A cucumber CsROS1 gene and its application in regulating cucumber fruit stalk length

Abstract

The present invention discloses a cucumber CsROS1 gene and its application in regulating the length of cucumber fruit stalks, including: the nucleotide sequence of the CsROS1 gene is shown in SEQ ID NO.1, and the protein amino acid sequence is shown in SEQ ID NO.2. The present invention uses CRISPR / Cas9 gene editing technology to obtain a CsROS1 gene knockout homozygous mutant strain for the first time, and performs functional verification, proving that the mutant strain can effectively increase the length of cucumber fruit stalks, improve the recognition rate and harvest success rate of mechanically harvested cucumber fruits.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and in particular relates to a cucumber CsROS1 gene and an application thereof in regulating the length of cucumber fruit stalks. Background Art

[0002] Cucumber (Cucumis sativus L.) is an important vegetable crop in my country. In 2021, its planting area accounted for about 59.5% of the global total, and its output accounted for 80.8% of the world's total, ranking first in the world (FAO, 2021). Although the facility cultivation area and yield of cucumbers continue to increase, due to factors such as the low penetration rate of mechanization and the high rate of damage to mechanical harvested fruits, its planting and harvesting are still labor-intensive, which hinders the further development of the cucumber industry. Therefore, in the process of cucumber production, safe and efficient mechanized harvesting has become increasingly important. Long fruit stalks can improve the accuracy of positioning and cutting during mechanical picking, and significantly improve the fruit harvest rate. Therefore, identifying candidate genes for cucumber fruit stalk regulation and cultivating cucumber varieties with long fruit stalk characteristics have important application value for cucumber germplasm innovation and mechanical harvesting.

[0003] Studies have shown that epigenetic modifications play a key role in regulating crop yield and quality traits. DNA methylation is one of the important modifications, which mainly occurs at the fifth carbon atom of cytosine in plants, including three types: CG, CHG and CHH. This modification usually promotes or inhibits the transcriptional activity of genes by changing the chromatin structure or regulating the accessibility of transcription factors. The DNA methylation level is affected by the synergistic action of DNA methyltransferases and demethylases, and thus presents a dynamic balance in the plant body, and participates in regulating important biological processes such as plant vegetative growth, reproductive growth, and response to biotic and abiotic stresses. The protein encoded by the ROS1 gene is a DNA demethylase that plays a key role in reducing the DNA methylation level of the whole genome of plants. However, in the case of cucumber, the epigenetic breeding system has not yet been perfected, and the CsROS1 (CsaV3_6G040410) gene and its function in regulating the length of the fruit stalk have not yet been reported. Summary of the invention

[0004] The purpose of this section is to summarize some aspects of embodiments of the present invention and briefly introduce some preferred embodiments. Some simplifications or omissions may be made in this section and the specification abstract and the invention title of this application to avoid blurring the purpose of this section, the specification abstract and the invention title, and such simplifications or omissions cannot be used to limit the scope of the present invention.

[0005] In view of the above problems and / or the problems existing in the prior art, the present invention is proposed.

[0006] In order to solve the above technical problems, the present invention provides the following technical solution: CsROS1 gene, characterized in that: comprising the following (A1) or (A2):

[0007] (A1) The nucleotide sequence is the DNA molecule shown in SEQ ID No. 1;

[0008] (A2) The coding region is the DNA molecule shown in SEQ ID No. 1 from position 1 to position 5349 from the 5' end.

[0009] Another object of the present invention is to overcome the deficiencies in the prior art and provide a CsROS1 protein for translating the CsROS1 gene of claim 1.

[0010] The protein is as shown in any one of (B1) to (B4):

[0011] (B1) a protein having an amino acid sequence of SEQ ID NO. 2;

[0012] (B2) a protein derived from SEQ ID NO. 2 having the same function as that of SEQ ID NO. 2, wherein one or more amino acid residues are substituted and / or deleted and / or added;

[0013] (B3) a protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more homology to the amino acid sequence defined in any one of (B1) to (B2) and having the same function;

[0014] (B4) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein defined in any one of (B1) to (B3).

[0015] As a preferred embodiment of the CsROS1 gene of the present invention, the length of the CsROS1 gene is 5349 bp, and the number of amino acids encoded in the CsROS1 gene is 1782 bp.

[0016] Another object of the present invention is to overcome the deficiencies in the prior art and provide a recombinant vector of the CsROS1 gene.

[0017] The nucleotide sequence of the recombinant vector is shown in SEQ ID No. 3, which contains a gene encoding the CsROS1 protein.

[0018] Another object of the present invention is to overcome the deficiencies in the prior art and provide a method for regulating the length of the fruit stalk, characterized in that the CsROS1 gene is overexpressed.

[0019] Another object of the present invention is to overcome the deficiencies in the prior art and provide a method for regulating the length of the fruit stalk to cultivate plant varieties, characterized in that: comprising: introducing a nucleic acid molecule capable of expressing the CsROS1 protein into a recipient plant to obtain a transgenic plant; the transgenic plant cucumber fruit stalk length is longer than that of the recipient plant;

[0020] The recipient plant is the cucumber inbred line "9930".

[0021] As a preferred embodiment of the CsROS1 gene of the present invention, the introduction of a nucleic acid molecule expressing the CsROS1 protein into a recipient plant is achieved by introducing a recombinant expression vector containing a nucleic acid molecule capable of expressing the CsROS1 protein into the recipient plant.

[0022] Another object of the present invention is to overcome the deficiencies in the prior art and provide an application of a CsROS1 gene in plant breeding.

[0023] Beneficial effects of the present invention:

[0024] The present invention uses the main cucumber variety "9930" as material, and uses CRISPR / Cas9 gene editing technology to obtain a CsROS1 gene knockout homozygous mutant strain, and proves that the fruit stalk of the mutant strain is significantly increased compared with the wild type, and the lignin content of the fruit stalk of the mutant strain is unchanged, which does not affect the load-bearing capacity of the fruit stalk. The research results of the present invention have important production and theoretical research significance in the fields of cucumber breeding and creation of germplasm resources. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for describing the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative labor. Among them:

[0026] Figure 1 This is a graph showing the expression specificity of the CsROS1 gene in Example 1 of the present invention.

[0027] Figure 2 This is a diagram of the gene-edited nucleotide sequence of the gene-edited cucumber mutant of CsROS1 in Example 1 of the present invention.

[0028] Figure 3 The figure shows the phenotypes of the female flowers and fruit stalks of the wild-type and transgenic cucumbers in Example 1 of the present invention.

[0029] Figure 4 The phenotypes of the cucumbers and fruit stalks of the wild-type and transgenic cucumbers in Example 1 of the present invention on the 20th day after field pollination.

[0030] Figure 5 The fruit stalk length of the wild-type and transgenic cucumbers in Example 1 of the present invention was measured 20 days after field pollination.

[0031] Figure 6 The lignin content of the fruit stalk of the wild-type and transgenic cucumbers in Example 1 of the present invention was determined 20 days after field pollination.

[0032] Figure 7 This is a graph showing the recognition rate of mechanically harvested fruit stalks in Example 1 of the present invention.

[0033] Figure 8 This is a graph of the harvesting success rate in Example 1 of the present invention. DETAILED DESCRIPTION

[0034] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific implementation methods of the present invention are described in detail below in conjunction with the embodiments of the specification.

[0035] In the following description, many specific details are set forth to facilitate a full understanding of the present invention, but the present invention may also be implemented in other ways different from those described herein, and those skilled in the art may make similar generalizations without violating the connotation of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.

[0036] Secondly, the term "one embodiment" or "embodiment" as used herein refers to a specific feature, structure, or characteristic that may be included in at least one implementation of the present invention. The term "in one embodiment" that appears in different places in this specification does not necessarily refer to the same embodiment, nor does it refer to a separate or selective embodiment that is mutually exclusive with other embodiments.

[0037] Unless otherwise specified, the raw materials used in the embodiments of the present invention are commercially available;

[0038] The background material of the experiment of the present invention is the cucumber inbred line "9930", and the article "The genome of the cucumber, Cucumis sativus L." was published in the journal Nature Genetics (Sanwen Huang et al., 2009) in 2009. The above germplasm resources are stored in the germplasm bank of the applicant's laboratory.

[0039] The nucleotide sequence of the cucumber CsROS1 gene of the present invention is shown in SEQ ID NO.1, and the amino acid sequence of its protein is shown in SEQ ID NO.2. The nucleotide sequence of the recombinant vector is shown in SEQ ID NO.3.

[0040] Example 1

[0041] Acquisition of CsROS1 gene knockout mutants:

[0042] 1. Expression of CsROS1 gene:

[0043] The transcriptome data of roots, stems, leaves, female flowers, male flowers, tendrils, and fruit stalks of the cucumber inbred line "9930" were analyzed, and it was found that the expression of the CsROS1 gene was tissue-specific, with the highest expression level in the fruit stalk. Figure 1 shown.

[0044] 2. Construction of CsROS1 gene knockout vector

[0045] The CRISPR-P 2.0 tool (http: / / cbi.hzau.edu.cn / CRISPR2 / ) was used to design the target sequence for CRISPR / Cas9 gene editing and knockout of the CsROS1 gene. The designed targets were located in the first and second exon regions of the CsROS1 gene, respectively. The specific target sequences are as follows:

[0046] Table 1

[0047] name 5’-3’ Target1 CCATGGGTTCCTGTGACCCCGG SEQ ID NO.4 Target2 ATATGGAAGAGCGAAAGCAGGG SEQ ID NO.5

[0048] A pair of primers was designed, each containing a target sequence, and a high-fidelity DNA polymerase was used to amplify a target fragment containing U6-26p promoter and U6-26t terminator from the intermediate vector DT1T2 template, and then agarose gel electrophoresis was performed and the gel was recovered for later use.

[0049] The specific primer sequences are as follows:

[0050] Table 2

[0051]

[0052] The PCR reaction system was: 2×Phanta Max Buffer 25μL, dNTP Mix 1μL, template DNA 1μL, Primer-F 2μL, Primer-R 2μL, Phanta Max Super-Fidelity DNA Polymerase 1μL, ddH2O to 50μL. Reaction procedure: 95℃3min; 95℃15sec, 56℃15sec, 72℃60sec, 30 cycles; 72℃5min. The PCR product was detected by gel electrophoresis, the target fragment was cut out, and the product purification kit was used for gel recovery.

[0053] The above-mentioned target fragment gel recovery product was connected to the pkSE402 vector by Golden Gate enzyme digestion and ligation, and transformed into E. coli Fast-T1 competent cells, cultured overnight at 37°C on a solid LB plate containing 50mg / L kanamycin, and a single colony was picked and sent to a sequencing company for sequencing. The sequencing results showed that the CsROS1 gene knockout vector was successfully constructed. The plasmid was extracted from the correctly sequenced bacterial solution using a plasmid extraction kit, and transformed into EHA5α Agrobacterium, cultured at 28°C on a solid LB plate containing 50mg / L kanamycin and 25mg / LRif for 2-3 days, and a single colony was picked and placed in 5mL of liquid LB medium containing 50mg / L Kan and 25mg / LRif, cultured overnight at 28°C and 220r / min shaking, and 1μL of the bacterial solution was taken for PCR identification.

[0054] Table 3

[0055] Sequencing primers 5’-3’ U626-IDF TGTCCCAGGATTAGAATGATTAGGC SEQ ID NO.12

[0056] Table 4

[0057] Identification primers 5’-3 U629-IDF TTAATCCAAACTACTGCAGCCTGAC SEQ ID NO.13 U629-IDR AGCCCTCTTCTTTCGATCCATCAAC SEQ ID NO.14

[0058] The Golden Gate enzyme-linked reaction system was: 3 μl of pkSE402 plasmid, 2 μl of purified target fragment, 1.5 μl of T4 DNA Ligase, 1.5 μl of 10×T4 Ligase Buffer, 1.5 μl of BsaI, and 5.5 μl of ddH2O; the Golden Gate reaction conditions were: 37°C for 3 min, 16°C for 4 min, for a total of 40 cycles; and 80°C for 10 min.

[0059] The PCR reaction system for colony identification was: 2×Rapid Taq Master Mix 10uL, U629-IDF 1uL, U629-IDR 1uL, bacterial solution 1uL, ddH20 7uL; reaction conditions were 95℃3min; 95℃15sec, 56℃15sec, 75℃60sec, 30 cycles; 72℃5min.

[0060] The identified correct bacterial solution was transformed into the cotyledonary nodes of the cucumber inbred line "9930" through Agrobacterium EHA5α-mediated infection to obtain the CsROS1 gene knockout mutant strain. For details of the genetic transformation steps, please refer to the article "Targeted creation of new mutants with compact plant architecture using CRISPR / Cas9 genome editing by an optimized genetic transformation procedure in cucurbit plants" published in Horticulture Research in 2022.

[0061] Example 2

[0062] Validation of CsROS1 knockout mutants:

[0063] The sequences of primers for knockout mutant verification are shown in Table 3:

[0064] Table 5

[0065] name 5’-3’ Target1-F1 TTTCACCGAGAAGATGG SEQ ID NO.8 Target1-R1 CAGACGATAAGCCCAAA SEQ ID NO.9 Target2-F1 AAAACCCTCTTGAACCA SEQ ID NO.10 Target2-R1 GCATCTGAGACCCATAAA SEQ ID NO.11

[0066] PCR amplification was performed using DNA from wild-type and CsROS1 knockout mutant cucumber plants as templates, and the PCR products were sent to a sequencing company for sequencing. The results are as follows: Figure 2 As shown, WT is the wild type, and Csros1#1 and Csros1#2 are two CRISPR / Cas9 gene editing strains. Target1 and Target2 are CRISPR / Cas9 gene editing site sequences. The red framed area is the deletion of CsROS1 after gene editing. In the first exon of the CsROS1 gene, the Csros1#1 strain has a 2-base GT deletion, and the Csros1#2 strain has a 4-base TCCT deletion; in the second exon of the CsROS1 gene, both Csros1#1 and Csros1#2 have a 2-base AA deletion.

[0067] Example 3

[0068] Determination of fruit stalk length of CsROS1 gene knockout mutants:

[0069] like Figure 3 , Figure 4 As shown, the fruit stalk length of Csros1 was significantly longer than that of the wild type.

[0070] All cucumbers whose fruit stalk lengths were measured were from the same node, and the pollination time was marked on a label after artificial pollination to unify the number of days for fruit growth. The length of the fruit stalk was measured with a tape measure 20 days after pollination, with an accuracy of 0.1 cm.

[0071] like Figure 5 As shown, compared with the wild type, the fruit stalk length of the two Csros1 lines was significantly increased.

[0072] Example 4

[0073] Determination of lignin content in fruit stalks of CsROS1 gene knockout mutants:

[0074] The fruit stalks of cucumbers at the same node and 20 days after pollination were taken, dried at 60°C until constant weight was reached, crushed and passed through a 40-mesh sieve, and the lignin content was determined using a lignin content detection kit.

[0075] like Figure 6 As shown in the figure, there was no significant difference in the lignin content of the Csros1 fruit stalk compared with the wild type. The results showed that the knockout of the CsROS1 gene effectively increased the length of the cucumber fruit stalk, but did not affect the lignin content of the fruit stalk and the load-bearing capacity of the fruit stalk.

[0076] Example 5

[0077] Evaluation of mechanical harvesting recognition rate and harvesting success rate of CsROS1 gene knockout mutants:

[0078] Suzhou Botian cucumber picking robot was used for greenhouse operations. Each cucumber variety was harvested 200 times and repeated three times to evaluate the fruit stalk recognition rate and harvesting success rate of the long fruit stalk CsROS1 gene knockout mutant during the harvesting process.

[0079] like Figure 7 and Figure 8 As shown in the figure, compared with the wild type, the recognition rate and harvesting success rate of Csros1 mechanical harvesting fruit stalks were significantly improved. The results showed that CsROS1 gene knockout effectively improved the accuracy and success rate of mechanical harvesting operations.

[0080] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention can be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present invention, which should all be included in the scope of the present invention.

[0081]

[0082]

[0083]

[0084]

[0085]

[0086]

[0087]

[0088]

[0089]

[0090]

[0091]

Claims

1. Application of CsROS1 gene in regulating cucumber fruit stalk length, characterized by: Including, by using CRISPR / Cas9 gene editing technology to obtain a CsROS1 gene knockout homozygous mutant strain, the length of the cucumber stalk can be increased; wherein, the amino acid sequence of the CsROS1 gene is shown in SEQ ID NO.2.

Images