Use of potato strboh a gene regulatory block to control dormancy period of tubers

By constructing overexpression and interference vectors for the StrbohA gene in potatoes, the dormancy period of potato tubers was effectively regulated. Overexpression shortened the dormancy period, while interference prolonged it, solving the problem of lack of regulation in existing technologies and promoting the growth and development of potato tubers.

CN118879759BActive Publication Date: 2026-02-06NORTHWEST A & F UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410970314.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-07-19
Publication Date
2026-02-06
Estimated Expiration
2044-07-19

AI Technical Summary

Technical Problem

The lack of existing research on the role of the potato StrbohA gene in regulating tuber dormancy makes it difficult to effectively improve the regulation of potato tuber dormancy.

Method used

By constructing overexpression and interference vectors for the potato StrbohA gene, plant genetic transformation technology was used to overexpress or silence the StrbohA gene in potatoes, thereby regulating its expression and influencing the tuber dormancy period.

Benefits of technology

Overexpression of the StrbohA gene significantly shortens the dormancy period of potato tubers and promotes sprouting, while interference with StrbohA gene expression prolongs the dormancy period, providing an effective means to regulate the dormancy period of potato tubers.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118879759B_ABST
    Figure CN118879759B_ABST
Patent Text Reader

Abstract

The application provides potato StrbohA gene regulation block dormancy period. The potato StRbohA gene CDS sequence contains 2892 nucleotides. The tuber dormancy period is significantly shortened by overexpression of the StrbohA gene, and early germination, however, inhibition of StrbohA expression can prolong the tuber dormancy period, which shows that the expression of the StrbohA gene has a significant effect on the improvement of the potato tuber dormancy period, and is a functional gene in the application of potato dormancy period improvement.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the field of potato molecular breeding, and particularly relates to application of a StrbohA gene in regulating potato tuber dormancy. BACKGROUND

[0002] Potato (Solanum tuberosum L.) is the fourth largest food crop in the world after wheat, maize and rice, with a total yield of 359 million tons in 2019. China is the largest potato producer, with a yield of 18.3 million tons, accounting for about one-twentieth of the world's total (FAO statistics, 2021). The International Potato Center (CIP) has recorded 4870 materials, of which 4467 are indigenous to the Andes region. More than 4500 potato varieties are grown worldwide, in more than 160 countries. Potato has high yield, strong adaptability, balanced nutrition and excellent processing characteristics, and is mainly used for food, animal feed, industrial use and seed production. Potato has high nutritional quality, rich in carbohydrates, very low fat content of about 1%, and protein content of about 2.5%. It is also rich in vitamins C and B, and potassium.

[0003] Potato tuber dormancy refers to a physiological state that remains ungerminated in the most favorable environment for tuber germination. Potato tuber dormancy and germination play a decisive role in the entire life cycle of the tuber, such as regulating growth and development and yield. In potato tubers, dormancy only occurs in the bud eyes containing meristems, while the rest of the tubers remain in a metabolically active state. The dormancy of bud eye meristems is established during the tuber formation period. At the harvest stage, potato tubers are in a physiological dormant state. Potato tuber dormancy is controlled by complex physiological, molecular and biochemical mechanisms, in addition to its genetic background, and is influenced by multiple factors such as environment, plant hormones, growth regulators and storage conditions.

[0004] The process of potato tuber dormancy release is a process of gradually releasing dormancy in response to environmental stress, accompanied by a series of complex biological processes such as tuber water loss, storage material oxidation loss, etc. The content of hydrogen peroxide (H2O2) increases significantly during the release of potato tuber dormancy, and the use of CAT enzyme inhibitors or exogenous H2O2 treatment of tubers can shorten the dormancy period and lead to germination. Numerous studies have shown that H2O2, as a reactive oxygen species (ROS), and O2 ·-) in seed germination. Recent studies have shown that ROS involved in the regulation of seed dormancy release in Arabidopsis and barley is related to plant hormone signals. Exogenous H2O2 treatment can enhance the expression of CYP707A gene in Arabidopsis, promote the decomposition of ABA, and enhance the expression of GA synthesis genes in dormant seeds. Exogenous H2O2 treatment of barley seeds can also enhance the expression of GA synthesis genes. NADPH-mediated ROS regulates barley seed germination by participating in the metabolism and signal of GA / ABA. These studies show that ROS regulates GA / ABA hormone signals play an important role in the process of seed dormancy. Plant NADPH oxidase, also known as Respiratory Burst Oxidase Homolog (RBOH), is the main source of ROS in the process of plant response to various stresses. NADPH oxidase is involved in the regulation of plant seed germination. Studies have shown that inhibition of plant NADPH oxidase can delay the germination of pasture seeds and root growth. DPI, a specific inhibitor of NADPH oxidase, can inhibit the germination of barley seeds, while the synthesis of GA and the decomposition of ABA in the endosperm are also inhibited. OsrbohA gene in rice is the first plant NADPH oxidase gene to be cloned, and more and more rboh genes have been found in other plants such as Arabidopsis, cassava, tobacco, and tomato. AtrbohB is the main source of reactive oxygen species during seed germination in Arabidopsis, and DPI can inhibit the generation of reactive oxygen species and delay seed germination. The precursor RNA of Arabidopsis AtrbohB is regulated by hormones and development, and the ROS generated by AtrbohB is involved in the signal transduction of ABA and post-translational protein modification during seed after-ripening. In the double mutant of Arabidopsis AtrbohD and AtrbohF, the inhibitory effect of ABA on seed germination is inhibited. Eight rboh genes have been identified in the whole genome of potato, but there is no report on the involvement of rboh-mediated ROS in the process of potato tuber dormancy release. Therefore, it is of great biological and economic significance to identify the function of potato tuber dormancy-related rboh genes and clarify their effects on the dormancy period of tubers. Based on this, the applicant screened StrbohA specifically expressed during potato dormancy release by evolutionary alignment analysis combined with fluorescence quantitative analysis. There is no report on the application of StrbohA gene in regulating the dormancy period of tubers in the prior art. SUMMARY

[0005] The key technical problem to be solved by the present application is the application of StrbohA gene in regulating the dormancy period of tubers. To solve the above technical problems, the present application adopts the following technical solutions:

[0006] 1. Potato StrbohA gene, CDS sequence as shown in SEQ ID No. 1, containing 2892 bp nucleotides. The sequence used for overexpression is as shown in SEQ ID No. 1, and the sequence used for interfering StrbohA gene is as shown in SEQ ID No. 2.

[0007] 2. Construction method of potato StrbohA gene plant overexpression vector and interference vector, comprising: PCR to obtain full-length coding sequence and interference sequence in cDNA of potato cultivar Desiree, wherein the sequence used for overexpression of StrbohA is as shown in SEQ ID No. 1, the PCR primers used for construction of overexpression vector are forward primer: 5'—GGACTCTAGAGGATCCATGAGGGGTTTACCTGGGC—3' and reverse primer: 5'—GATCGGGGAAATTCGAGCTCCTAAAAATGTTCTTTGTGAAACTCG—3'; the sequence used for interfering StrbohA is as shown in SEQ ID No. 2; the PCR primers used for construction of interference vector are forward primer: 5'—GGGGACAAGTTTGTACAAAAAAGCAGGCTCTTCGCACCACCTTCTCATCATTG—3' and reverse primer: 5'—GGGGACCACTTTGTACAAGAAAGCTGGGTAGCTCGCAAGCCTCGGAAA—3'; and the above PCR products are recovered. For the overexpression vector, the recovered full-length StrbohA gene coding region fragment is recombined into pBI121 expression vector by using homologous recombinase; for the interference vector, the recovered interference fragment is recombined into pDONR TM / Zeo vector by BP reaction, and the positive clone pDONR TM / Zeo-StrbohA plasmid is recombined into pBin19pH7GWIWG2(II) expression vector by LR reaction. The connected overexpression vector and interference vector plasmid are transformed into E. coli DH5α by heat shock, and the positive clone is detected by PCR and verified by sequencing; the positive clone with correct sequencing is extracted for plasmid, and the positive clone detected by PCR is preserved for further genetic transformation.

[0008] 3. Verification method of application of potato StrbohA gene in regulating tuber dormancy period, comprising: (1) potato genetic transformation, (2) detection of transgenic positive lines, and (3) determination of dormancy period of transgenic potato.

[0009] 4. Application of potato StrbohA gene in shortening the dormancy period of potato tuber, wherein the application is achieved by overexpression of up-regulated StrbohA gene expression.

[0010] 5. The use of overexpression of potato StrbohA gene in shortening the dormancy period of potato tubers, wherein the CDS sequence of the potato StrbohA gene is shown in SEQ ID No. 1.

[0011] 6. The use of interfering with the expression of potato StrbohA gene in prolonging the dormancy period of potato tubers, wherein the CDS sequence of the potato StrbohA gene is shown in SEQ ID No. 1 and the interfering fragment is shown in SEQ ID No. 2. Beneficial effects: The expression of StrbohA is regulated in potato by using gene overexpression and RNAi technology to study whether the overexpression and silencing of StrbohA gene have an impact on the growth and development of potato and the dormancy characteristics of potato tubers after overexpression and silencing. The results show that the overexpression strain has a significant increase in plant height, leaf area and tuber yield; the interfering strain has a significant decrease in plant height and tuber yield. The overexpression and silencing of StrbohA gene have an impact on the basic processes of plant growth and development, which is suitable for breeding. Further, the applicant found that the dormancy period of the overexpression strain was significantly shortened and germinated early compared with the control, while the dormancy period of the interfering strain was prolonged, indicating that the overexpression of StrbohA gene promotes the dormancy release of tubers, while the interference prolongs the dormancy of tubers. This application shows that the control of the expression of StrbohA gene has a very significant effect on the improvement of the dormancy period of potato tubers and is a functional gene for the improvement of the dormancy period of potato. BRIEF DESCRIPTION OF DRAWINGS

[0012] Figure 1 : Schematic diagram of StrbohA gene vector construction.

[0013] Figure 2 : qPCR identification of the expression amount of StrbohA gene in transgenic strains, wherein Figure 2 a is the overexpression strain, Figure 2 b is the interfering strain; wild type (Desiree) is used as the control in the figure, T test is used for significance analysis, and the data in the figure is represented by mean ± standard error (n = 3). ns indicates that there is no significant relationship at the 0.05 level, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

[0014] Figure 3 : Tuber germination statistics of Desiree, OE-StrbohA and RNAi-StrbohA strains

[0015] Figure 4 : Tuber dormancy release process of potato StrbohA gene transgenic strains, Figure 4 a is the overexpression strain, Figure 4b is the interference strain, the scale is 1 cm.

[0016] Figure 5 StrbohA gene CDS sequence, wherein the underlined is the interference fragment. Specific implementation method

[0017] The methods and devices used in the following examples of the present patent are all conventional methods and devices unless otherwise specified; the equipment and reagents used are all conventional equipment and reagents purchased from reagent companies. In order to make the purpose, technical scheme and advantages of the present patent more clear, the specific implementation of the present patent will be described in detail below combined with specific examples. The examples of these preferred implementation modes are exemplified in the specific examples. Here, it also needs to be explained that, in order to avoid the technical scheme of the present patent being obscured by unnecessary details, only the technical scheme and / or processing steps closely related to the scheme according to the present patent are shown in the examples, and other details not closely related are omitted.

[0018] Example 1

[0019] This example provides potato StrbohA gene, including:

[0020] The potato StrbohA gene, the CDS sequence is shown in the sequence table SEQ ID No. 1, containing 2892bp nucleotides, the StrbohA gene in the potato database ID number is Soltu.DM.08G028440.1. The sequence used for interfering StrbohA is shown in the sequence table SEQ ID No. 2.

[0021] Example 2

[0022] This example provides a method for constructing a plant overexpression and interference vector of potato StrbohA gene, including:

[0023] The applicant amplifies the full-length coding sequence and interference sequence from the cDNA of potato cultivar (Solanum tuberosum, referred to as St) Desiree by PCR, wherein the PCR primers used for constructing the overexpression vector are forward primer: 5'-GGACTCTAGAGGATCCATGAGGGGTTTACCTGGGC-3'; reverse primer: 5'-GATCGGGGAAATTCGAGCTCCTAAAAATGTTCTTTGTGAAACTCG-3'; the sequence used for overexpressing StrbohA is shown in the sequence table SEQ ID NO: 1. The PCR primers used for constructing the interference vector are forward primer: 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTCTTCGCACCACCTTCTCATCATTG-3'; reverse primer: 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTAGCTCGCAAGCCTCGGAAA-3'; the sequence used for interfering StrbohA is shown in the sequence table SEQ ID NO: 2. The above PCR products are recovered. For the overexpression vector, the gel-recovered full-length StrbohA gene coding region fragment is connected to the pBI121 expression vector by homologous recombination reaction (5x buffer 2.0 μL, target fragment 1.0 μL, plasmid 1.0 μL, homologous recombination enzyme 1.0 μL, ddH2O 5 μL, 37°C reaction for 30 min); for the interference vector, the gel-recovered product is recombined into the pDONR TM / Zeo plasmid 1.0 μL, BP enzyme 1.0 μL, TE buffer 1.0 μL, 25°C recombination for 16 h, add 0.5 μL protease K, 37°C reaction for 10 min) to the pDONR TM / Zeo vector, and the positive clone pDONR TM / Zeo-StrbohA) plasmid is recombined into the pBin19pH7GWIWG2(II) expression vector by LR reaction (gateway vector 1.0 μL, pBin19pH7GWIWG2(II) 1.0 μL, LR enzyme 0.5 μL, TE buffer 1.0 μl, 25°C recombination for 16 h, add 0.3 μL protease K, 37°C reaction for 10 min). The connected overexpression vector and interference vector plasmid are transformed into E. coli DH5α by heat shock, and the positive clone is detected by PCR and verified by sequencing; the positive clone with correct sequencing is extracted into plasmid, and the agrobacterium GV3101 is transformed by electroporation, and the positive clone detected by PCR is preserved for further genetic transformation.

[0024] Example 3

[0025] The present embodiment provides the application of potato StrbohA gene in regulating the dormancy period of tubers, including:

[0026] 1. Potato genetic transformation

[0027] The StrbohA gene overexpression and interference vector-containing Agrobacterium GV3101 was streaked on LB solid medium plate and cultured in an inverted incubator at 28°C for two days, and a single colony was inoculated in 5 mL of LB liquid medium containing Kan and Rif, and cultured at 28°C, 200 rpm overnight. In the clean bench, 1 mL of overnight cultured bacteria was taken and added to 15 mL of LB liquid medium (containing only Kan) and cultured at 28°C, 200 rpm for 6-8 h. Centrifuge at room temperature 4000 rpm for 5 min, resuspend the bacterial body with MS liquid to OD600 of 0.5-0.8. Four-pole Desiree was selected as the genetic transformation material, and the tissue culture seedlings grown on MS solid medium for 3-4 weeks were selected, the head and tail of the leaf were cut off with a sterile scalpel, and the leaf was cut 3-4 times perpendicular to the vein (not through), and immediately placed in a culture dish containing 10 mL of MS liquid medium, about 15-20 leaves per dish, and 80 μL of Agrobacterium bacteria resuspended in MS liquid medium was added, shaken gently, sealed with parafilm, and cultured in the dark at 22°C for 2 days. After two days, the residual liquid on the leaf was absorbed with sterile filter paper, and transferred to callus induction medium. Press gently to make the wound fully contact with the medium. Culture in a 22°C light incubator for 10 days. After 10 days, transfer to bud induction medium, replace bud induction medium every 7 days. Continue to culture until the callus grows 1-2 cm buds, and the regenerated buds are inoculated into rooting screening medium containing Kan, and the rooted test tube seedlings are selected to extract DNA, and primers are designed according to the 35S sequence and gene fragment of the vector, and PCR is used to detect transgenic positive plants. The transgenic medium is shown in Table 1.

[0028] Table 1 Potato transgenic medium

[0029]

[0030] 2. Detection of transgenic positive lines

[0031] Cut 1-2 leaves of the plantlets to be tested in a clean bench. Put the sample into a mortar and add 950 μL of DNA extraction solution (400 μL of Extaction Buffer (0.35 M Sorbitol, 100 mM Tris, pH 7.5, 5 mM EDTA), 500 μL of Nuclei Lysis Buffer (200 mM Tris-HCl, 50 mM EDTA, 2 M NaCl, 2% CTAB), 50 μL of Sarkosyl), and transfer into a 2 mL centrifuge tube after grinding. After vortexing, place in a water bath at 65°C for 30 min. Add 800 μL of chloroform:isopropyl alcohol (24:1), mix well, and centrifuge at 8000 rpm for 4 min at room temperature. Take the supernatant into a 2 mL centrifuge tube, add 800 μL of isopropyl alcohol, mix well, and centrifuge at 8000 rpm for 1 min at room temperature. Add 250 μL of 75% ethanol, centrifuge at 8000 rpm for 1 min, and repeat this step twice. Blow in a clean bench until the 75% ethanol evaporates completely. Add 50 μL of ddH2O to dissolve the DNA, and store at -20°C for later use. Use the extracted overexpression and interference plant DNA as a template for PCR transgenic strain detection. The overexpression plant detection primer is p35S rbohA-F: 5'-AAGAATGCTAACCCACAG-3', and the reverse primer is the gene primer rbohA-R: 5'-TAGGGGGACCAGAGTAACCG-3'. Perform PCR amplification and electrophoresis detection to obtain 10 positive transgenic plants. The interference plant detection primer is RI rbohA-F: 5'-CCCTTATCTGGGAACTAC-3', and the reverse primer is the gene primer RI rbohA-R: 5'-TTGTCGGATATGAATGCT-3'. Perform PCR amplification and electrophoresis detection to obtain 11 positive transgenic plants. Perform PCR amplification and electrophoresis detection to obtain 11 transgenic plants. Use the Tian Gen plant total RNA extraction kit to extract the total RNA of the potato plants. After reverse transcription into cDNA, use Ubi3 as the internal reference gene, and use the fluorescent quantitative PCR technique to detect the expression amount of the StrbohA gene in the overexpression and interference expression strains. The results show that, compared with the control, the expression amount of the StrbohA gene in the overexpression strains OE-StrbohA-6, OE-StrbohA-7, OE-StrbohA-9, and OE-StrbohA-17 is significantly increased, while the expression amount of the StRbohA gene in the interference strains RNAi-32, RNAi-41, RNAi-42, RNAi-50, and RNAi-55 is significantly reduced. Finally, two overexpression strains OE-7 and OE-17 with extremely significantly increased expression amounts and two interference strains RNAi-41 and RNAi-55 with extremely significantly reduced expression amounts are selected for further evaluation of the dormant period Figure 2).

[0032] 3. Dormancy period identification of transgenic potato tubers

[0033] StrbohA transgenic function identification Applicant will select the StrbohA overexpression, interference strain and control Desiree tissue culture seedlings with good and consistent growth, 20-30 plants per strain, planted in small flowerpots with vermiculite, cultured in a light incubator with a temperature of 22±1℃, light for 14h / dark for 10h, light intensity of 10000Lx, humidity of 65%. Observe the growth state of the plants, water regularly, spray pesticides, prevent drought and disease and insect pests. After 2-3 months of growth, transplant to large flowerpots containing vermiculite and nutrient soil (3:1), and carry out open-air culture, continue to culture for 3 months. According to the daily weather conditions, cover the sunshade net and rain cloth, and the light is natural light. Water every 3 days, and fertilize every 10 days and spray pesticides in time. After 180 days of planting, the phenotype data of the plants are counted, and the plant height, stem diameter, leaf area, internode length, top leaf shape, top leaf width, root length, aboveground fresh weight, underground fresh weight, aboveground dry weight, underground dry weight, single plant tuber number, and single plant tuber yield are measured. 8-14 plants per strain are selected for measurement. With Desiree as the control, the germination rate of the overexpression and interference strain tubers is counted, and when the tuber grows at least one bud ≥2mm is considered to germinate, and when the number of germinated tubers accounts for 80% of the total number of tubers is considered to be the end of dormancy. The test results prove that compared with the control, the dormancy period of the overexpression strain OE-StrbohA is significantly shortened and germinates early, while the dormancy period of the RNAi-StrbohA interference strain is prolonged. The tubers of the overexpression strain, wild type and interference strain start to germinate on the 50th, 55th and 58th days respectively. On the 77th day, the control and overexpression strain tubers have all ended dormancy, and the germination rates are 67%, 80% and 92% respectively. Figure 3 ) On the 85th day, all tubers have germinated but the bud growth rate is slow. On the 90th day, the bud growth rate of the OE-StrbohA tubers is significantly faster than that of the control, while there is no significant difference in the bud growth rate of the wild type tubers and the interference strain tubers Figure 4 ). The results show that overexpression of the StrbohA gene promotes tuber dormancy and bud growth, and inhibition of StrbohA gene expression prolongs the dormancy period. StrbohA is a functional gene for regulating potato tuber dormancy.

[0034] The above is merely a specific implementation of the present application, and it should be noted that for ordinary skilled persons in the technical field, several improvements and refinements can be made without departing from the principles of the present application, and these improvements and refinements should also be considered within the protection scope of the present application.

Claims

1. Use of overexpression of the potato StrbohA gene for shortening the dormancy period of potato tubers, characterized in that The potato StrbohA gene CDS sequence is shown in the sequence table SEQ ID No.

1. The potato StrbohA gene CDS sequence is shown in the sequence table SEQ ID No. 1.