solution (pH adjusted to 6.5 with citric acid). The dialyzed enzyme was then subjected to ion exchange chromatography, with solution A being 10 mM disodium hydrogen phosphate solution (pH adjusted to 6.5 with citric acid) and solution B being solution A plus 1 M NaCL. The protein was purified and the eluate was collected for SDS-PAGE analysis.

[0083] 3. Determination of properties of the mutants and parent GoxM10 of the present application

[0084] 3.1 Enzyme activity assay of mutants and parent GoxM10 of the present application

[0085] The thermal stability of the glucose oxidase mutant GoxM10 is disclosed in Chinese patent application CN201910835766.4. The optimum temperature and optimum pH of GoxM10 are 40°C and pH 6.0, respectively. The above-purified GoxM10 and its mutants were subjected to enzymatic reaction at pH 6.0 and 40°C to determine their enzyme activity. Figure 1 As shown, the enzyme activity of GoxM10 is 393.63 U / mg, and the enzyme activities of the mutant enzymes Q241E / E361P / A419I and GoxM12 of the present application are 336 U / mg and 480 U / mg, respectively, and GoxM12 is 22% higher than that of GoxM10.

[0086] 3.2 Determination of the optimal temperature of the mutant and parent GoxM10 of the present application

[0087] The optimal temperature of the mutant and GoxM10 of the present application was determined by measuring the enzyme specific activity in a 0.1 mol / L citric acid-sodium hydrogen phosphate buffer (pH 6.0) buffer system at different temperatures (20, 50, 60, 65, 70, 75 and 80°C). Figure 2 As shown, the highest specific activities of GoxM10 and mutants were used as controls, and the enzyme activity data measured at different temperatures were plotted. It was found that the optimal temperature of GoxM10 and mutants was 40 ℃.

[0088] 3.3 Determination of the optimal pH for the mutant and parent GoxM10 of the present application

[0089] The standard enzyme activity assay method for glucose oxidase is 30°C. Therefore, the optimal pH of the mutants and GoxM10 of the present application is determined by performing enzymatic reactions at different pH (pH 2.0-8.0, 0.1 mol / L sodium hydrogen phosphate-citrate buffer) at 30°C to determine their optimal pH. Figure 3 As shown, the highest specific activities of GoxM10 and mutants were used as controls, and the enzyme activity data measured at different temperatures were plotted. It was found that the optimal pH for GoxM10 and mutants was 6.0.

[0090] 3.4 Thermal stability determination of mutants and parent GoxM10 of the present application

[0091] The thermal stability of the mutants and GoxM10 of the present application was determined by treating them in a 0.1 mol / L citric acid-sodium hydrogen phosphate buffer (pH 6.0) buffer system at 75°C for different time periods (2-12 min), and then determining the residual enzyme activity at 30°C. Figure 4 As shown in the figure, the residual enzyme activities of the triple-point mutant Q241E / E361P / A419I were 78%, 56%, 49%, 47%, 41%, and 37% when treated at 75℃ for 2, 4, 6, 8, 10, and 12 minutes, respectively. The residual enzyme activities of the quadruple-point mutant GoxM12 were 98%, 83%, 73%, 67%, 57%, and 48% when treated at 75℃ for 2, 4, 6, 8, 10, and 12 minutes, respectively. After GoxM10 was treated at 75℃ for 12 minutes, the residual enzyme activity was equivalent to 36% of that before treatment; after mutants Q241E / E361P / A419I and GoxM12 were treated at 75℃ for 12 minutes, the residual enzyme activities were equivalent to 37% and 48% of that before treatment.

[0092] 3.5 Acid stability test of the mutant and parent GoxM10 of the present application

[0093] The acid stability of the mutants and GoxM10 of the present application was determined by treating them at 37°C and different 0.1 mol / L citric acid-sodium hydrogen phosphate buffer systems (pH 2.0-8.0) for 60 min, and treating them in pH 2.5 buffer for different time periods (10, 20, 30, 40, 50, 60 min) and then measuring the residual enzyme activity at pH 6.0 and 30°C. Figure 5As shown, after treatment at pH 2.75 and 37°C for 60 min, the retained enzyme activities of mutants Q241E / E361P / A419I and GoxM12 were approximately 35.26% and 42.96%, respectively, which were increased by 47% and 79% compared with GoxM10.

[0094] like Figure 6 As shown, when treated at pH 2.5 for 10, 20, 30, 40, 50 and 60 min, the relative residual enzyme activities of mutant GoxM12 were 62%, 41%, 33%, 24%, 20% and 15%, respectively, which were all higher than those of GoxM10. After treatment at pH 2.5 and 37°C for 60 min, the retained enzyme activities of mutants Q241E / E361P / A419I and GoxM12 were 12.87% and 15.32%, respectively, which were increased by 101% and 139% compared with M10, respectively.

[0095] The above embodiments are only used to understand the technical solution of the present application and do not limit the protection scope of the present application.

Claims

1. A glucose oxidase mutant with improved thermal stability and acid stability, characterized in that: The amino acid sequence of the mutant is shown in SEQ ID NO:

2.

2. A glucose oxidase gene, characterized in that The gene encodes glucose oxidase with an amino acid sequence as shown in SEQ ID NO:

2.

3. The glucose oxidase gene according to claim 2, characterized in that The nucleotide sequence of the gene is shown in SEQ ID NO:

3.

4. A recombinant vector comprising the glucose oxidase gene according to claim 2.

5. A recombinant strain comprising the glucose oxidase gene according to claim 2.

6. A method for improving the thermal stability and acid stability of glucose oxidase, characterized in that: The method comprises the steps of performing the following mutations on the glucose oxidase shown in SEQ ID NO: 1 to obtain a glucose oxidase with an amino acid sequence as shown in SEQ ID NO: 2: The 241st amino acid mutated from Gln to Glu, the 499th amino acid mutated from Arg to Glu, the 361st amino acid mutated from Glu to Pro, and the 419th amino acid mutated from Ala to Ile.

7. Use of the glucose oxidase mutant with improved thermal stability and acid stability according to claim 1 for oxidizing β-D-glucose for non-therapeutic purposes.

8. A method for preparing glucose oxidase, characterized in that: The method comprises the following steps: (1) using a recombinant vector comprising the glucose oxidase gene according to claim 2 to transform a host cell to obtain a recombinant strain; (2) culturing the recombinant strain and inducing the expression of glucose oxidase; (3) Purify the expressed glucose oxidase.

Images