Use of adipose exosomal miR-146a-5p in muscle development regulation

Abstract

The application relates to the field of bioengineering technology, and particularly relates to application of fat exosome miR-146a-5p in muscle development regulation. The nucleotide sequence of the miR-146a-5p is 5'-UGAGAACUGAAUUCCAUGGGUU-3', muscle cell differentiation is promoted by improving fat exosome miR-146a-5p gene expression, the miR-146a-5p loaded by the fat-derived exosome can be targeted and combined with an IGF1R gene, IGF1R signals are mediated to participate in muscle cell differentiation, metabolism regulation of cells is realized, and muscle development is effectively promoted.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of bioengineering technology, in particular to the application of fat exosome miR-146a-5p in muscle development regulation. BACKGROUND

[0002] Fat tissue is composed of many cells and is the largest energy reservoir in the human body. The most abundant cell type in fat tissue is called "adipocyte". Adipocytes are mainly composed of lipid droplets and are divided into two lineages: white adipose tissue (WAT) and brown adipose tissue (BAT). The main functions of adipose tissue include energy storage, energy supply and body temperature regulation. In addition, adipose tissue is an active endocrine organ that can synthesize and secrete bioactive molecules with regulatory functions, known as "adipokines". Specifically, adipocytes secrete adipokines, which exert their effects through autocrine, paracrine and endocrine pathways. Different adipokines have their own physiological functions, and in adipose tissue, adipokines are involved in adipogenesis, adipocyte metabolism and immune cell migration. The secretion of adipokines provides a link between lipid accumulation in adipose tissue and metabolic functions in other tissues such as muscle and liver. At the whole body level, adipokines can regulate different biological processes in target organs, including muscle.

[0003] Exosomes have been recognized as an important way to mediate inter-tissue signaling and functional regulation. Adipocytes send genetic information to target cells through the exosome secretion pathway to regulate gene expression and thus regulate metabolic activity in distant organs such as skeletal muscle. However, it is still unclear whether adipose exosomes have the function of regulating muscle development and their potential targeting mechanisms.

[0004] Therefore, analyzing the target points of adipose exosome-mediated muscle development regulation has important value for regulating animal muscle development, fat deposition, and improving meat quality, and also has certain reference significance for human health. SUMMARY

[0005] The present application aims to avoid the shortcomings in the prior art and provides the application of fat exosome miR-146a-5p in muscle development regulation. The miR-146a-5p loaded in adipose-derived exosomes can target and bind to the IGF1R gene, participate in muscle cell differentiation by mediating IGF1R signaling, realize metabolic regulation of cells, and effectively promote muscle development.

[0006] To achieve the above-mentioned application purposes,

[0007] The application provides an application of fat exosome miR-146a-5p in regulating muscle development, and a nucleotide sequence of the miR-146a-5p is 5'-UGAGAACUGAAUUCCAUGGGUU-3', and muscle cell differentiation is promoted by improving gene expression of the fat exosome miR-146a-5p.

[0008] In some embodiments, the application comprises:

[0009] The application of fat exosome miR-146a-5p in identifying muscle cell development potential, and the expression level of the miR-146a-5p is proportional to muscle cell development potential;

[0010] The application of fat exosome miR-146a-5p in a molecular marker of muscle cell differentiation gene expression level.

[0011] The application of fat exosome miR-146a-5p in participating in muscle cell regulation, and the miR-146a-5p participates in development regulation of muscle cells by target binding of IGF1R gene, wherein the miR-146a-5p mediates IGF1R signal to inhibit IGF1R gene expression, so that muscle development can be promoted.

[0012] The application of fat exosome miR-146a-5p in establishing a dynamic individual development detection system of fat exosome miRNAs signal establishment.

[0013] The application of fat exosome miR-146a-5p in muscle development metabolism, a nucleotide sequence of the fat exosome miR-146a-5p is 5'-UGAGAACUGAAUUCCAUGGGUU-3', and the fat exosome miR-146a-5p target binds IGF1R gene to start muscle cell differentiation.

[0014] A muscle regulator is provided, and the regulator contains a mimic of fat exosome miR-146a-5p.

[0015] In some embodiments, a sequence of the mimic of the miR-146a-5p is: a positive sequence 5'-UGAGAACUGAAUUCCAUGGGUU-3',

[0016] a negative sequence 5'-CCCAUGGAAUUCAGUUCUCAUU-3'.

[0017] The application of the above muscle regulator is provided, and the application comprises any one of the following applications:

[0018] The application of fat exosome miR-146a-5p in promoting muscle development;

[0019] Application of fat exosome miR-146a-5p as a signal molecule to target intervention of IGF1R gene;

[0020] Application of genetic auxiliary molecular marker of fat exosome miR-146a-5p mediated muscle development regulation;

[0021] Application of fat exosome miR-146a-5p in development of drugs and targets for muscle development regulation.

[0022] Beneficial effects of the application of fat exosome miR-146a-5p in muscle development regulation:

[0023] (1) The application of fat exosome miR-146a-5p in muscle development regulation, the application first discovers that fat can regulate muscle development through the exosome pathway, wherein fat exosome miR-146a-5p is an important fat factor, and muscle development is regulated by utilizing the significant correlation of fat exosome miR-146a-5p to muscle development, wherein promoting fat exosome miR-146a-5p can promote muscle development, and muscle cells are regulated by utilizing fat exosome miR-146a-5p.

[0024] (2) The application of fat exosome miR-146a-5p in muscle development regulation, it is first discovered that miR-146a-5p participates in the development regulation of muscle cells by targeting IGF1R gene, wherein miR-146a-5p mediates IGF1R signal to inhibit IGF1R gene expression, and therefore, muscle development can be promoted by inhibiting IGF1R gene expression. BRIEF DESCRIPTION OF DRAWINGS

[0025] Figure 1 is a fat exosome separation and identification result graph in the specific embodiment mode of the application, including

[0026] A graph: exosome electron microscope detection result extracted from in vitro adipose tissue;

[0027] B graph: exosome particle size distribution;

[0028] C graph: Western blot bands of marker proteins Alix, TSG101, CD9 and CD63 in exosomes (WAT-Exos) extracted from in vitro adipose tissue and endoplasmic reticulum marker protein Calnexin in adipocytes;

[0029] D. Figure: Fluorescent quantitative PCR detection of miR-146a-5p gene in four kinds of fat exosomes (Flox-iWAT-Exos, Flox-eWAT-Exos, aKO-iWAT-Exos, aKO-eWAT-Exos);

[0030] Flox represents wild type mice; aKO represents fat-specific knockout of miR-146a-5p; Flox-iWAT-Exos represents exosomes derived from Flox mouse inguinal white fat; Flox-eWAT-Exos represents exosomes derived from Flox mouse epididymal white fat; aKO-iWAT-Exos represents exosomes derived from aKO mouse inguinal white fat; aKO-eWAT-Exos represents exosomes derived from aKO mouse epididymal white fat.

[0031] Figure 2 is a result graph of fat exosome stimulation of C2C12 cells in the specific embodiment of the present application, including

[0032] A. Figure: Western blot detection of protein levels of muscle differentiation-related genes MyHC, MyoD and MyoG, muscle atrophy-related genes Fbx32 and MuRF;

[0033] B. Figure: MyHC immunofluorescence staining of myotubes and statistical results of myotube diameter;

[0034] C. Figure: Protein expression levels of MyHC, MyoD, MyoG, Pax7, Fbx32 and MuRF in C2C12 cells treated with miR-146a-5p mimics;

[0035] D. Figure: MyHC immunofluorescence staining of myotubes and statistical results of myotube diameter;

[0036] aKO-Exos+Mimics represents C2C12 cell myotubes treated by co-incubation of aKO-WAT-Exos with miR-146a-5p mimics.

[0037] Figure 3 is a function verification of miR-146a-5p gene in the specific embodiment of the present application, including

[0038] A. Figure: miR-146a-5p transfection efficiency results graph after transfection of C2C12 cells with miR-146a-5p mimics;

[0039] B. Figure: MyHC immunofluorescence staining of myotubes after transfection of C2C12 cells with miR-146a-5p mimics;

[0040] C. Western blot analysis of IGF1R and muscle differentiation related genes protein levels after transfection of C2C12 cells with miR-146a-5p mimic. DETAILED DESCRIPTION

[0041] Preferred embodiments of the present application will be described in greater detail below, with reference to the accompanying drawings. While preferred embodiments of the present application are shown in the drawings, it is understood that the present application can be embodied in various forms without being limited by the embodiments set forth herein. Rather, these embodiments are provided so that this application will be thorough and complete, and fully convey the scope of the application to those skilled in the art.

[0042] Example 1

[0043] The research object of this embodiment is adipose-specific knockout miR-146a-5p (aKO) and wild-type (Flox) mouse isolated adipose exosomes. The isolation method of adipose exosomes is disclosed, including identification and structural observation of adipose exosomes.

[0044] Specifically, by observing the identification of adipose exosomes, the steps include:

[0045] Exosome extraction: white adipose tissue was removed from 8-12 week old Flox mice and aKO mice, washed three times in PBS solution, and the adipose tissue was cut into small pieces with a diameter of less than 3 mm, in 10% exosome-free serum DMEM-High Glucose basal medium, and after 24h, the culture supernatant was collected on ice at 300g for 10min to remove floating cells, followed by 2000g for 10min to remove dead cells, then the exosomes were filtered through a 0.22μm PVDF filter into a 38.5mL ultracentrifuge tube (Beckman Coulter), and the subsequent supernatant was ultracentrifuged at 120000g for 90min, the supernatant was carefully aspirated, the precipitate was resuspended in 100-150μL PBS buffer, and stored at -80℃. The exosomes from different mice were named Flox-iWAT-Exos, Flox-eWAT-Exos, aKO-iWAT-Exos, aKO-eWAT-Exos, respectively.

[0046] Fat exosome identification: Transmission electron microscopy imaging analysis was performed on fat exosomes. 10 μL of exosomes were placed on a 400-mesh polyvinyl acetate methyl vinyl ether-coated copper grid, incubated for 5 min, then the excess liquid was discarded, and uranyl acetate was added to the grid for negative staining for 1 min, the excess liquid was discarded, and the sample was observed under a transmission electron microscope at 100 kV; the size distribution and concentration of fat exosomes were determined by Nanosight instrument; Western Blot detection was used to identify the expression of exosome marker proteins Alix, TSG101, CD63 and CD9, and endoplasmic reticulum membrane protein Calnexin.

[0047] The morphology of exosomes and the main distribution of exosome diameter between 50-170 nm were observed by electron microscopy Figure 1 A) and nanoparticle size Figure 1 B). In addition, Western Blot detection found that exosome marker proteins Alix, TSG101, CD63 and CD9 were detected in fat exosomes, while endoplasmic reticulum marker protein Calnexin Figure 1 C) was detected in adipocytes. qPCR detection results found that the expression level of miR-146a-5p in aKO-iWAT-Exos was significantly lower than that in Flox-iWAT-Exos, and the expression level of miR-146a-5p in aKO-eWAT-Exos was also significantly lower than that in Flox-eWAT-Exos Figure 1 D). The above results collectively indicate that fat exosomes have been successfully extracted.

[0048] From the above experimental results, it can be seen that the above separation and identification method can effectively harvest fat exosomes, providing real materials for studying the muscle development regulation function of fat exosomes.

[0049] Example 2

[0050] To further illustrate the regulation function of fat exosomes on muscle cells, Example 2 was carried out on the basis of Example 1:

[0051] The research object of this example is the regulation function of fat-specific knockout miR-146a-5p (aKO) and wild-type (Flox) mouse isolated fat exosomes on muscle cells. It is disclosed that fat-derived exosome miR-146a-5p can effectively promote muscle cell differentiation, indicating that fat exosomes can effectively regulate muscle cell differentiation, including:

[0052] Fat exosome-mediated muscle differentiation regulation: as Figure 2A) Western Blot analysis was performed to detect the protein expression levels of MyHC, MyoD, MyoG, Fbx32 and MuRF. The results showed that aKO-iWAT-Exos and aKO-eWAT-Exos significantly inhibited the protein abundance of MyHC, MyoD, MyoG, Fbx32 and MuRF in C2C12 cells, while Flox-iWAT-Exos and Flox-eWAT-Exos significantly promoted the protein abundance of MyHC, MyoD, MyoG, Fbx32 and MuRF in C2C12 cells.

[0053] Immunofluorescence staining of MyHC gene was performed on C2C12 cell myotubes treated with PBS, Flox-iWAT-Exos, Flox-eWAT-Exos, aKO-iWAT-Exos and aKO-eWAT-Exos. Figure 2 A) The diameter of C2C12 cell myotubes was not significantly changed after treatment with Flox-iWAT-Exos and Flox-eWAT-Exos, while aKO-iWAT-Exos and aKO-eWAT-Exos significantly reduced the diameter of C2C12 cell myotubes Figure 2 B) The results suggested that aKO mouse adipose exosomes (miR-146a-5p knockdown) significantly inhibited the expression of C2C12 cell differentiation-related genes and C2C12 cell myofiber diameter, and promoted the expression of atrophy-related genes.

[0054] Subsequently, to determine whether adipose exosomes mediate C2C12 myofiber development through miR-146a-5p. The present application used adipose exosomes aKO-Exos to co-incubate with miR-146a-5p mimics to treat C2C12 cells, and Western Blot analysis showed that aKO-Exos+mimics significantly promoted the protein expression abundance of MyHC, MyoD, MyoG and Pax7, and significantly inhibited the protein expression abundance of Fbx32 and MuRF Figure 2 C) MyHC immunofluorescence staining results showed that aKO-Exos+mimics significantly promoted the myofiber diameter of C2C12 cells Figure 2 D).

[0055] The research object of this embodiment is the regulatory function of isolated adipose exosomes of fat-specific knockout miR-146a-5p (aKO) and wild-type (Flox) mice on muscle cells. The extracted adipose exosomes were used to stimulate C2C12 cells, and Western Blot and immunofluorescence staining were used to confirm that aKO-Exos and miR-146a-5p mimics were co-incubated to treat C2C12 cells. The backfilling of this specific miR-146a-5p promotes the differentiation of C2C12 cells and inhibits atrophy, reversing the phenotype of aKO-Exos inhibiting the differentiation of C2C12 cells and promoting atrophy, proving that adipose exosomes are involved in the differentiation regulation of muscle cells.

[0056] Example 3

[0057] To further illustrate the expression pattern of adipose exosome miRNAs in muscle differentiation, Example 3 is based on Example 2:

[0058] The research object of this embodiment is the regulatory function of miR-146a-5p on muscle differentiation. This embodiment uses miRNAs transfection technology to achieve overexpression of miR-146a-5p in C2C12 cells using miR-146a-5p mimics to verify the role of miR-146a-5p in the regulation of muscle cell differentiation function, and to illustrate that adipose exosome-delivered miR-146a-5p can regulate muscle development phenotype, including:

[0059] Transfection of C2C12 cells: When C2C12 cells grow to 75%-90%, transfection reagent Lipofectamine2000 is used to transfect C2C12 cells.

[0060] Transfection sequence of the control group:

[0061] Sense sequence 5'-UUCUCCGAACGUGUCACGUTT-3';

[0062] Antisense sequence 5'-ACGUGACACGUUCGGAGAATT-3',

[0063] Mimic sequence of miR-146a-5p:

[0064] Sense sequence: 5'-UGAGAACUGAAUUCCAUGGGUU-3',

[0065] Antisense sequence: 5'-CCCAUGGAAUUCAGUUCUCAUU-3',

[0066] Inhibitor sequence of miR-146a-5p:

[0067] AACCCAUGGAAUUCAGUUCUCA,

[0068] The whole experiment period was transfected 3 times, and each time was transfected once every 2 days.

[0069] The C2C12 cells transfected by miR-146a-5p were verified by RT-qPCR to determine the expression level of miR-146a-5p in C2C12 cells, so as to determine the transfection efficiency, and the results were as shown in FIG. A of Figure 3 FIG. A, which shows that the transfection reagent and method used in the present example can realize overexpression and knockdown of miR-146a-5p in C2C12 cells.

[0070] The differentiation regulation ability of C2C12 cell miR-146a-5p was detected by immunofluorescence staining, and the results were as shown in FIG. B of Figure 3 which shows that overexpression of miR-146a-5p in C2C12 cells promotes myotube differentiation of C2C12 cells. Subsequently, the metabolic pathway of C2C12 cells mediated by miR-146a-5p was determined by Western Blot, and the results were as shown in FIG. C of Figure 3 which shows that overexpression of miR-146a-5p in C2C12 cells can mediate muscle cell differentiation by targeting IGF1R gene.

[0071] In the present example, the regulation function of adipose-derived exosome miR-146a-5p on muscle development was determined, and the relationship between adipose-derived exosome miR-146a-5p and muscle cell differentiation was explored. By transfecting the mimics and inhibitors of miR-146a-5p into C2C12 cells, overexpression and knockdown of miR-146a-5p in C2C12 cells were realized, and RT-qPCR, immunofluorescence staining and Western Blot were combined to confirm that adipose-derived exosome miR-146a-5p has the function of promoting muscle cell differentiation.

[0072] In combination with Embodiment 1 to Embodiment 3, the adipose-specific knockout miR-146a-5p (aKO) and wild-type (Flox) mice adipose-derived exosomes are isolated, and the particle size is detected, the electron microscope is observed, and the Western Blot is determined, so as to obtain the adipose-derived exosomes. In order to verify the function of the adipose-derived exosome miR-146a-5p on muscle differentiation, the adipose-specific knockout miR-146a-5p (aKO) and wild-type (Flox) mice adipose-derived exosomes are respectively stimulated C2C12 cells, and the Western Blot and immunofluorescence staining observation show that the aKO-Exos and the miR-146a-5p mimics are co-incubated to treat the C2C12 cells. The backfilling of the specific miR-146a-5p promotes the differentiation of the C2C12 cells, inhibits the atrophy, and reverses the phenotype of the aKO-Exos inhibiting the differentiation of the C2C12 cells and promoting the atrophy, so as to prove that the adipose-derived exosomes participate in the differentiation regulation of the muscle cells.

[0073] In order to explore the influence of the miR-146a-5p on the differentiation of the C2C12 cells, the miR-146a-5p mimics and the miR-146a-5p inhibitor are transfected in the differentiation stage of the C2C12 cells, the expression of the miR-146a-5p is detected according to the RT-qPCR, it is proved that the mimics and the inhibitor can effectively realize the overexpression and knockdown of the miR-146a-5p in the C2C12 cells. Then, the immunofluorescence staining and the Western Blot detection prove that the adipose-derived exosome miR-146a-5p can promote the myotube differentiation of the C2C12 cells. The Western Blot detection of the pathway change of the miR-146a-5p in the protein metabolism function regulation of the C2C12 cells finds that the miR-146a-5p realizes the metabolism function regulation of the muscle cells by targeting the IGF1R gene, and promotes the differentiation of the muscle cells.

[0074] In the research, the adipose-derived exosomes (Flox-WAT-Exos and aKO-WAT-Exos) from the wild-type (Flox) and aKO mice are respectively treated C2C12 myoblasts. It is firstly clarified that the adipose-derived exosome miR-146a-5p has a significant correlation with the muscle development. The aKO-WAT-Exos inhibits the differentiation and promotes the atrophy of the C2C12 cells. When the miR-146a-5p mimics and the aKO-WAT-Exos are co-incubated to treat the C2C12 cells, the phenotype is reversed. The miR-146a-5p mimics are transfected into the muscle cells to enhance the expression level of the miR-146a-5p in the muscle cells, so as to promote the differentiation of the muscle cells.

[0075] The application firstly finds that miR-146a-5p in fat exosomes is a key factor for regulating muscle development; firstly confirms that the differential expression of miR-146a-5p in fat exosomes is the main reason for affecting muscle cell differentiation; firstly finds that fat exosome miR-146a-5p targets and combines IGF1R gene to participate in the development regulation of muscle cells. The finding provides new insights for exosome-mediated miRNA regulation of muscle and fat development and interaction, and provides a new target and material for animal meat quality regulation.

[0076] The above merely describes the preferred embodiments of the present application and is not intended to limit the present application. For those skilled in the art, the present application can have various modifications and changes. Any modification, equivalent replacement, improvement, etc. within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. Use of fat exosomal miR-146a-5p in the regulation of muscle development, characterized in that, The application is the application of transfecting miR-146a-5p mimic in vitro to promote the increase of myotube diameter of myoblasts, the nucleotide sequence of the miR-146a-5p is: 5'-UGAGAACUGAAUUCCAUGGGUU-3', the sequence of the miR-146a-5p mimic is: Sense sequence: 5'-UGAGAACUGAAUUCCAUGGGUU-3', Antisense sequence: 5'-CCCAUGGAAUUCAGUUCUCAUU-3'.

Images