A site-directed mutagenesis influenza virus gene non-coding region nucleic acid fragment and its application

Abstract

The present invention provides a site-directed mutated influenza virus gene non-coding region nucleic acid fragment and its application in improving the expression efficiency of mRNA vaccines. The provided site-directed mutated influenza virus gene non-coding region nucleic acid fragment has a sequence of SEQ ID NO: 3. The present invention also provides an mRNA fragment for translating and expressing in a host, which contains a coding frame for encoding a target protein, and the 5′UTR and / or 3′UTR of the mRNA fragment is the site-directed mutated influenza virus gene non-coding region nucleic acid fragment. In view of the problems that the existing mRNA vaccine has low translation efficiency, relatively insufficient activation of the immune system, and difficulty in producing the expected immune protection effect, the present invention provides a method for site-directed mutagenesis of a non-coding region derived from an influenza virus M gene fragment, which can be used as the 5′UTR and / or 3′UTR of the target expression sequence, and can improve the translation efficiency of the target mRNA.

Description

Technical Field

[0001] The present invention belongs to the technical field of mRNA vaccine preparation, and specifically relates to a site-directed mutagenesis influenza virus gene non-coding region nucleic acid fragment and its preparation and application. Background Art

[0002] Influenza is one of the most important epidemics in the world, and hundreds of thousands of people die from influenza every year. Vaccination against influenza is the most efficient and convenient way to prevent influenza. Currently, most influenza vaccines commonly used in clinical practice are inactivated vaccines or attenuated vaccines. The production of such vaccines requires the culture and amplification of viruses in chicken embryos, which has a long production cycle. In addition, since influenza viruses are very easy to mutate and produce new epidemic strains, it is easy to cause a mismatch between the vaccine strain and the epidemic strain, making it difficult to achieve the expected immune protection effect.

[0003] With the continuous advancement of biotechnology and the emergence of the new crown mRNA vaccine, influenza mRNA vaccines have gradually come into people's view in recent years. Compared with traditional inactivated vaccines and live attenuated vaccines, influenza mRNA vaccines are safer, have no potential risk of infection, and will not cause serious toxic side effects due to incomplete inactivation. Compared with the subunit vaccines used in the market in recent years, the preparation process of mRNA vaccines is relatively simpler, the development speed is faster, and it can quickly provide targeted protection according to the sudden epidemic strains. It can be seen that the application of mRNA technology to the development of influenza vaccines has innovative advantages. For example, the Chinese invention patent with publication number CN118256522A discloses a method for preparing an influenza mRNA vaccine, and the prepared mRNA vaccine can provide immune protection against influenza virus infection.

[0004] However, existing influenza mRNA vaccines still have problems such as low translation efficiency, insufficient expression of antigens in the body, and a higher dosage is required to achieve the expected protective efficacy. For example, in the Chinese invention patent with publication number CN116785424A, the dosage of mRNA vaccine per mouse is as high as 50μg. The lower translation efficiency not only increases the application cost of mRNA vaccines, but also increases the dosage of excipients such as LNP due to the increase in vaccine dosage, which increases the side effects of mRNA vaccines. Therefore, the development of influenza mRNA vaccines with higher translation efficiency has important application value and practical significance. Summary of the invention

[0005] The purpose of the present invention is to provide a site-directed mutagenesis of a non-coding region of an influenza virus gene nucleic acid fragment and its application in improving the expression efficiency of an mRNA vaccine. The present invention aims to solve the problem that the existing mRNA vaccine has low translation efficiency, relatively insufficient activation of the immune system, and difficulty in producing the expected immune protection efficacy. The present invention provides a method for site-directed mutagenesis of a non-coding region derived from an influenza virus M gene fragment, which can be used as the 5′UTR and / or 3′UTR of a target expression sequence, and can improve the translation efficiency of the target mRNA.

[0006] The present invention first provides a site-directed mutagenesis influenza virus gene non-coding region nucleic acid fragment, the sequence of which is AGTAAAAGCAGGTAGATATTGAAAG (SEQ ID NO: 3);

[0007] The present invention also provides a use of the site-directed mutagenesis influenza virus gene non-coding region nucleic acid fragment as a 5′UTR and / or 3′UTR fragment to improve mRNA expression efficiency;

[0008] The present invention also provides an mRNA fragment for translating and expressing in a host, which contains a coding frame for encoding a target protein, and the 5′UTR and / or 3′UTR of the mRNA fragment is the site-directed mutated influenza virus gene non-coding region nucleic acid fragment;

[0009] The target protein is a fluorescent protein for detection or an antigen protein for immunization;

[0010] As a specific record of the embodiment, the fluorescent protein is EGFP fluorescent protein or Renilla luciferase Luc protein;

[0011] The antigen protein is influenza virus hemagglutinin HA antigen protein.

[0012] As a specific description of the embodiment, the nucleotide sequence of the mRNA fragment used to express the HA antigen protein is SEQ ID NO:6.

[0013] In another aspect, the invention also provides an mRNA vaccine, wherein the antigen protein is translated and expressed by the above-mentioned mRNA fragment;

[0014] The mRNA vaccine comprises the above-mentioned mRNA fragment and LNP packaging components.

[0015] The present invention utilizes the 5'UTR and 3'UTR in the M segment of the influenza virus genome, performs site-directed mutagenesis on them, and synthesizes EGFPP, Luc or HA expression frame DNA sequences with complete functions, which are transcribed and packaged into mRNA-LNPs and then used for transfection of 293T cells and mouse immunization. It is found that the 5'UTR and 3'UTR after the M1+2 mutation can significantly improve the in vivo and in vitro translation efficiency of the target gene, thereby improving the immune response, which is of great significance to the research and development and wide application of mRNA vaccines. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 A schematic diagram of adding UTR sequences to both ends of the target expression sequence.

[0017] Figure 2 This is the gel electrophoresis diagram of the EGFP target fragment. (The lanes from left to right are: marker, M-EGFP, M1+2-EGFP, α-globin-EGFP).

[0018] Figure 3 This is a data graph of mRNA-LNP quality control results.

[0019] Figure 4 This is the electron microscopy observation result of mRNA-LNP.

[0020] Figure 5 These are the fluorescence expression images of 293T cells after transfection of three mRNA-LNPs: α-globin-EGFP, M-EGFP, and M1+2-EGFP.

[0021] Figure 6 The figure shows the quantitative statistical results of fluorescence intensity after 293T cells were transfected with three mRNA-LNPs: α-globin-EGFP, M-EGFP, and M1+2-EGFP (**: P<0.01, ***: P<0.001).

[0022] Figure 7 These are fluorescent in vivo imaging images of three types of mRNA-LNPs, α-globin-Luc, M-Luc, and M1+2-Luc, injected intramuscularly into mice 48 hours later.

[0023] Figure 8 This is the quantitative statistical result of in vivo imaging fluorescence values ​​of three types of mRNA-LNPs, α-globin-Luc, M-Luc, and M1+2-Luc, injected intramuscularly into mice 48 hours later (*: P<0.05).

[0024] Fig. 9This is the gel electrophoresis diagram of the HA target fragment (lanes from left to right: marker, M-HA, M1+2-HA, α-globin-HA).

[0025] Fig.10 This is the flow chart of immunizing mice with three mRNA-LNP vaccines: α-globin-HA, M-HA, and M1+2-HA, and attacking PR8.

[0026] Fig.11 This is the result of flow cytometry detection of CD3 clustering of spleen monocytes in each group of mice.

[0027] Fig.12 The statistical graphs show the proportion of CD3 monocytes in spleen of each group of mice (*: P<0.05, **: P<0.01, ***: P<0.001, vs PBS; #: P<0.05).

[0028] Fig.13 Statistical graph of the anticoagulant titer of peripheral serum of each group of mice against influenza virus in the hemagglutination inhibition experiment (**: P<0.01, ***: P<0.001, vs PBS; #: P<0.05, ##: P<0.01).

[0029] Fig.14 These are photos of mice showing symptoms such as messy fur, weight loss, loss of appetite, and lethargy after being infected with the virus.

[0030] Fig.15 This is a curve of the survival rate of mice in each group after PR8 infection.

[0031] Fig.16 This is a statistical graph of daily body weight changes in each group of mice after PR8 infection. DETAILED DESCRIPTION

[0032] The present invention aims at the problems that the existing mRNA vaccine has low translation efficiency, relatively insufficient activation of the immune system, and is difficult to produce the expected immune protection effect, and provides a nucleic acid fragment derived from the non-coding region of the influenza virus M gene that has undergone site-directed mutation. The nucleic acid fragment of the non-coding region of the influenza virus M gene that has undergone site-directed mutation can be connected to both ends of the target expression sequence as 5'UTR and / or 3'UTR, which can improve the translation efficiency of the target mRNA. The constructed mRNA is packaged and delivered using LNP, and the UTR sequence of α-globin (α-globin) mRNA is used as a control, and is compared with the UTR sequence before and after the site-directed mutation, respectively. The enhancement effect of the UTR sequence of the site-directed mutation on the translation efficiency of the mRNA vaccine is verified in detail by cell transfection and mouse in vivo experiments.

[0033] The technical solutions of the present invention are now specifically described by way of examples, which should not be considered as limitations of the present invention but should be understood as more detailed descriptions of certain aspects, characteristics and implementation schemes of the present invention.

[0034] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods; the materials and reagents used are reagents and materials that can be obtained from commercial channels unless otherwise specified.

[0035] Example 1: Preparation and packaging of mRNA vaccines containing M1+2 site-directed mutation UTR sequences

[0036] 1) PCR amplification and in vitro transcription of target fragment

[0037] like Figure 1 As shown in Table 1, the 5′UTR and 3′UTR (SEQ ID NO: 1, SEQ ID NO: 2) derived from the influenza virus M gene fragment were placed at both ends of the EGFP gene expression frame (NCBI GenBank: LC008492.1), and some bases of the 5′UTR were mutated M1+2 (SEQ ID NO: 3) to improve the translation efficiency of the target gene. At the same time, the UTR sequence of α-globin (SEQ ID NO: 4, SEQ ID NO: 5) was added to both ends of the EGFP gene expression frame in the same manner as a control. The nucleotide sequence of each UTR is shown in Table 1. The gene sequence of 5′UTR+EGFP+3′UTR was cloned into the PVAX1 vector as a template DNA, and the target gene was amplified using T7 promoter primers (upstream primer: TAATACGACTCACTATAGGGA; downstream primer: AGGAAAGGACAGTGGGAGT) according to the reaction system shown in Table 2. The PCR amplification program is shown in Table 3.

[0038] Table 1: Nucleotide sequence information of each UTR

[0039]

[0040] Table 2: Reaction system composition

[0041]

[0042]

[0043] Table 3: PCR amplification program

[0044]

[0045] The amplified product was electrophoresed on a 1% agarose gel at 120V and 600mA and the results were observed using a UV gel imager. Figure 2As shown, the band size is consistent with the expected target band size. Use a disposable scalpel to cut off the target band and then perform gel recovery. Use the gel recovery product to configure the reaction system shown in Table 4 for in vitro transcription. After incubation at 37°C for 4h, add 1μL DNAase to the system, mix well and incubate at 37°C for 15min to eliminate the DNA template. Then add 30μL enzyme-free water and 25μL lithium chloride solution to the system. After freezing at -20°C overnight, centrifuge at 13200g for 15min at 4°C, and wash the precipitate with 1mL pre-cooled 75% ethanol. Centrifuge again under the same conditions for 3min and discard the supernatant. Dry the precipitate in the clean bench. Finally, dissolve the precipitate with enzyme-free water and store it in a -80°C refrigerator for use.

[0046] Table 4: Components of in vitro transcription reaction system

[0047]

[0048]

[0049] 2) mRNA capping and tailing modification

[0050] Take 10 μg of the above in vitro transcription product and make up the volume to 15 μL with enzyme-free water, denature the RNA in a 65°C water bath for 5 minutes, and immediately transfer to an ice box for 5 minutes to reheat, then prepare the capping reaction system shown in Table 5, and incubate at 37°C for 30 minutes for capping reaction. After capping, prepare the tailing reaction system as shown in Table 6, and incubate at 37°C for 30 minutes for tailing. After the capping and tailing are completed, make up the reaction system to 25 μL with enzyme-free water, add 25 μL of lithium chloride solution, freeze at -20°C for 2 hours, purify, centrifuge at 13200g at 4°C for 15 minutes, and wash the precipitate with 1 mL of pre-cooled 75% ethanol. Centrifuge again under the same conditions for 3 minutes, discard the supernatant, and dry the precipitate in a clean bench. Finally, dissolve the precipitate with enzyme-free water and store it in a -80°C refrigerator for use.

[0051] Table 5: Capping reaction system components

[0052]

[0053] Table 6: Tailing reaction system components

[0054]

[0055] (3) mRNA-LNP packaging

[0056] Dissolve four lipids (SM102, DSPC, DMG-PEG2000, cholesterol) in anhydrous ethanol to 16mM, and store in aliquots. Before each packaging, mix the four lipids according to the volume ratio of SM102: DSPC: DMG-PEG2000: cholesterol = 50: 10: 1.5: 38.5, and mix them for immediate use. Then, according to N / P (ratio of nitrogen in lipids to phosphorus in nucleic acids) = 6, FRR (flow rate ratio between aqueous phase and organic phase) = 3, dilute the prepared mRNA to 0.108μg / μL with citric acid buffer (50mM, pH = 4), and use a microfluidic nano preparation instrument to package mRNA-LNP particles. The packaged product was diluted 4 times with PBS and placed in a 100KD ultrafiltration tube, and ultrafiltered at 5000g until the volume of anhydrous ethanol dropped below 1%, and then an equal volume of 20% sucrose solution was added thereto to obtain the final purified mRNA-LNP product, which was placed in a 4°C refrigerator for standby use.

[0057] like Figure 3 As shown, the particle size of mRNA-LNP detected by Zeta potential instrument is 111.4nm, and the Polydispersity Index (PI) value is 0.097. The encapsulation efficiency of mRNA-LNP detected by encapsulation efficiency kit is above 90%. Figure 4 The electron microscopy results also showed that the LNP particles were regular circles with a particle size of about 100 nm and were basically uniform in size.

[0058] Example 2: M1+2 site-directed mutation of the UTR sequence significantly enhances the translation efficiency of EGFP

[0059] According to 1x10 5 293T cells were plated at a density of 10 cells / mL. After overnight, the supernatant was carefully aspirated and replaced with serum-free opti-MEM medium. The cells were incubated at 37°C for 20 min. The mRNA-LNP prepared as described in Example 1 was taken out, and 2 μg of mRNA was carefully added to each well for transfection. The culture plate was then returned to 37°C for incubation for 6 h, and serum-containing DMEM medium was added to continue the culture. GFP expression was observed under an inverted fluorescence microscope 24 h after transfection. The results are shown in Figure 5 Compared with the linear α-globin group and the unmutated M group, the GFP fluorescence expression level of the UTR site-directed mutation M1+2 group was significantly increased. And as the mRNA transfection dose decreased, the fluorescence brightness of the M1+2 group was always stronger than the other two groups. The fluorescence result images were imported into Image J software for quantitative analysis, and the experimental results were statistically analyzed using Graphpad Prizm software.

[0060] like Figure 6As shown, at transfection doses of 0.2, 1, and 5 μg, the fluorescence values ​​of the M1+2 group were significantly higher than those of the α-globin group and the M group. The results showed that the UTR sequence of the influenza virus M gene segment M1+2 site-directed sequence can significantly enhance the translation efficiency of EGFP mRNA.

[0061] Example 3: M1+2 site-directed mutation of the UTR sequence significantly improves the expression of Luc protein in mice

[0062] According to the method in Example 1, UTR sequences were added to both ends of the Renilla luciferase Luc gene (NCBI GenBank: AF025846.2) to construct a plasmid, and Luc-mRNA-LNP was prepared through in vitro transcription, capping, tailing, LNP packaging and purification. According to the injection volume of 2μg / 0.1mL / mouse, Luc-mRNA-LNP containing α-globin, M, M1+2 site-directed mutant UTR sequences were injected intramuscularly into BALB / c mice. 48h after intramuscular injection, each mouse was intraperitoneally injected with 200μL of luciferase substrate and given isoflurane inhalation anesthesia. 10min after intraperitoneal injection, the mice were put on the machine for in vivo imaging detection. Figure 7 The results show that the in vivo expression level of Luc-mRNA containing the M1+2 site-directed mutant UTR sequence increased significantly. The Graphpad Prizm software quantitatively counted the fluorescence value levels of each group. Figure 8 Compared with α-globin, the UTR sequence of the influenza virus M gene increased the in vivo fluorescence level of Luc by about 3 times; and compared with the M sequence before mutation, the M1+2 site-directed mutation further increased the fluorescence level by 3 times. The in vivo fluorescence level of this group of mice was about 10 times that of the α-globin group.

[0063] Example 4: mRNA vaccine prepared using M1+2 site-directed mutagenesis UTR sequence affects mouse spleen immune cell populations

[0064] The M1+2-HA plasmid was prepared according to the method in Example 1, wherein the sequence of influenza virus hemagglutinin HA is NCBI sequence number GenBank EF190982.1. The gel electrophoresis results of the plasmid are shown in Fig. 9 The M1+2-HA vaccine was obtained by in vitro transcription, capping, tailing, LNP packaging and purification as described in Example 1. Fig.10 As shown in the process, mice were immunized with two intramuscular injections of the vaccine, the injection volume was 0.1 mL / mouse, and the immunization dose was 2 μg / mouse.

[0065] (1) Extraction and isolation of mouse spleen mononuclear cells

[0066] 24 hours after booster immunization, mice were killed by cervical dislocation and spleens of mice in each group were taken and transferred to a 35 mm cell culture dish containing 4 mL of lymphocyte separation solution. The spleen was ground into a homogenate using a 1 mL syringe core and a 100-mesh nylon mesh, and then the separation solution containing spleen cells was immediately transferred to a 15 mL centrifuge tube and covered with 1 mL of RPMI 1640 medium. The centrifuge speed was set to 3 for both acceleration and deceleration, and centrifuged at 800 g for 30 min at room temperature. The lymphocyte layer was aspirated, and 6 mL of RPMI 1640 medium was added. After inversion and washing, the tube was centrifuged at 250 g for 10 min at room temperature, the supernatant was discarded, and the cells were gently resuspended with 2 mL of medium and counted for later use.

[0067] (2) Detection of CD3 in mouse spleen monocytes by flow cytometry + Cell clustering

[0068] Each sample takes 1x10 6 Each cell was placed in a 1.5mL EP tube, and 500μL of PBS solution (FACS buffer) containing 1% BSA was added and blown evenly, centrifuged at room temperature at 300g for 3min, the supernatant was discarded, and then resuspended with 100μL FACS buffer, and 1μL Fc receptor blocker was added, and incubated at room temperature in the dark for 15min to block the Fc receptor on the cell surface. Then centrifuged again at 300g for 3min, the cell pellet was resuspended with 200μL FACS buffer for washing, the centrifugation and supernatant were repeated, 100uL FACS Buffer was added for resuspending, and 1uL PE-Anti-mouse-CD3 antibody was added for staining, and incubated at room temperature in the dark for 15min. After repeating the washing and resuspending steps, the cell clusters were analyzed by flow cytometry, and the results were imported into Flowjo software for analysis.

[0069] like Fig.11 and Fig.12 As shown, compared with the negative control group injected with PBS intramuscularly, the number of CD3 - The proportion of cell populations increased significantly. This suggests that HA vaccine immunity may induce a large number of B cells to proliferate and activate, and participate in subsequent immune processes such as antibody secretion. At the same time, compared with the α-globin-HA vaccine, the HA vaccine containing the M1+2 site-directed mutation UTR sequence can further enhance the CD3 - The cell ratio indicates that it has a stronger inducing effect on B cell proliferation and differentiation, which may lead to higher levels of antibody secretion.

[0070] Example 5: mRNA vaccine prepared by using M1+2 site-directed mutation UTR sequence to improve the antibody secretion level of mice

[0071] 14 days after the initial immunization and booster immunization with the mRNA vaccine prepared in Example 4, peripheral blood was collected from the retro-orbital venous plexus of each group of mice. After standing at room temperature for 1 hour, the serum was separated by centrifugation at 3500rpm, and the serum antibody titer was detected by hemagglutination inhibition experiment. 25 μL PBS was added to each well of the 1st to 11th columns of the pointed bottom 96-well plate, and 50 μL PBS was added to each well of the 12th column. Then 25 μL of serum was added to the first column, and after repeated pipetting 3-5 times to mix, 25 μL was transferred to the second column, and then diluted to the 10th column in turn. Then 25 μL of diluted PR8 virus was added to each well of columns 1-11, the reaction plate was tapped lightly to mix, and it was incubated at room temperature for 30 minutes. Finally, 50 μL of 1% chicken red blood cells were added to each well of the plate, and the reaction plate was tapped lightly again to mix, and the results were observed after standing at room temperature for 40 minutes. Fig.13 The data of hemagglutination inhibition experiment showed that compared with the PBS negative control group, the serum of each group of mice after HA vaccine immunization could significantly inhibit the hemagglutination of red blood cells caused by PR8 virus, and the titer of serum of mice in M1+2-HA vaccine group to inhibit hemagglutination was significantly higher than that in α-globin group, and it also increased to a certain extent compared with M group. This trend was also shown after the first and second immunizations. This shows that HA vaccine can effectively induce the expression of specific antibodies of PR8 influenza virus in mice and produce immune protection effect, while the UTR sequence of M1+2 site-directed mutation has a stronger effect of inducing the secretion of specific antibodies in mice, suggesting that it has the function of further enhancing the body's immune activation and antibody secretion.

[0072] Example 6: mRNA vaccine prepared using M1+2 site-directed mutation UTR sequence has immune protection effect

[0073] 14 days after booster immunization, mice in each group were challenged with PR8 intranasal drops, and the weight, coat color, food intake and other living conditions of mice in each group were closely observed. Fig.14 As shown, the mice in the negative control PBS group developed symptoms such as messy fur, weight loss, loss of appetite, and mental depression after infection, while the mice in the vaccine immunization group were relatively normal. Fig.15 The daily weight of mice in each group was statistically analyzed, and it was found that the weight of mice in the PBS group continued to decrease after the virus challenge, while the weight change trend of mice in the vaccine immunization group and the NC control group without virus challenge was consistent, with no significant decrease. Fig.16 Only the mice in the PBS group that were not vaccinated died, and all the mice in the vaccine group survived after the virus challenge. The experimental results in this part show that vaccine immunization has a significant protective effect, which can effectively reduce the symptoms of weight loss, decreased appetite, and messy fur in mice caused by PR8 influenza virus challenge, and avoid the death of mice caused by influenza virus. It suggests that vaccines containing M1+2 site-directed mutation UTR sequences can induce the body to form stronger immune protection and effectively resist influenza virus infection.

Claims

1. A site-directed mutagenesis nucleic acid fragment of a non-coding region of an influenza virus gene, characterized in that: The sequence of the non-coding region nucleic acid fragment is SEQ ID NO:

3.

2. Use of the influenza virus gene non-coding region nucleic acid fragment with site-directed mutagenesis according to claim 1 as a 5'UTR and / or 3'UTR fragment to improve mRNA expression efficiency.

3. An mRNA fragment for translation and expression in a host, characterized in that: The mRNA fragment contains a coding frame for encoding a target protein, and the 5′UTR and / or 3′UTR of the mRNA fragment is the site-directed mutagenesis influenza virus gene non-coding region nucleic acid fragment according to claim 1.

4. The mRNA fragment according to claim 3, characterized in that The target protein is a fluorescent protein for detection or an antigen protein for immunization.

5. The mRNA fragment according to claim 4, characterized in that The fluorescent protein is EGFP fluorescent protein or Renilla luciferase Luc protein.

6. The mRNA fragment according to claim 4, characterized in that The antigen protein is influenza virus hemagglutinin HA antigen protein.

7. The mRNA fragment according to claim 3, characterized in that The nucleotide sequence of the mRNA fragment is SEQ ID NO:

6.

8. Use of the mRNA fragment according to claim 3 in the preparation of mRNA vaccines.

9. An mRNA vaccine, characterized in that: The antigen protein in the mRNA vaccine is expressed by translation of the mRNA fragment described in claim 7.

10. The mRNA vaccine according to claim 9, characterized in that The mRNA vaccine also contains an LNP component.

Images