Rice mutant osbadh2 gene, identification method, application and primer thereof

The OsBadh2 gene mutant in rice was rapidly identified using Indel markers and KASP genotyping, solving the problem of low efficiency in identifying and breeding aromatic rice in existing technologies. This enabled a highly efficient and accurate breeding process, resulting in aromatic rice varieties adapted to mechanized seed production.

CN118879741BActive Publication Date: 2025-11-21HUNAN HYBRID RICE RES CENT
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411121890.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-08-15
Publication Date
2025-11-21
Estimated Expiration
2044-08-15

AI Technical Summary

Technical Problem

Existing technologies make it difficult to efficiently and accurately identify and cultivate aromatic rice varieties adapted to mechanized seed production, and the breeding process is cumbersome, costly, and inefficient.

Method used

Using Indel markers and KASP genotyping, a molecular marker of aromatic hybrid rice with a 21bp deletion of the base CTTGGTATTTCACATTTTTCT at position 20381692 on rice chromosome 8 was rapidly identified by combining PCR amplification and KASP genotyping. A male-sterile line of aromatic hybrid rice adapted to mechanized seed production was then bred through hybridization and grain screening.

Benefits of technology

This method enables rapid and accurate identification of the OsBadh2 mutant gene in aromatic rice, shortening the breeding cycle, saving identification time and costs, improving breeding efficiency, and obtaining aromatic rice varieties adapted to mechanized seed production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118879741B_ABST
    Figure CN118879741B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of rice planting, and discloses a mutant type OsBadh2 gene of aromatic rice and an identification method, application and primer thereof. A sequence of the 8th chromosome OsBadh2 gene of Nipponbare rice IRGSP-1.0 version is used as a basic sequence, 21 base pairs of CTTGGTATTTCACATTTTTCT are deleted from the basic sequence at the 20381692th base on the 8th chromosome of the rice, and the mutant type OsBadh2 gene of aromatic rice is obtained. The identification method of the gene, the application of the gene in breeding of a male sterile line of aromatic hybrid rice suitable for mechanized seed production, and corresponding primers are disclosed. Significant technical effects are achieved, and a modified line of aromatic rice suitable for mechanized seed production is finally obtained, which not only saves identification time and cost, but also facilitates crop improvement and germplasm innovation of aromatic varieties, and has significant progress significance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of rice cultivation technology, and in particular relates to a mutant OsBadh2 gene of aromatic rice, its identification method, application and primers. Background Technology

[0002] Unlike conventional rice cultivation, hybrid rice seed production involves numerous technical steps, high requirements, meticulous management, high investment, and significant challenges in mechanization. With the research and development of hybrid rice, a series of simplified, mechanized seed production methods have emerged to reduce seed costs and stabilize the acreage of hybrid rice seed production. Full-process mechanized hybrid rice seed production refers to the mechanization of all stages, from paddy field preparation, leveling, sowing and transplanting, fertilization, plant protection and pesticide application, assisted pollination, harvesting to seed drying. Among these, the mechanized seed production technology involving the mixed sowing and harvesting of small-grain female parents and large-grain male parents is the most valuable due to its green, efficient, simple, and low-cost nature.

[0003] Rice aroma is considered an important quality indicator. Fragrant rice is widely known and popular worldwide, providing a broad market prospect for its research. Furthermore, the increasing competition in the domestic rice market, driven by high-quality imported fragrant rice varieties, makes the cultivation of high-quality fragrant rice a crucial goal in rice breeding. Rice aroma is primarily controlled by the single recessive gene OsBadh2, located on chromosome 8 of rice, which encodes betaine dehydrogenase. Mutations in OsBadh2 promote the conversion of 4-aminobutyric acid (GABA) to 1-pyrrolidine, which then combines with acetyl groups to form the aroma compound 2-AP. The identification of aroma traits is easily influenced by subjective factors. Developing molecular markers for aroma genes and using them for marker-assisted selection can significantly shorten breeding time and improve breeding efficiency. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to overcome the deficiencies and defects mentioned in the background art above, and to provide a method for cultivating a mutant OsBadh2 gene of aromatic rice adapted to mechanized seed production with high efficiency, high accuracy and simple operation, as well as its identification method, application and primers.

[0005] To solve the above-mentioned technical problems, the technical solution proposed by this invention is as follows:

[0006] In a first aspect, the present invention provides a molecular marker for aromatic hybrid rice, wherein the aromatic molecular marker is an Indel marker, which is significantly associated with the aroma trait of rice grains. Using the genome of Nipponbare rice (IRGSP-1.0 version) as a reference genome, the nucleotide sequence of the aromatic hybrid rice molecular marker contains a 21 bp deletion CTTGGTATTTCACATTTTTCT after the base at position 20381692 on chromosome 8 of rice, hereinafter referred to as "molecular marker fgr20381692".

[0007] Preferably, the aroma-type hybrid rice molecular markers described above contain nucleotide sequences as shown in SEQ ID No. 1.

[0008] Secondly, the present invention provides a mutant OsBadh2 gene of aromatic rice, wherein the sequence of the mutant OsBadh2 gene of aromatic rice is based on the OsBadh2 gene sequence of chromosome 8 of Nipponbare rice IRGSP-1.0 version, and a 21 bp deletion of CTTGGTATTTCACATTTTTCT is found after the 20381692nd base on chromosome 8 of rice.

[0009] Preferably, the CDS region of the above-mentioned aromatic rice mutant OsBadh2 gene contains the nucleotide sequence shown in SEQ ID No. 2.

[0010] Thirdly, the present invention provides a method for identifying whether rice contains the aforementioned aromatic rice mutant OsBadh2 gene, comprising the following steps: using the rice genomic DNA to be tested as a template, performing PCR amplification; if only one product of length 153 bp is obtained, it indicates that the sample does not contain the aforementioned rice mutant OsBadh2 gene; if two products of lengths of 132 bp and 153 bp are obtained, it indicates that the sample contains the aforementioned rice mutant OsBadh2 gene and is in a heterozygous state; if only one product of length 132 bp is obtained, it indicates that the sample contains the aforementioned rice mutant OsBadh2 gene in a homozygous state.

[0011] In the above-described identification method, preferably, the nucleotide sequences of the PCR primers used for PCR amplification are as follows:

[0012] fgr20381692-F: 5'-TGCACCTGTCTCTCTTCCAATG-3';

[0013] fgr20381692-R: 5'-GTACTATTTAGTACCATGCTGGGTC-3'.

[0014] Fourthly, the present invention provides another method for identifying whether rice carries the OsBadh2 gene of the aromatic hybrid rice mutant, comprising the following steps: using the genomic DNA of the rice to be tested as a template, performing PCR amplification using the KASP genotyping method; if only fluorescence signal 1, indicating the absence of a 21bp deletion after the 20381692nd base of chromosome 8 of the rice, is obtained, then the sample does not carry the molecular marker of the aromatic hybrid rice; if both signals are obtained, then the sample carries the molecular marker of the aromatic hybrid rice and is in a heterozygous state; if only fluorescence signal 2, indicating the presence of a 21bp deletion after the 20381692nd base of chromosome 8 of the rice, is obtained, then the sample carries the molecular marker of the aromatic hybrid rice in a homozygous state.

[0015] In the above-mentioned identification method, preferably, the fluorescence signal 1 is a FAM signal and the fluorescence signal 2 is a HEX signal; the primer nucleotide sequences used in the KASP genotyping method are as follows:

[0016] fgr20381692-KF:

[0017] 5'-GAAGGTGACCAAGTTCATGCTGTGTAGTTGGGTTGATCACACCTT-3';

[0018] fgr20381692-KH:

[0019] 5'-GAAGGTCGGAGTCAACGGATTGTTGTAGTTGGGTTGATCACACCTC-3';

[0020] fgr20381692-KC:

[0021] 5'-TGGGTCATAAATAAATATAAGCGCAGG-3'.

[0022] In addition to using PCR primers and KASP genotyping primers to identify the aroma molecular marker fgr20381692, other techniques such as second-generation and third-generation sequencing can be used to detect the deletion of 21 bp bases CTTGGTATTTCACATTTTTCT after the 20381692nd base on rice chromosome 8.

[0023] Fifthly, the present invention provides an application of the aforementioned aromatic rice mutant OsBadh2 gene in the breeding of aromatic hybrid rice maternal sterile lines adapted to mechanized seed production, wherein the amino acid sequence encoded by the aromatic rice mutant OsBadh2 gene is shown in SEQ ID No. 3.

[0024] In the above application, preferably, the method includes the following steps: using a small-grained aromatic rice male-sterile line containing the OsBadh2 gene of the aromatic rice mutant as the donor parent, and other male-sterile lines to be improved as the recipient parents, hybridization is carried out to obtain F1, F1 is planted to obtain F2 generation, and the individual plants of the F2 generation are identified as carrying the molecular marker of the aromatic hybrid rice. The individual plants carrying the molecular marker of the aromatic hybrid rice are screened for grain size, and the seeds with qualified grain size are kept for seed production. The above process is repeated for multiple generations until the offspring obtain genetically stable individual plants with homozygous aromatic molecular marker and qualified grain size, that is, the aromatic hybrid rice maternal male-sterile line adapted to mechanized seed production is obtained.

[0025] In the above application, preferably, the donor parent is the small-grained aromatic mutant Zhuo B234S; and the sterile line to be improved is Bing S.

[0026] Preferably, the individual plants carrying the OsBadh2 gene of the aromatic rice mutant are first identified for agronomic traits and resistance, and then the superior individual plants are selected for seed harvesting and grain size screening; the qualified indicators for grain size are: grain length greater than 10 mm and thickness less than 2 mm.

[0027] Sixthly, the present invention provides PCR primers for identifying whether rice contains the aforementioned aromatic hybrid rice molecular marker, the nucleotide sequence of which is as follows:

[0028] fgr20381692-F: 5'-TGCACCTGTCTCTCTTCCAATG-3';

[0029] fgr20381692-R: 5'-GTACTATTTAGTACCATGCTGGGTC-3'.

[0030] This primer can amplify the chromosomal region containing the marker, enabling high-throughput identification of the presence of a fragrance marker.

[0031] In a seventh aspect, the present invention provides a KASP genotyping primer for identifying whether rice carries the aforementioned aromatic hybrid rice molecular marker, the nucleotide sequence of which is as follows:

[0032] fgr20381692-KF:

[0033] 5'-GAAGGTGACCAAGTTCATGCTGTGTAGTTGGGTTGATCACACCTT-3';

[0034] fgr20381692-KH:

[0035] 5'-GAAGGTCGGAGTCAACGGATTGTTGTAGTTGGGTTGATCACACCTC-3';

[0036] fgr20381692-KC:

[0037] 5'-TGGGTCATAAATAAATATAAGCGCAGG-3'.

[0038] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0039] 1. This invention provides a mutant OsBadh2 gene for aromatic rice adapted to mechanized seed production. It utilizes a 21bp deletion of the base CTTGGTATTTCACATTTTTCT after the 20381692nd base on rice chromosome 8 to rapidly identify aromatic rice, reduce the workload of breeding high-quality aromatic rice and shorten the breeding cycle. It provides technical support for the simple, rapid and high-throughput application of molecular marker-assisted breeding technology to improve the aromatic trait adapted to mechanized seed production.

[0040] 2. This invention also provides the application of using the OsBadh2 mutant gene of aromatic rice to cultivate a maternal male-sterile line of aromatic hybrid rice adapted to mechanized seed production. Significant technical effects have been achieved, and ultimately, an improved aromatic rice variety line adapted to mechanized seed production has been obtained. This not only saves identification time and costs, but also facilitates crop improvement and germplasm innovation of aromatic varieties, which has significant progressive significance.

[0041] 3. This invention provides a method and PCR primers and KASP genotyping primers for identifying the OsBadh2 mutant gene in aromatic rice. It can accurately genotype different individuals of the Indel discovered by sequencing, which can further improve the accuracy and efficiency of existing innovative germplasm screening and identification, and is easy to operate. Attached Figure Description

[0042] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0043] Figure 1 This is the result of KASP typing based on the molecular marker fgr20381692.

[0044] Figure 2 The content of 2-AP in Zhuo B234S and its wild-type control material is determined.

[0045] Figure 3 This is the F2 population genotyping statistics of grain 2-AP content.

[0046] Figure 4 It is identified by polyacrylamide gel electrophoresis with fragrance labeling.

[0047] Figure 5 The content of Bingxiang S-1 and its wild-type control material 2-AP is determined. Detailed Implementation

[0048] To facilitate understanding of the present invention, the present invention will be described more fully and in detail below with reference to the accompanying drawings and preferred embodiments, but the scope of protection of the present invention is not limited to the following specific embodiments.

[0049] Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by those skilled in the art. The technical terms used herein are for the purpose of describing particular embodiments only and are not intended to limit the scope of the invention.

[0050] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be purchased from the market or prepared by existing methods.

[0051] Example 1:

[0052] The screening process for a mutant OsBadh2 gene of aromatic rice according to the present invention is as follows:

[0053] 1. Creation of aroma molecular markers for large-grain sterile lines

[0054] Using high-energy heavy ion beams (12C) 6+ The small-grained male-sterile line Zhuo 234S was irradiated. M1 generation seeds after irradiation were grown to the tillering stage. DNA pools were constructed using samples of 500 plants each. Exon capture and targeted deep sequencing were performed using exon capture primers for the rice OsBadh2 gene. After filtering, the sequencing data were aligned to the Nipponbare genome (IRGSP-1.0) as a reference sequence. Pool 168 contained one Indel variant. Pool 168 is the M1 generation DNA pool of Zhuo 234S, containing a mutation within the OsBadh2 gene, specifically a 21 bp deletion of CTTGGTATTTCACATTTTTCT (SEQ ID No. 9) after base position 20381692 on rice chromosome 8. (The reference genome is the IRGSP-1.0 version of the rice variety Nipponbare.)

[0055] KASP genotyping primers were developed for the aforementioned Indel mutation, namely fgr20381692-KF, FH, KC.

[0056] fgr20381692-KF: 5'-GAAGGTGACCAAGTTCATGCTGTGTAGTTGGGTTGATCACAC CTT-3' (SEQ ID No. 4);

[0057] fgr20381692-KH: 5'-GAAGGTCGGAGTCAACGGATTGTTGTAGTTGGGTTGATCACAC CTC-3' (SEQ ID No. 5);

[0058] fgr20381692-KC: 5'-TGGGTCATAAATAAATATAAGCGCAGG-3' (SEQ ID No. 6).

[0059] Using rice genomic DNA as a template, PCR amplification was performed using KASP genotyping primers. If a FAM signal was obtained, the sample did not carry the fgr20381692 molecular marker; if a FAM / HEX signal was obtained, the sample carried the molecular marker fgr20381692 and was heterozygous; if a HEX signal was obtained, it indicated that the sample carried the homozygous molecular marker fgr20381692. Figure 1 ).

[0060] Genotyping of individual plants from pool 145 was performed using the KASP genotyping primers, and a deletion mutation of CTTGGTATTTCACATTTTTCT was identified in the first plant of row 168 in the Zhuo234S M1 generation population. In the M2 population with the same mutation, a homozygous mutant plant was identified and named ZhuoB234S.

[0061] Specific PCR primers were designed using the 21 bp deletion of the CTTGGTATTTCACATTTTTCT sequence after position 20381692 on rice chromosome 8, namely the aforementioned long fgr20381692-F,R. The nucleotide sequence of the aroma molecular marker was amplified as shown in SEQ ID No. 1, the nucleotide sequence of the CDS region of the mutant OsBadh2 gene containing it is shown in SEQ ID No. 2, and the amino acid sequence of the encoded protein is shown in SEQ ID No. 3. Mature seeds of homozygous mutant OsBadh2 plants and wild-type materials were harvested, and the content of the aroma compound 2-AP was determined using gas chromatography-mass spectrometry. The 2-AP content of the homozygous mutant OsBadh2 plants was significantly higher than that of the original control. Figure 2 ).

[0062] SEQ ID No. 1:

[0063] TGCACCTGTCTCTCTTCCAATGGAAAACTTTAAATGCTATCTTCGGAAAGAGCCTAT CGGTGTAGTTGGGTTGATCACACCTCATCCTGCGCTTATATTTATTTATGACCCAAGCATG GTACTAAATAGTAC。

[0064] SEQ ID No. 2:

[0065]

[0066] SEQ ID No.3:

[0067] Met Ala Thr Ala Ile Pro Gln Arg Gln Leu Phe Val Ala Gly Glu Trp ArgAla Pro Ala Leu Gly Arg Arg Leu Pro Val Val Asn Pro Ala Thr Glu Ser Pro IleGly Glu Ile Pro Ala Gly Thr Ala Glu Asp Val Asp Ala Ala Val Ala Ala Ala ArgGlu Ala Leu Lys Arg Asn Arg Gly Arg Asp Trp Ala Arg Ala Pro Gly Ala Val ArgAla Lys Tyr Leu Arg Ala Ile Ala Ala Lys Ile Ile Glu Arg Lys Ser Glu Leu AlaArg Leu Glu Thr Leu Asp Cys Gly Lys Pro Leu Asp Glu Ala Ala Trp Asp Met AspAsp Val Ala Gly Cys Phe Glu Tyr Phe Ala Asp Leu Ala Glu Ser Leu Asp Lys ArgGln Asn Ala Pro Val Ser Leu Pro Met Glu Asn Phe Lys Cys Tyr Leu Arg Lys GluPro Ile Gly Val Val Gly Asn Tyr Pro Leu Leu Met Ala Thr Trp Lys Val Ala ProAla Leu Ala Ala Gly Cys Thr Ala Val Leu Lys Pro Ser Glu Leu Ala Ser Val ThrCys Leu Glu Leu Ala Asp Val Cys Lys Glu Val Gly Leu Pro Ser Gly Val Leu AsnIle Val Thr Gly Leu Gly Ser Glu Ala Gly Ala Pro Leu Ser Ser His Pro Gly ValAsp Lys Val Ala Phe Thr Gly Ser Tyr Glu Thr Gly Lys Lys Ile Met Ala Ser AlaAla Pro Met Val Lys Pro Val SerLeu Glu Leu Gly Gly Lys Ser Pro Ile Val ValPhe Asp Asp Val Asp Val Glu Lys Ala Val Glu Trp Thr Leu Phe Gly Cys Phe TrpThr Asn Gly Gln Ile Cys Ser Ala Thr Ser Arg Leu Ile Leu His Lys Lys Ile AlaLys Glu Phe Gln Glu Arg Met Val Ala Trp Ala Lys Asn Ile Lys Val Ser Asp ProLeu Glu Glu Gly Cys Arg Leu Gly Pro Val Val Ser Glu Gly Gln Tyr Glu Lys IleLys Gln Phe Val Ser Thr Ala Lys Ser Gln Gly Ala Thr Ile Leu Thr Gly Gly ValArg Pro Lys His Leu Glu Lys Gly Phe Tyr Ile Glu Pro Thr Ile Ile Thr Asp ValAsp Thr Ser Met Gln Ile Trp Arg Glu Glu Val Phe Gly Pro Val Leu Cys Val LysGlu Phe Ser Thr Glu Glu Glu Ala Ile Glu Leu Ala Asn Asp Thr His Tyr Gly LeuAla Gly Ala Val Leu Ser Gly Asp Arg Glu Arg Cys Gln Arg Leu Thr Glu Glu IleAsp Ala Gly Ile Ile Trp Val Asn Cys Ser Gln Pro Cys Phe Cys Gln Ala Pro TrpGly Gly Asn Lys Arg Ser Gly Phe Gly Arg Glu Leu Gly Glu Gly Gly Ile Asp AsnTyr Leu Ser Val Lys Gln Val Thr Glu Tyr Ala Ser Asp Glu Pro Trp Gly Trp TyrLys Ser Pro Ser Lys Leu。

[0068] 2. Linkage verification of molecular markers and aroma traits

[0069] F1 generation was obtained by crossing Zhuo B234S with Xiangzaoxian 45. F1 generation was planted and F2 generation was harvested. F2 generation was then planted in the field to obtain F2 population. KASP genotyping of F2 population was performed using molecular marker fgr20381692. KASP marker primers were designed, namely fgr20381692-KF, KH, KC.

[0070] Based on the KASP genotyping results after amplification using primers fgr20381692-KF, KR, and KC, 100 plants were randomly selected from each of the + / + and - / - genotypes (homozygous mutant and wild type, respectively). After the rice was fully mature, individual plants were harvested, threshed, and milled. The content of the aroma compound 2-AP was determined using gas chromatography-mass spectrometry (GC-MS). The 2-AP content of the grains was statistically analyzed according to the genotype as follows: Figure 3 As shown in the figure, the experiment shows that the fgr20381692 molecular marker carried by the small-particle male sterile line Zhuo 234BS is completely linked to the aroma phenotype and can be used to rapidly cultivate aroma-type small-particle male sterile lines.

[0071] Example 2:

[0072] A method for identifying whether rice contains the rice mutant OsBadh2 gene includes the following steps: using the rice genomic DNA to be tested as a template, PCR amplification is performed using PCR primers, namely fgr20381692-F and R mentioned above. If only one product of 153 bp in length is obtained, it indicates that the sample does not contain the rice mutant OsBadh2 gene; if two products of 132 bp and 153 bp in length are obtained, it indicates that the sample contains the rice mutant OsBadh2 gene and is in a heterozygous state; if only one product of 132 bp in length is obtained, it indicates that the sample contains the rice mutant OsBadh2 gene in a homozygous state. Figure 4 ).

[0073] The PCR primers used for PCR amplification are as follows:

[0074] fgr20381692-F: 5'-TGCACCTGTCTCTCTTCCAATG-3' (SEQ ID No. 7);

[0075] fgr20381692-R: 5'-GTACTATTTAGTACCATGCTTGGGTC-3' (SEQ ID No. 8).

[0076] Example 3:

[0077] The application of the fgr20381692 molecular marker obtained in Example 1 in breeding aromatic hybrid rice male-sterile lines adapted to mechanized seed production, namely, using the fgr20381692 molecular marker and grain shape characteristics to select small-grained, aromatic male-sterile lines, includes the following steps:

[0078] F1 was obtained by crossing Bing S and Zhuo B234S. F1 was planted to obtain F2 generation. The genotype of fgr20381692 marker was identified in individual plants of F2 generation using KASP primers fgr20381692-KF, FH, KC. Individual plants with fgr20381692 molecular marker were identified for agronomic traits. Superior individual plants were selected for seed selection based on seed size. Seeds with a length greater than 10 mm and a thickness less than 2 mm were retained for seed production. The above process was repeated for multiple generations until the offspring obtained genetically stable individual plants with homozygous fgr20381692 marker and seed length greater than 10 mm and thickness less than 2 mm. This resulted in a fragrant sterile line adapted to mechanized seed production, named Bingxiang S.

[0079] After the Bingxiang S and wild-type control plants were fully mature, individual plants were harvested, threshed, and milled into brown rice. The content of the aroma compound 2-AP was determined using gas chromatography-mass spectrometry. The 2-AP content in Bingxiang S seeds was significantly higher than that in the control material. Figure 5 ).

Claims

1. A molecular marker for aromatic hybrid rice, characterized in that, The nucleotide sequence of the molecular marker for the aromatic hybrid rice is shown in SEQ ID No.

2.

2. A method for identifying whether rice contains the molecular marker of aromatic hybrid rice as described in claim 1, characterized in that, The process includes the following steps: using the rice genomic DNA to be tested as a template, PCR amplification is performed. If only one product of 153 bp in length is obtained, it indicates that the sample does not contain the aromatic hybrid rice molecular marker; if two products of 132 bp and 153 bp in length are obtained, it indicates that the sample contains the aromatic hybrid rice molecular marker and is in a heterozygous state; if only one product of 132 bp in length is obtained, it indicates that the sample contains the aromatic hybrid rice molecular marker in a homozygous state. The nucleotide sequences of the PCR primers used for the PCR amplification are as follows: fgr20381692-F: 5'-TGCACCTGTCTCTCTTCCAATG-3'; fgr20381692-R: 5'-GTACTATTTAGTACCATGCTGGGTC-3'.

3. A method for identifying whether rice contains the molecular marker of aromatic hybrid rice as described in claim 1, characterized in that, The steps include: using the rice genomic DNA to be tested as a template, PCR amplification is performed using the KASP genotyping method. If only fluorescence signal 1 is obtained, the sample does not carry the molecular marker of the aromatic hybrid rice. If two signals are obtained, the sample carries the molecular marker of the aromatic hybrid rice and is in a heterozygous state; if only fluorescence signal 2 is obtained, it indicates that the sample carries the molecular marker of the aromatic hybrid rice in a homozygous state. The fluorescence signal 1 is a FAM signal, and the fluorescence signal 2 is a HEX signal; the primer nucleotide sequences used in the KASP genotyping method are as follows: fgr20381692-KF: 5'-GAAGGTGACCAAGTTCATGCTGTGTAGTTGGGTTGATCACACCTT-3'; fgr20381692-KH: 5'-GAAGGTCGGAGTCAACGGATTGTTGTAGTTGGGTTGATCACACCTC-3'; fgr20381692-KC: 5'-TGGGTCATAAATAAATATAAGCGCAGG-3'.

4. The application of the molecular marker for aromatic hybrid rice as described in claim 1 in the breeding of maternal sterile lines of aromatic hybrid rice adapted to mechanized seed production.

5. The application according to claim 4, characterized in that, The method of application includes the following steps: using a small-grained aromatic hybrid rice male-sterile line containing the aforementioned aromatic hybrid rice molecular marker as the donor parent and other male-sterile lines to be improved as the recipient parents, hybridization is carried out to obtain F1, F1 is planted to obtain F2 generation, and the individual plants of the F2 generation population are identified as carrying the aforementioned aromatic hybrid rice molecular marker. The individual plants carrying the aforementioned aromatic hybrid rice molecular marker are screened for grain size, and the seeds with qualified grain size are kept for seed production. The above process is repeated for multiple generations until the offspring obtain genetically stable individual plants with homozygous aromatic molecular marker and qualified grain size, thus obtaining the aforementioned aromatic hybrid rice maternal male-sterile line adapted to mechanized seed production.

6. The application according to claim 5, characterized in that, The donor parent is the small-grained, fragrant mutant Zhuo B234S; the sterile line to be improved is Bing S.

7. The application according to claim 5, characterized in that, Individual plants bearing the aforementioned aromatic hybrid rice molecular markers are first subjected to agronomic trait and resistance identification, and then superior individual plants are selected for seed harvesting and grain size screening; the qualified indicators for grain size are: grain length greater than 10 mm and thickness less than 2 mm.

8. A KASP genotyping primer for identifying whether rice carries the molecular marker of aromatic hybrid rice as described in claim 1, characterized in that, The nucleotide sequences of the KASP genotyping primers are as follows: fgr20381692-KF: 5'-GAAGGTGACCAAGTTCATGCTGTGTAGTTGGGTTGATCACACCTT-3'; fgr20381692-KH: 5'-GAAGGTCGGAGTCAACGGATTGTTGTAGTTGGGTTGATCACACCTC-3'; fgr20381692-KC: 5'-TGGGTCATAAATAAATATAAGCGCAGG-3'.