A set of genes regulating resistance to gray mold in tomato and their use

Abstract

The application provides a group of genes for regulating resistance of tomatoes to botrytis blight, and the genes are tomato SlBIUPa gene and tomato SlBIUPb gene; wherein the nucleotide sequence of the tomato SlBIUPa gene is shown in SEQ ID NO. 1, or has more than 90% homology with the nucleotide sequence shown in SEQ ID NO. 1, and the nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO. 2; the nucleotide sequence of the tomato SlBIUPb gene is shown in SEQ ID NO. 3, or has more than 90% homology with the nucleotide sequence shown in SEQ ID NO. 3, and the nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO. 4. SlBIUPa and SlBIUPb can negatively regulate resistance of tomatoes to botrytis blight, the functions of the two genes in regulating resistance of tomatoes to botrytis blight have a dose effect, and knocking out SlBIUPa or SlBIUPb alone can reduce the lesion area, and knocking out SlBIUPa and SlBIUPb simultaneously can more obviously enhance the resistance to botrytis blight.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically involving a set of genes that regulate the resistance of tomatoes to gray mold and their applications. Background Technology

[0002] Gray mold disease is one of the most serious diseases affecting tomato production, typically reducing yield by 10%–20%, and in severe cases by 30%–60%, significantly impacting both yield and economic benefits. Its pathogen, *Botrytis cinerea* Pers., can also infect over 200 other crops, including grapes, cucumbers, and strawberries, causing symptoms such as soft rot, black rot, and mold, resulting in substantial economic losses. While research on tomato resistance to gray mold has made some progress, several key issues remain unresolved. As early as 2009, Davis et al. located some QTL loci for gray mold resistance using introgression lines; however, to date, the major resistance gene for tomato gray mold has not been cloned. Therefore, using genetic engineering techniques to study the resistance mechanism of tomato to gray mold is of great significance for the effective control of this disease and the healthy development of the tomato industry.

[0003] During infection with *Botrytis cinerea*, the resistance mechanisms of tomatoes to this pathogen mainly consist of physical barriers and pathogen-induced biochemical substances and immune genes. Physical barriers refer to the resistance structures and substances inherent in the plant itself, while biochemical substances and immune genes mainly refer to the immune responses induced by pathogen infection, resistance-related signaling pathways, and the expression of defense genes. Chloroplasts, as plant-specific organelles that perform photosynthesis, also play a central role in regulating plant defense responses. Numerous studies have confirmed the basic functions of chloroplasts in plant immune responses: after a plant senses a danger signal, chloroplasts, as a source of calcium and reactive oxygen species signals, transmit signals to the cell nucleus, leading to the expression of defense-related genes (such as genes related to the synthesis of salicylic acid and jasmonic acid) and the activation of pattern-triggered immunity (PTI) triggered by pathogen pattern molecules. However, the mechanisms by which chloroplast proteins participate in the defense response against *Botrytis cinerea* are still poorly understood. Summary of the Invention

[0004] In view of this, the present invention provides a set of genes that regulate resistance to gray mold in tomatoes and their applications.

[0005] One objective of this invention is to provide a set of genes that regulate resistance to gray mold in tomatoes, namely the tomato SlBIUPa gene and the tomato SlBIUPb gene.

[0006] The nucleotide sequence of the tomato SlBIUPa gene is as shown in SEQ ID NO.1, or has more than 90% homology with the nucleotide sequence shown in SEQ ID NO.1, and encodes the amino acid sequence shown in SEQ ID NO.2;

[0007] The nucleotide sequence of the tomato SlBIUPb gene is shown in SEQ ID NO.3, or a nucleotide sequence that has more than 90% homology with the nucleotide sequence shown in SEQ ID NO.3 and encodes the amino acid sequence shown in SEQ ID NO.4.

[0008] The second objective of this invention is to provide the application of the above-mentioned genes in regulating the resistance of tomatoes to gray mold. Specifically, the application is manifested in the following ways: when the SlBIUPa gene or the SlBIUPb gene is overexpressed in tomatoes, the resistance of tomatoes to gray mold is significantly reduced; knocking out the SlBIUPa gene or the SlBIUPb gene separately can improve the resistance of tomatoes to gray mold; and knocking out both the SlBIUPa gene and the SlBIUPb gene simultaneously can further improve the resistance of tomatoes to gray mold.

[0009] Furthermore, knocking out the SlBIUPa gene or the SlBIUPb gene separately can enhance the resistance of tomatoes to gray mold by 12% to 23%; knocking out both the SlBIUPa gene and the SlBIUPb gene at the same time can enhance the resistance of tomatoes to gray mold by 45% to 48%.

[0010] A third objective of this invention is to provide an expression vector for expressing the protein encoded by the aforementioned gene, wherein the expression vector contains the tomato SlBIUPa gene or the tomato SlBIUPb gene.

[0011] Furthermore, when constructing an expression vector containing the tomato SlBIUPa gene, the primers used to amplify the SlBIUPa gene are shown in SEQ ID NO.5, and are as follows:

[0012] SlBIUPa-OE-FW:5'-CATTTGGAGAGGACACGCTCGAGATGGC TGACCCGAATCGAC-3';

[0013] SlBIUPa-OE-RV:5'-TCTCATTAAAGCAGGACTCTAGATCACAG CCCAACTCGACACTGCCT-3'.

[0014] When constructing an expression vector containing the tomato SlBIUPb gene, the primers used to amplify the SlBIUPb gene are shown in SEQ ID NO. 6, and are as follows:

[0015] SlBIUPb-OE-FW:5'-CATTTGGAGAGGACACGCTCGAGATGAA CGACCCAAATCGGC-3';

[0016] SlBIUPb-OE-RV:5'-TCTCATTAAAGCAGGACTCTAGATCAGAGGCCAACCCGGCA-3'.

[0017] The fourth objective of this invention is to provide an editing and recombination vector for editing the above-mentioned genes. The editing and recombination vector is a gene expression cassette inactivated recombination vector constructed using CRISPR / Cas9 technology. Specifically, the editing and recombination vector is a tomato SlBIUPa gene editing and recombination vector, a tomato SlBIUPa gene editing and recombination vector, and a tomato SlBIUPa+SlBIUPb gene editing and recombination vector.

[0018] The two target sequences in the tomato SlBIUPa gene are shown in SEQ ID NO: 7 and SEQ ID NO: 8, respectively; the two target sequences in the tomato SlBIUPb gene are shown in SEQ ID NO: 9 and SEQ ID NO: 10, respectively; and the two target sequences in the tomato SlBIUPa+SlBIUPb gene editing recombinant vector are shown in SEQ ID NO: 7 and SEQ ID NO: 9, respectively.

[0019] Specifically, SEQ ID NO: 7 is SlBIUPa target 1, and the specific sequence is: GTAA ACGAGACTACCCAGG;

[0020] SEQ ID NO: 8 is SlBIUPa target 2, with the specific sequence: CTCCTCCTCC TAACCACAA;

[0021] SEQ ID NO: 9 is SlBIUPb target 1, and the specific sequence is: GCACCGCCG CCAAACCCTAA;

[0022] SEQ ID NO: 10 is SlBIUPb target 2, with the specific sequence: CCGAGTGAT CGGTATGGCTA.

[0023] Furthermore, the primer sequences used to amplify the knockout target site when constructing the tomato SlBIUPa gene editing recombinant vector are shown in SEQ ID NO.11, and are as follows:

[0024] SlBIUPa-KO-Fw:5'-GAATCTAACAGTGTAGTTTGGTAAACGAGACTACCCAGGGTTTTAGAGCTAGAAATAGC-3';

[0025] SlBIUPa-KO-Rv:5'-GCTATTTCTAGCTCTAAAACTTGTGGTTAGGAGGAGGAGCAAACTACACTGTTAGATTC-3'.

[0026] The primer sequences used to amplify the knockout target site when constructing the tomato SlBIUPb gene editing recombinant vector are shown in SEQ ID NO. 12, and are as follows:

[0027] SlBIUPb-KO-Fw:5'-GAATCTAACAGTGTAGTTTGGCACCGCCGCCAAACCCTAAGTTTTAGAGCTAGAAATAG-3';

[0028] SlBIUPb-KO-Rv:5'-GCTATTTCTAGCTCTAAAACCCGAGTGATCGGTATGGCTACAAACTACACTGTTAGATT-3'.

[0029] The primer sequences used to amplify the knockout target site when constructing the tomato SlBIUPa+SlBIUPb gene editing recombinant vector are shown in SEQ ID NO.13, and are as follows:

[0030] DKO-FW: 5'-GAATCTAACAGTGTAGTTTGGTAAACGAGACTACCCAGGGTTTTAGAGCTAGAAATAGC-3';

[0031] DKO-RV: 5'-GCTATTTCTAGCTCTAAAACTTAGGGTTTGGCGGCGGTGCAAACTACACTGTTAGATTC-3'.

[0032] The fifth objective of this invention is to provide a method for regulating the resistance of tomatoes to gray mold, comprising the following steps:

[0033] S1. The above expression vector and the above editing and recombination vector were respectively transferred to Agrobacterium and positive clones were identified to obtain engineered bacteria;

[0034] S2. The above-mentioned engineered bacteria were used to infect the cotyledons of tomato seedlings, and the transgenic seedlings were identified as transgenic positive to obtain overexpression positive seedlings and knockout gene positive seedlings.

[0035] S3. Transplant the positive seedlings from S2 to obtain tomato plants with controllable gray mold resistance.

[0036] Furthermore, the primers used in step S1 to identify the expression vector transformed into the Agrobacterium positive clone were: the front primer CaMV 35S and the back primer of SEQ ID NO. 5; the front primer CaMV 35S and the back primer of SEQ ID NO. 6;

[0037] The primer sequences used to identify the recombinant vector transformed into Agrobacterium-positive clones are shown in SEQ ID NO.14, as follows:

[0038] PTX-FW: AGCGGATAACAATTTCACACAGGA;

[0039] PTX-RV: GCAGGCATGCAAGCTTATTGG.

[0040] Furthermore, the primer sequences used in step S2 to identify the overexpression of positive seedlings are shown in SEQ ID NO.15, and are as follows:

[0041] SlBIUPa-qPCR-FW:ATGGCTGACCCGAATCGAC;

[0042] SlBIUPa-qPCR-RV:GGGTCTGGGTAGGGGTAGTT;

[0043] SlBIUPb-qPCR-FW:CAACCCGTACTACCAACCTAAT;

[0044] SlBIUPb-qPCR-RV:GCCAGAGAATGAAAACAAAGGT.

[0045] The primer sequences used to identify gene editing in gene-positive seedlings with knockout genes are shown in SEQ ID NO.16, and are as follows:

[0046] SlBIUPa-ko-det-FW:ATGGCTGACCCGAATCGACCC;

[0047] SlBIUPa-ko-det-RV:TCACAGCCCAACTCGACACTGCCT;

[0048] SlBIUPb-ko-det-FW:ATGAACGACCCAAATCGGC;

[0049] SlBIUPb-ko-det-RV:TCAGAGGCCAACCCGGCA.

[0050] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0051] By stably introducing SlBIUPa or SlBIUPb gene overexpression vectors and SlBIUPa and SlBIUPb CRISPR-Cas9 knockout recombinant vectors into tomato plants, the application of the SlBIUP gene in regulating tomato resistance to gray mold was confirmed, providing a new target for subsequent tomato variety improvement and the creation of gray mold-resistant materials. Attached Figure Description

[0052] Figure 1 This is a diagram showing the construction result of the overexpression vector in Example 1 of the present invention.

[0053] Figure 2 This is a diagram showing the construction result of the CRISPR-Cas9 editing and recombination vector in Example 3 of the present invention.

[0054] Figure 3 This is a graph showing the test results of the over-meter material in Embodiment 6 of the present invention.

[0055] Figure 4 This is a diagram showing the test results of the knockout material in Embodiment 6 of the present invention.

[0056] Figure 5 This is a graph showing the results of the over-scale material expression level detection in Example 6 of the present invention.

[0057] Figure 6 This is a comparison of sequencing results of the knockout materials in Example 6 of the present invention.

[0058] Figure 7 The images show the results of botrytis cinerea infection in each positive plant and control plant in Example 7 of this invention.

[0059] Figure 8 This is a statistical chart showing the area of ​​lesions after Botrytis cinerea infection in each positive plant and control plant in Example 7 of the present invention. Detailed Implementation

[0060] The present invention will now be described in further detail with reference to specific embodiments, so that those skilled in the art can more clearly understand the present invention.

[0061] Example 1

[0062] This embodiment provides the method for obtaining the target gene, and the specific steps are as follows:

[0063] First, the full-length open reading frame of SlBIUPa / b was amplified using the Solanaceae gene database (https: / / solgenomics.net / ), with primers shown in SEQ ID NO. 5 and SEQ ID NO. 6. The full-length SlBIUPa gene sequence contains 744 nucleotides (SEQ ID NO. 1) and translates into a protein of 247 amino acids (SEQ ID NO. 2); the full-length SlBIUPa gene sequence contains 771 nucleotides (SEQ ID NO. 3) and translates into a protein of 256 amino acids (SEQ ID NO. 4). A BLAST search of the NCBI database revealed that the cloned gene sequence showed low homology to currently published gene sequences, indicating it is a novel gene associated with resistance to tomato gray mold.

[0064] Then, using primers specified in SEQ ID NO. 5 and SEQ ID NO. 6, the full-length cDNA sequences of SlBIUPa / b (SlBIUPa gene or SlBIUPb gene) were amplified from the tomato material Alisa Craig. Amplification method: RNA was extracted from tomato young leaves using the Trizol one-step method, and then cDNA was synthesized by reverse transcription using a reverse transcription kit (purchased from Nanjing Novizan Pharmaceutical Co., Ltd., see instruction manual for specific procedures). The full-length SlBIUPa / b gene was then amplified by PCR using the designed primers.

[0065] The amplification reaction system is as follows:

[0066] Components volume 2×Phanta Max Buffer 25μL dNTP Mix (10mM each) 1μL SlBIUPa / b-OE-FW(10μM) 2μL SlBIUPa / b-OE-RV (10μM) 2μL Phanta Max Super-Fidelity DNA Polymerase 1μL template cDNA 1μL <![CDATA[ddH2O]]> 18μL

[0067] The reaction procedure is as follows:

[0068] step temperature time Pre-variation 95℃ 3min transsexual 95℃ 15 seconds annealing 55℃ 15 seconds extend 72℃ 1min Complete extension 72℃ 5min

[0069] The denaturation, annealing and extension processes were carried out in 38 cycles during the reaction.

[0070] Finally, the amplification products were detected by 0.8% agarose gel electrophoresis, and the target fragment was recovered using a recovery kit (purchased from OMEGA, see the instruction manual for specific procedures).

[0071] Example 2

[0072] This embodiment provides a method for preparing an expression vector, and the specific steps are as follows:

[0073] The pHellsgate8 plasmid (provided and preserved by our laboratory) was digested with XhoI and XbaI (NEB) (37℃, >3h). The digestion products were detected by 1.0% agarose gel extraction and recovered using a recovery kit. The linearized plasmid and the amplified SlBIUPa / b gene fragment were then ligated using a homologous recombination kit (Novizan, China). The specific reaction procedure is as follows:

[0074] Components Dosage Exnase II 1μL 5×CE II Buffer 1μL Linearized cloning vector 25-100ng Insertion fragment amplification products 10-100ng sterile water Add volume to 10 μL

[0075] The above reaction system was coupled at 37°C for 30 min to obtain the coupling product.

[0076] The ligation product was transformed into *E. coli* DH5α (Weidi, China) using the heat shock method. Positive clones were screened on Spec-resistant LB agar plates, and the bacterial culture was picked and shaken. PCR detection was then performed on the liquid bacterial culture. The primers used for detection were: the first primer CaMV 35S and the second primer of SEQ ID NO. 5; the first primer CaMV 35S and the second primer of SEQ ID NO. 6. The results showed that the target band (bacterial culture containing the tomato SlBIUPa gene expression vector) was located at approximately 744 bp, and the target band (bacterial culture containing the tomato SlBIUPb gene expression vector) was located at approximately 771 bp.

[0077] Bacterial cultures with the correct banding pattern were sent to our sequencing facility (Tianyi Huayu) for sequence alignment. After successful alignment, the correct bacterial culture was selected, incubated overnight with gentle shaking, and plasmids were extracted using a small-scale plasmid extraction kit (purchased from OMEGA, see instruction manual for details). The vector construction process is described below. Figure 1 .

[0078] Example 3

[0079] This embodiment provides the method for obtaining the target gene, and the specific steps are as follows:

[0080] First, based on the (partial) gene information annotated from the gene chip (http: / / solgenomics.net / tomato / ), Cas9 target analysis was performed on the cDNA of SlBIUPa / b at (http: / / www.rgenome.net / ), and dual-target primers were designed. SEQ ID NO. 7 and SEQ ID NO. 8 of the SlBIUPa gene target fragment were selected as dual targets for SlBIUPa gene knockout; SEQ ID NO. 9 and SEQ ID NO. 10 of the SlBIUPb gene target fragment were selected as dual targets for SlBIUPb gene knockout; and SEQ ID NO. 7 and SEQ ID NO. 9 of the SlBIUPa and SlBIUPb gene target fragments were selected as dual targets for the dual knockout vector of the SlBIUPa and SlBIUPb genes.

[0081] Then, the target fragments of SlBIUPa single knockout, SlBIUPb single knockout, and SlBIUPa and SlBIUPb gene double knockout were amplified. The primers for amplifying SlBIUPa single knockout are shown in SEQ ID NO.11, the primers for amplifying SlBIUPb single knockout are shown in SEQ ID NO.12, and the primers for amplifying SlBIUPa and SlBIUPb gene double knockout are shown in SEQ ID NO.13. A 608 bp sequence was amplified from the CP043 plasmid (from Professor Cui Xia's research group at the Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences) using PCR. Amplification method: The CP043 plasmid was extracted using a small-scale method (kit purchased from OMEGA, see instruction manual for details). Using the plasmid as a template, a one-step amplification method was employed. The amplified product was recovered using a recovery kit (purchased from OMEGA, see instruction manual for details).

[0082] The amplification reaction system is as follows:

[0083] Components volume 2*Phanta Max Buffer 25μL dNTP Mix (10mM each) 1μL Primer FW (10uM) 2μL Primer RV (10uM) 2μL Phanta Max Super-Fidelity DNA Polymerase 1μL Template DNA (CP043 plasmid) 1μL <![CDATA[ddH2O]]> 18μL

[0084] The reaction procedure is as follows:

[0085]

[0086]

[0087] The denaturation, annealing and extension processes were carried out in 35 cycles during the reaction.

[0088] Example 4

[0089] This embodiment provides a recombinant vector for editing the target gene, and the specific steps are as follows:

[0090] The PTX041 plasmid (kindly provided by Researcher Li Chuanyou of the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences) was digested with BsaI (NEB) at 37℃ for >3 hours. The digestion products were detected using 1.0% agarose gel extraction and the large fragment of PTX041 (around 18K) was recovered using a recovery kit. Then, the linearized plasmid and the amplified target fragment were ligated using a homologous recombination kit (Novizan, China). The specific reaction procedure is as follows:

[0091] Components Dosage Exnase II 1μL 5×CE II Buffer 2μL Linearized cloning vector 25-100ng Insertion fragment amplification products 10-100ng sterile water Add volume to 10 μL

[0092] The above reaction system was coupled at 37°C for 30 min to obtain the coupling product.

[0093] The ligation product was transformed into *E. coli* TransT1 using the heat shock method. Positive clones were screened on Kan-resistant LB agar plates, and the bacterial culture was picked and shaken. PCR detection was performed on the liquid bacterial culture using primers shown in SEQ ID NO. 14. PCR products were detected using 1.0% agarose gel. The empty vector fragment size was 1820 bp, the tomato SlBIUPa gene-edited recombinant vector was 1169 bp, the tomato SlBIUPb gene-edited recombinant vector was 1169 bp, and the tomato SlBIUPa+SlBIUPb gene-edited recombinant vector was 1169 bp. Bacterial cultures with dual targets were sent to a sequencing company (Tianyi Huayu) for sequencing. Sequence alignment was performed, and the bacterial culture was gently shaken before plasmid extraction was performed using a small-scale method. The vector construction process is described in [link to documentation]. Figure 2 .

[0094] Example 5

[0095] This embodiment provides a method for transfecting tomatoes using the above-mentioned expression vector and editing / recombination vector, as detailed below:

[0096] 1. Screening for successfully transformed Agrobacterium

[0097] The vectors obtained above were transformed into Agrobacterium GV3101 using an electroporator at 1800V. After transformation, over-recombinant vectors were screened using LB agar plates containing 50 mg / L Rif and 100 mg / L Spec; CRISPR / Cas9 knockout recombinant vectors were screened using LB agar plates containing 50 mg / L Rif and 100 mg / L Kana. Positive clones were selected and cultured overnight at 28℃ and 200 rpm. 1 μL of Agrobacterium culture was used as a template, and PCR was performed using two primer pairs: the first primer CaMV 35S and the second primer of SEQ ID NO. 5, and the first primer CaMV 35S and the second primer of SEQ ID NO. 6, to detect over-recombinant single clones; PCR was performed using the vector primer SEQ ID NO. 14 to detect knockout recombinant single clones.

[0098] 2. Plant transfection and culture

[0099] Aseptic seedling acquisition: Tomato seeds Ailsa Craig (abbreviated as AC or A57, a product of the U.S. Tomato Genetic Resource Center) were sterilized with sodium hypochlorite for 15 min (with 2% available chlorine); sown on 1 / 2 MS medium (pH=5.8) and cultured at 25±2℃ in the dark until germination; then transferred to a light intensity of 1800 lx and a photoperiod of 16 h light / 8 h dark to obtain aseptic seedlings.

[0100] Agrobacterium transfection: Cotyledons of 7-8 day old sterile seedlings were pre-cultured for 2 days (MS medium, pH=5.8). Agrobacterium solution was resuspended on MS0 to OD600≈0.5 and inoculated for 3-5 minutes. Excess bacterial solution was blotted with sterile filter paper and the seedlings were returned to the pre-culture medium and co-cultured in the dark for 2 days. The seedlings were then transferred to 1.0 ZR (MS + ZR (zeatin nucleoside) 1.0 mg / L + Cef (cephalosporin) 400 mg / L + Km (karamycin) 100 mg / L) for resistance selection. Subcultures were performed every two weeks. After resistant shoots appeared, the explants were transferred to 0.2 ZR + Cef (cephalosporin) 200 mg / L + Km (karamycin) 100 mg / L medium.

[0101] Culture of resistant plants: After 20-30 days, resistant buds are cut off and inserted into rooting medium (RM) to induce rooting. Plants with well-developed root systems are then transplanted into flower pots to obtain resistant plants.

[0102] The specific culture media used in the above process are detailed in Table 1 below.

[0103] Table 1. Details of the specific culture media used in the experiment.

[0104]

[0105] Note: Except for MSO, all the above culture media contain 7.4 g / L of agar, and the pH of all culture media is 5.8.

[0106] Example 6

[0107] This embodiment tested plants transfected with different Agrobacterium species as described above. The specific steps are as follows: gDNA was extracted from tomatoes using the CTAB method. Using the tomato gDNA as a template, PCR was performed to detect positive results. The detection primers were the same as in Example 5. The PCR detection results for the overexpression material are shown below. Figure 3 The results of the knockout material testing are shown below. Figure 4 .

[0108] The expression levels of the overexpression material were detected as follows:

[0109] RNA was extracted from positive plants and reverse transcribed into cDNA for expression level detection. The real-time PCR reaction system was as follows: 5 μL SYBR Mix, 0.5 μL each of forward and reverse primers (10 nmol / L) sequence SEQ ID NO.15, and 4 μL sample cDNA; the reaction program was: 95℃ for 30 s, 95℃ for 5 s, 55℃ for 10 s, and 72℃ for 15 s, for a total of 40 cycles (if the melting curve peak time was later than 30 cycles, an additional 10 cycles were added), followed by cooling at 40℃ for 10 s.

[0110] Melting curves were collected and analyzed, with three technical replicates for each sample. The tomato endogenous actin gene (GenBank accession no. BT013524) was used as an internal control. The obtained data were analyzed using the ΔΔCt method, and the results are shown below. Figure 5 Ultimately, four overexpression materials were selected and named SlBIUPa-OE-15, SlBIUPa-OE-43, SlBIUPb-OE-1, and SlBIUPb-OE-5.

[0111] The editing status of the knockout material was tested as follows: gDNA from the positive plants was taken and amplified using gDNA as a template. The primers were SEQ ID NO.16. The primer for amplifying the SlBIUPa sequence was SlBIUPa-ko-det-FW / Rv, and the primer for amplifying the SlBIUPb sequence was SlBIUPb-ko-det-FW / Rv.

[0112] The PCR amplification system is as follows:

[0113] Components volume 2×Phanta Max Buffer 25μL dNTP Mix (10mM each) 1μL FW (10μM) 2μL RV (10μM) 2μL Phanta Max Super-Fidelity DNA Polymerase 1μL Template gDNA 1μL <![CDATA[ddH2O]]> 18μL

[0114] The reaction procedure is as follows:

[0115] step temperature time Pre-variation 95℃ 3min transsexual 95℃ 15 seconds annealing 55℃ 15 seconds extend 72℃ 1min Complete extension 72℃ 5min

[0116] The denaturation, annealing and extension processes were carried out in 38 cycles during the reaction.

[0117] Finally, the amplified products were detected by 0.8% agarose gel electrophoresis, and the target fragment was recovered using a recovery kit (purchased from OMEGA, see the instruction manual for specific procedures) and sent for sequencing.

[0118] Sequencing alignment of the transgenic T2 generation revealed two single mutant SlBIUPa plants, two single mutant SlBIUPb plants, and two homozygous edited plants containing both SlBIUPa and SlBIUPb double mutants. Sequencing alignment results are shown below. Figure 6Six mutant materials were obtained and named SlBIUPa-KO-2, SlBIUPa-KO-4-2-1, SlBIUPb-KO-18, SlBIUPb-KO-25, DKO-6-1-2, and DKO-6-1-8. The SlBIUPa and SlBIUPb sequences in the six materials are shown in SEQ ID NO.17-22, respectively.

[0119] Furthermore, SEQ ID NO.17: The sequence of the SlBIUPa single knockout mutant SlBIUPa-KO-2 is ATGGCTGACCCGAATCGACCCGTCACCGGTTACCCCGCC;

[0120] SEQ ID NO.18: The sequence of the SlBIUPa single knockout mutant SlBIUPa-KO-4-2-1 is ATGGCTGACCCGAATCGACCCGTCACCGGTTACCCCGCCGCTGCCGCTCCTCCTCCTAACCACAATGGCTACCCCTCCGCTCGACCTCAACCTCCGGCCACCGCCTACCCTTACGCTGCACCACCGTATTACAACAACTACCCCTACCCAGACCCTTACGCGGCCCAGCGTAATACCTTTCTTCGACGAGTGATAGCTATACTTGTTGCTTCTACGATCATCACCGGAACAATTCTCTTTGTCATCTGGATTGTTATTCTTCCTCGCATCCCTGAGTTCCAAGTCGACTCGCTCAATGTATCCAACCTAAATCTGTCGAATTCCCTCATAACTGCTAACTGGGATCTCAGATTTACTGCCAGGAATCCAAACAAGAAGCTTACTCTGAAAAGGCAAGTGTTAGATTCAATGTGAGGATGGTAGCTAGGGTTAGTTTTAAAGCTGGAGCTTGGAGAGCAAGGAGGAGATATTTGAGAGTTTACTGTGGGGATTTGTCAGTTGGAGTTGCGTTAAACAAGTCTTCTGGGAACTTGCTTGGAGGACAAAGGCAGTGTCGAGTTGGGCTGTGA;

[0121] SEQ ID NO.19: The sequence of the single-knockout mutant SlBIUPa-KO-18 of SlBIUPb is AT GAACGACCCAAATCGGCCAGTTACCGGTTACCCTGCCGCCGGAGCACCGCCGCCAAACCCTTAATGGTTACGGAGGTGCTGCTCAGCAGCAACCACCGATAGGCACCGGTTACCCATATGCAGCACCGCCACCTGGCTCCGCGGTGTACTATCAAAACAACCCGTACTACCAACCTAATCACTACGATGCCCAACGCAACACCTTGCTCCGCCGAGTGATCGGTATGGCTATAGCTTGTATGGTCATCGCTGGTACCTTTGTTTTCATTCTCTGGCTGATATTTCGTCCTCGAATCCCCGAGTTCAGAGTTGATTCACTGTCTGTATCGAATCTTAATCTGACTAATTCGCTGATTTCTGGTAAATGGGACCTTCGTTTTACTGTGAGAAACCCAAATAAGAAGATGACCCTTTACTATGATGACGTCGCCGCTGCAGTTTTCTATGATGACGTGTCGCTTTCCGATACAACGGTTCCGCCTTTCTTTCAAGAGAAGAGGGCTGAGACGGCCCGGCAAGCAAGTTTTGCTACTGCGGGCGCTTACGTGAATAATCGGGCTTTTGATCAGATGAACAAAGAAAGGTCGCAAAAAGGTGCAATTGGGTTTAATGTGAGGATCGTGGCTAGGGTTAGGTTTAGGTCTGGGGCTTGGAGAGCGAGGAGGAGGTTTATAAGGGTGTACTGTAAGGATTTGTCAGTGGGGGTTGGGTCGAACAATTCATCGGGTACCTTGCTTGGTGGTGCACGACAGTGCCGGGTTGGCCTCTGA;

[0122] SEQ ID NO.20: The sequence of the SlBIUPb single knockout mutant SlBIUPa-KO-25 is AT GAACGACCCAAATCGGCCAGTTTACCGGTTACCCTGCCGCCGGAGCACCGCCGCCAAACCCTAATGGTTACGGAGGTGCTGCTCAGCAGCAACCACCGATAGGCACCGGTTACCCATATGCAGCACCGCCACCTGGCTCCGCGGTGTACTATCAAAACAACCCGTACTACCAACCTAATCACTACGATGCCCAACGCAACACCTTGCTCCGCCGAAGTGATCGGTATGGCTATAGCTTGTATGGTCATCGCTGGTACCTTTGTTTTCATTCTCTGGCTGATATTTCGTCCTCGAATCCCCGAGTTCAGAGTTGATTCACTGTCTGTATCGAATCTTAATCTGACTAATTCGCTGATTTCTGGTAAATGGGACCTTCGTTTTACTGTGAGAAACCCAAATAAGAAGATGACCCTTTACTATGATGACGTCGCCGCTGCAGTTTTCTATGATGACGTGTCGCTTTCCGATACAACGGTTCCGCCTTTCTTTCAAGAGAAGAGGGCTGAGACGGCCCGGCAAGCAAGTTTTGCTACTGCGGGCGCTTACGTGAATAATCGGGCTTTTGATCAGATGAACAAAGAAAGGTCGCAAAAAGGTGCAATTGGGTTTAATGTGAGGATCGTGGCTAGGGTTAGGTTTAGGTCTGGGGCTTGGAGAGCGAGGAGGAGGTTTATAAGGGTGTACTGTAAGGATTTGTCAGTGGGGGTTGGGTCGAACAATTCATCGGGTACCTTGCTTGGTGGTGCACGACAGTGCCGGGTTGGCCTCTGA;

[0123] SEQ ID NO.21: Sequence of the double-knockout mutant DKO-6-1-2 of SlBIUPa and SlBIUPb. Among them, the gene sequence of SlBIUPa: ATGGCTGACCCGAATCGACCCGTCACC GGTTACCCCGCCGCTGCCGCTCCTCCTCCTAACCACAATGGCTACCCCTCCGCTCGACCTCAACCTCCGGCCACCGCCTACCCTTACGCTGCACCACCGTATTACAACAACTACCCCTACCCAGACCCTTACGCGGCCCAGCGTAATACCTTTCTTCGACGAGTGATAGCTATACTTGTTGCTTCTACGATCATCACCGGAACAATTCTCTTTGTCATCTGGATTGTTATTCTTCCTCGCATCCCTGAGTTCCAAGTCGACTCGCTCAATGTATCCAACCTAAATCTGTCGAATTCCCTCATAACTGCTAACTGGGATCTCAGATTTACTGCCAGGAATCCAAACAAGAAGCTTACTCTGTACTACGACGAAATTGCTGCTGCGATTTTCTATGATTCACTCTCAATTGCTGATACTACGGTTCCACCTTTCTTTATGGATAGGGTAAAGGTTAGCTTTGTTGCCTCTGGGGCGTATGTGGAGAAATGGGCTTTTGAGGGTATGGCTAAAGAGAGGGCTGAAAAGGCAAGTGTTAGATTCAATGTGAGGATGGTAGCTAGGGTTAGTTTTAAAGCTGGAGCTTGGAGAGCAAGGAGGAGATATTTGAGAGTTTACTGTGGGGATTTGTCAGTTGGAGTTGCGTTAAACAAGTCTTCTGGGAACTTGCTTGGAGGACAAAGGCAGTGTCGAGTTGGGCTGTGA;

[0124] SlBIUPb gene sequence: ATGAACGACCCAAATCGGCCAGTTACCG GTTACCCTGCCGCCGGAGCACCGCCGAGCAGCAACCACCGATAGGCACCGGTTACCCATATGCAGCACCGCCACCTGGCTCCGCGGTGTACTATCAAAACAACCCGTACTACCAACCTAATCACTACGATGCCCAACGCAACACCTTGCTCCGCCGAGTGATCGGTATGGCTATAGCTTGTATGGTCATCGCTGGTACCTTTGTTTTCATTCTCTGGCTGATATTTCGTCCTCGAATCCCCGAGTTCAGAGTTGATTCACTGTCTGTATCGAATCTTAATCTGACTAATTCGCTGATTTCTGGTAAATGGGACCTTCGTTTTACTGTGAGAAACCCAAATAAGAAGATGACCCTTTACTATGATGACGTCGCCGCTGCAGTTTTCTATGATGACGTGTCGCTTTCCGATACAACGGTTCCGCCTTTCTTTCAAGAGAAGAGGGCTGAGACGGCCCGGCAAGCAAGTTTTGCTACTGCGGGCGCTTACGTGAATAATCGGGCTTTTGATCAGATGAACAAAGAAAGGTCGCAAAAAGGTGCAATTGGGTTTAATGTGAGGATCGTGGCTAGGGTTAGGTTTAGGTCTGGGGCTTGGAGAGCGAGGAGGAGGTTTATAAGGGTGTACTGTAAGGATTTGTCAGTGGGGGTTGGGTCGAACAATTCATCGGGTACCTTGCTTGGTGGTGCACGACAGTGCCGGGTTGGCCTCTGA

[0125] SEQ ID NO.22: SlBIUPa and SlBIUPb double knockout mutant DKO-6-1-8 series. Among them, the SlBIUPa gene sequence: ATGGCTGACCCGAATCGACCCGTCACC GGTTACCCCGCCGCTGCCGCTCCTCCTCCTAACCACAATGGCTACCCCTCCGCTCGACCTCAACCTCCGGCCACCGCCTACCCTTACGCTGCACCACCGTATTACAACAACTACCCCTACCCAGACCCTTACGCGGCCCAGCGTAATACCTTTCTTCGACGAGTGATAGCTATACTTGTTGCTTCTACGATCATCACCGGAACAATTCTCTTTGTCATCTGGATTGTTATTCTTCCTCGCATCCCTGAGTTCCAAGTCGACTCGCTCAATGTATCCAACCTAAATCTGTCGAATTCCCTCATAACTGCTAACTGGGATCTCAGATTTACTGCCAGGAATCCAAACAAGAAGCTTACTCTGTACTACGACGAAATTGCTGCTGCGATTTTCTATGATTCACTCTCAATTGCTGATACTACGGTTCCACCTTTCTTTATGGATAGGGTAAACGAGACTACCCCAGGAGGTTAGCTTTGTTGCCTCTGGGGCGTATGTGGAGAAATGGGCTTTTGAGGGTATGGCTAAAGAGAGGGCTGAAAAGGCAAGTGTTAGATTCAATGTGAGGATGGTAGCTAGGGTTAGTTTTAAAGCTGGAGCTTGGAGAGCAAGGAGGAGATATTTGAGAGTTTACTGTGGGGATTTGTCAGTTGGAGTTGCGTTAAACAAGTCTTCTGGGAACTTGCTTGGAGGACAAAGGCAGTGTCGAGTTGGGCTGTGA;

[0126] SlBIUPb gene sequence: ATGACGACCCAAATCGGCCAGTTACCG.

[0127] Example 7

[0128] This embodiment verifies the resistance of each positive plantlet selected above to gray mold, and the specific steps are as follows:

[0129] For each positive plant and the control plant Ailsa Crai (non-transgenic plant) selected above, the undersides of mature leaflets of mature compound leaves at the same location on healthy plants with consistent growth vigor were inoculated with Botrytis cinerea spores for identification. The Botrytis cinerea spore suspension was then prepared. The suspension concentration was 10. 5Cells / mL; Culture conditions: 22℃ constant temperature, 16h light / 8h darkness, 75% relative humidity for 72h.

[0130] Compared with the control material, the excessive transgenic plants showed more severe disease and larger lesion areas on their leaves. The lesion area on the leaves of the single-knockout transgenic material was significantly smaller than that of the control, while the lesion area on the double-knockout material was the smallest, only 45%-48% of that of AC (control plants). See the image for leaf inoculation with pathogen. Figure 7 See the statistical chart of lesion area. Figure 8 .

[0131] The above experimental results indicate that SlBIUPa and SlBIUPb can negatively regulate tomato resistance to gray mold. The functions of the two genes in regulating tomato gray mold resistance exhibit a dose-effect relationship. Knocking out SlBIUPa or SlBIUPb alone can reduce the lesion area, while knocking out both SlBIUPa and SlBIUPb simultaneously can more significantly enhance resistance to gray mold.

[0132] Unless otherwise specified, all raw materials used in this invention are existing substances that can be purchased directly from the market.

[0133] The above are merely preferred embodiments of the present invention and are not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. The application of knocking out the tomato SlBIUPa gene and / or the tomato SlBIUPb gene in improving resistance to tomato gray mold, characterized in that, The nucleotide sequence of the tomato SlBIUPa gene is a nucleotide sequence that has more than 90% homology with the nucleotide sequence shown in SEQ ID NO.1 and encodes the amino acid sequence shown in SEQ ID NO.2; The nucleotide sequence of the tomato SlBIUPb gene is a nucleotide sequence that has more than 90% homology with the nucleotide sequence shown in SEQ ID NO.3 and encodes the amino acid sequence shown in SEQ ID NO.

4.

2. The application according to claim 1, characterized in that, The nucleotide sequence of the tomato SlBIUPa gene is shown in SEQ ID NO.1; The nucleotide sequence of the tomato SlBIUPb gene is shown in SEQ ID NO.

3.

3. The application according to claim 2, characterized in that, Knockout is performed using editing and recombination vectors, which are gene expression cassette inactivation recombinant vectors constructed using CRISPR / Cas9 technology. Specifically, the editing and recombination vectors are tomato SlBIUPa gene editing and recombination vectors, tomato SlBIUPa gene editing and recombination vectors, and tomato SlBIUPa+SlBIUPb gene editing and recombination vectors. The two target sequences in the tomato SlBIUPa gene are shown in SEQ ID NO: 9 and SEQ ID NO: 10, respectively; the two target sequences in the tomato SlBIUPb gene are shown in SEQ ID NO: 11 and SEQ ID NO: 12, respectively; and the two target sequences in the tomato SlBIUPa+SlBIUPb gene editing recombinant vector are shown in SEQ ID NO: 9 and SEQ ID NO: 11, respectively.

4. The application according to claim 3, characterized in that, The primer sequences used to amplify the knockout target when constructing the tomato SlBIUPa gene editing recombinant vector are shown in SEQ ID NO: 13-14; The primer sequences used to amplify the knockout target when constructing the tomato SlBIUPb gene editing recombinant vector are shown in SEQ ID NO: 15-16; The primer sequences used to amplify the knockout target when constructing the tomato SlBIUPa+SlBIUPb gene editing recombinant vector are shown in SEQ ID NO: 17~18.

5. A method for improving the resistance of tomatoes to gray mold, characterized in that, Includes the following steps: S1. The editing and recombination vector described in claim 3 is transferred to Agrobacterium and positive clones are identified to obtain engineered bacteria; S2. The above-mentioned engineered bacteria were used to infect the cotyledons of tomato seedlings, and the transgenic seedlings were identified as transgenic positive to obtain knockout gene positive seedlings. S3. Transplant the positive seedlings from S2 to obtain tomato plants with high resistance to gray mold.

6. The method according to claim 5, characterized in that, The primer sequences used in step S1 to identify and edit the recombinant vector transferred into Agrobacterium positive clones are shown in SEQ ID NO: 19~20.

7. The method according to claim 5, characterized in that, The primer sequences used in step S2 to identify gene editing in knockout gene-positive seedlings are shown in SEQ ID NO: 25~28.

Images