Use of erbin gene / protein as a target in screening for drugs for preventing or treating foot-and-mouth disease virus infection

Abstract

The application discloses use of an ERBIN gene / protein as a target in screening of a medicine for preventing or treating foot-and-mouth disease virus infection, and relates to the technical field of genetic engineering; the application uses the ERBIN gene / protein as a target in the medicine for preventing or treating foot-and-mouth disease virus infection, and can effectively inhibit the infection of the foot-and-mouth disease virus by knocking out the ERBIN gene.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of genetic engineering, in particular to the use of ERBIN gene / protein as a target in screening drugs for preventing or treating foot and mouth disease virus infection. BACKGROUND

[0002] Foot and mouth disease (FMD) is a highly contagious viral disease caused by foot and mouth disease virus (FMDV), and the susceptible animals include more than 70 kinds of animals such as pigs, cattle, sheep and other major livestock species. The World Organization for Animal Health (WOAH) lists FMD as a statutory report of animal epidemic, and China also lists it as a class animal epidemic. This epidemic is an insurmountable barrier in international trade.

[0003] In the hundreds of years of FMD epidemic, it has brought huge economic losses to countries and regions around the world. The direct economic losses caused by FMD each year are as high as tens of billions of dollars. Once FMD occurs, many countries will impose restrictions on animal imports and embargoes on the country where the epidemic occurs, thereby affecting normal international trade. If FMDV spreads to wild animals, it will have a serious impact on ecological balance.

[0004] As a viral infectious disease, FMD can rapidly spread between domestic and wild cloven-hoofed animals. FMDV can infect susceptible animals through direct contact, or through contaminated stables or vehicles transporting livestock, and previous studies have shown that FMDV can be transmitted through the air. After the host animal is infected with this disease, it can cause fever, loss of appetite, weight loss, lameness, drooling and depression, and can form water blister ulcers on the mouth, teats and hooves of infected animals. Therefore, through genetic engineering technology, it will be a new development direction for the prevention and treatment of foot and mouth disease virus to prevent or cultivate pigs resistant to foot and mouth disease virus infection. SUMMARY

[0005] In order to solve the above technical problems, the purpose of the present application is to provide the use of ERBIN gene / protein as a target in screening drugs for preventing or treating foot and mouth disease virus infection. By knocking out the ERBIN gene, the infection of foot and mouth disease virus can be effectively inhibited.

[0006] The technical solution of the present application to solve the above technical problems is as follows: the use of ERBIN gene / protein as a target in screening drugs for preventing or treating foot and mouth disease virus infection is provided. The ERBIN gene ID is ENSSSCG00000016954.

[0007] The present application also provides use of the ERBIN gene / protein expression inhibitor in the preparation of a medicine for preventing or treating foot-and-mouth disease virus infection.

[0008] Further, the medicine for preventing or treating foot-and-mouth disease virus infection has at least one of the following functions:

[0009] 1) inhibiting foot-and-mouth disease virus adsorption or internalization;

[0010] 2) inhibiting foot-and-mouth disease virus proliferation;

[0011] 3) inhibiting foot-and-mouth disease virus infection;

[0012] 4) inhibiting expression of foot-and-mouth disease virus receptors.

[0013] Further, the foot-and-mouth disease virus receptors are integrins and / or heparan sulfate.

[0014] Further, the ERBIN gene / protein expression inhibitor is at least one of a nucleic acid molecule, a small molecule compound, a polypeptide, a protein, a gene editing vector, a lentivirus or an adeno-associated virus.

[0015] Further, the ERBIN gene / protein expression inhibitor includes sgRNA targeting knockout of the ERBIN gene / protein.

[0016] Further, the sgRNA is GTACCATGTCGTTGTCTACG.

[0017] The present application also provides a medicine combination for preventing or treating foot-and-mouth disease virus infection, comprising the above-mentioned ERBIN gene / protein expression inhibitor.

[0018] The present application also provides use of the ERBIN gene in the preparation of a pig for breeding foot-and-mouth disease virus-resistant varieties.

[0019] The present application has the following beneficial effects:

[0020] The present application uses the ERBIN gene / protein as a target in a medicine for preventing or treating foot-and-mouth disease virus infection, and by knocking out the ERBIN gene, the infection of foot-and-mouth disease virus can be effectively inhibited. BRIEF DESCRIPTION OF DRAWINGS

[0021] Figure 1 Sequencing diagram for ERBIN gene knockout cell line;

[0022] Figure 2 FMDV infection candidate host gene mixed knockout cell virus RNA copy number detection results. DETAILED DESCRIPTION

[0023] The principles and features of the present application are described below, and the examples are used to explain the present application, but are not intended to limit the scope of the present application. Unless otherwise specified, the specific conditions in the examples are carried out under conventional conditions or manufacturer's recommended conditions. The reagents or instruments used are not specified by the manufacturer, but are conventional products that can be purchased on the market.

[0024] Example 1 Preparation of gene mixed targeting cell line

[0025] 1. The CRISPR-PB vector system was used to construct the gene knockout mixed clone cell line. The system is a three-plasmid system, including the plasmid pBase for transient expression of PB transposase, the pCRISPR-S10 plasmid containing Cas9 protein, and the piggyBac transposon backbone vector PB-CRISPR-Sg4 containing sgRNA target sequence.

[0026] 2. According to the sgRNA target sequence information of the ERBIN gene, the sgRNA knockout vector was constructed, and the sgRNA target information is shown in Table 1.

[0027] When constructing the sgRNA targeting sequence vector, Bbs I sticky end sequences need to be added at both ends of the sequence. The upstream and downstream target primers are annealed to form a double-stranded sequence, and the annealing reaction system and reaction program are shown in Table 2. Then, the PB-CRISPR-sg4 backbone vector is digested with Bbs I, and the ligation reaction system and reaction program are shown in Table 3. After successful sequencing and insertion, the PB-CRISPR-sg4 vector with sgRNA target sequence inserted into the host gene is obtained.

[0028] The primer sequence information is as follows:

[0029] ERBIN-F: CACCGGTACCATGTCGTTGTCTACG;

[0030] ERBIN-R: AAACCGTAGACAACGACATGGTACC.

[0031] Table 1 sgRNA target information

[0032]

[0033] Table 2 Annealing reaction system and reaction program

[0034]

[0035] Table 3 Ligation reaction system and reaction program

[0036]

[0037] 3、Subsequently, PB-CRISPR-Sg4 plasmid, pCRISPR-S10 plasmid and pBase plasmid are transiently transfected into wild type IBRS-2 cells, 24h after transfection, the cells are treated with culture medium containing 3 μg / mL puromycin and 4 μg / mL doxycycline, and after 80% of the cells die, the drug screening is stopped for recovery culture, and after about a week, the genomic DNA of the cells is extracted, and after PCR amplification, genome sequencing is performed to determine the targeting of the candidate gene, and the ERBIN gene primer sequence is shown in Table 4; the sequencing results are shown in Figure 1 .

[0038] Table 4 Identification primer of ERBIN gene knockout cell line

[0039]

[0040] It can be seen from Figure 1 that the ERBIN gene appears a nested peak at the target site, indicating that the mixed knockout cell line of the ERBIN gene is successfully constructed.

[0041] Example 2 ERBIN gene mixed knockout cell anti-FMDV phenotype

[0042] The ERBIN gene mixed knockout cells are inoculated in a 12-well plate, and when the cells grow to about 90% density, the ERBIN gene mixed knockout cells are infected with FMDV at MOI = 0.01; 24h after viral infection, the cells are collected, and after extraction of viral RNA, the viral RNA copy number is detected, and the FMDV absolute quantification primer is shown in Table 5, and the results are shown in Figure 2 .

[0043] Table 5 FMDV absolute quantification primer sequence

[0044]

[0045] It can be seen from Figure 2 that the ERBIN gene mixed knockout cell line shows a significant inhibitory effect on FMDV infection.

[0046] The above only describes the preferred embodiments of the present application, and is not intended to limit the present application, and any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application shall be included in the protection scope of the present application.

Claims

1. ERBIN The use of gene / protein expression inhibitors in the preparation of drugs for the prevention or treatment of foot-and-mouth disease virus infection; ERBIN Gene / protein expression inhibitors are gene editing systems composed of sgRNA and CRISPR / Cas9 that work by knocking out gene expression inhibitors. ERBIN Genes are used to suppress their expression.

2. The use as described in claim 1, characterized in that, The drug for preventing or treating foot-and-mouth disease virus infection has at least one of the following functions: 1) Inhibits the adsorption or internalization of foot-and-mouth disease virus; 2) Inhibits the growth or proliferation of foot-and-mouth disease virus; 3) Inhibits foot-and-mouth disease virus infection; 4) Inhibit the expression of foot-and-mouth disease virus receptors.

3. The use as described in claim 2, characterized in that, The foot-and-mouth disease virus receptor is integrin and / or heparan sulfate.

4. The use as described in claim 1, characterized in that, The sgRNA is GTACCATGTCGTTGTCTACG.

Images