A method for constructing a prokaryotic single-cell RNA sequencing library
By using the combination technology of PolyA polymerase and shielding primers in prokaryotic single-cell RNA sequencing, the problem of rRNA removal in prokaryotic RNA sequencing is solved, and efficient and low-cost single-cell RNA sequencing library construction is achieved, improving the efficiency and accuracy of sequencing.
Patent Information
- Application Number
- CN202411355884.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-27
- Publication Date
- 2025-06-06
- Estimated Expiration
- 2044-09-27
AI Technical Summary
The existing single-cell RNA sequencing technology is mainly aimed at eukaryotes, and has technical challenges to the application of prokaryotes, especially in terms of removing rRNA, improving specificity and reducing experimental complexity and cost.
A low-cost and simple method for constructing a single-cell RNA sequencing library of prokaryotic organisms is proposed. By adding polyA sequence to the 3' end of the RNA fragment by PolyA polymerase, and using specific shielding primers to block the 3' end of the rRNA, to achieve effective removal of rRNA.
This method effectively removes rRNA interference, simplifies experimental steps, reduces costs, and improves the efficiency and accuracy of single-cell RNA sequencing of prokaryotic organisms.
Smart Images

Figure CN118879832B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of gene sequencing, and in particular, relates to a method for constructing an RNA sequencing library for a prokaryotic single cell. Background Art
[0002] With the continuous advancement of gene sequencing technology, RNA sequencing has become an important tool in biological and medical research. In particular, the development of single-cell RNA sequencing technology has greatly improved the details and depth of research, allowing researchers to obtain expression patterns at the level of single cells. However, existing single-cell RNA sequencing technology is mainly targeted at eukaryotes, and its application to prokaryotes still faces technical challenges.
[0003] Gene expression heterogeneity exhibited by prokaryotes under different conditions, such as antibiotic resistance, is often confined to very few cells, and population-level gene expression measurements cannot reveal these important biological phenomena. Although methods such as SPLiT-seq, PETRI-seq, BacDrop, and m3-seq provide certain solutions for prokaryotic single-cell transcriptomics, these methods still need to be improved in terms of removing rRNA, improving specificity, and reducing experimental complexity and cost. Summary of the invention
[0004] In view of the shortcomings of the prior art, the present invention proposes an efficient and low-cost method for constructing a prokaryotic single-cell RNA sequencing library. The method effectively removes rRNA through specific technical means, simplifies the experimental steps, reduces costs, and improves the efficiency and accuracy of prokaryotic single-cell RNA sequencing.
[0005] In order to achieve the above object, the present invention provides a low-cost and convenient method for constructing a prokaryotic single-cell RNA sequencing library, the process is as follows Figure 1 As shown, the following steps are included:
[0006] (1) Cell treatment: Fix prokaryotic cells and permeabilize the cell membrane.
[0007] According to a preferred embodiment, the number of fixed prokaryotic cells is 1-10 20 More preferably, 10 5 -10 9 The most preferred number is 10 million.
[0008] Fixation and permeabilization are preferably performed at low temperatures of 1-4°C with the addition of RNase inhibitors.
[0009] (2) PolyA addition and rRNA shielding: The polyA sequence is added to the 3' end of the RNA fragment by using Poly A polymerase, and the rRNA end is specifically blocked from being added with the polyA sequence by using a shielding primer; by using the characteristic that poly A polymerase only performs ATP incorporation into the 3' end of single-stranded RNA, rRNA and other RNA are distinguished by using a blocking primer; the sequence of the shielding primer is shown in SEQ ID No. 1~13.
[0010] The shielded primers include basic shielded primers, hotspot shielded primers and human tissue cell shielded primers.
[0011] Basic Shielding Primer:
[0012] Targeting 5S rRNA:
[0013] 5'-ATGCCTGGCAGTTCCCTACTCTCGCATGGG-3' (SEQ ID No. 1)
[0014] Targeting 16S rRNA:
[0015] 5'-TAAGGAGGTGATCCAACCGCAGGTTCCCCT-3' (SEQ ID No. 2)
[0016] Targeting 23S rRNA:
[0017] 5'-AAGGTTAAGCCTCACGGTTCATTAGTACCG-3' (SEQ ID No. 3)
[0018] Hotspot shielding primers: SEQ ID No. 4 to 9 describe in detail shielding primers targeting the hotspot regions of 16S rRNA and 23S rRNA.
[0019] For 16S hotspot 107:
[0020] 5'-GGCACATCCGATGGCAAGAGGCCCGAAGGT-3' (SEQ ID No. 4)
[0021] For 16S hotspot 682:
[0022] 5'-TCCTGTTTGCTCCCCACGCTTTCGCACCTG-3' (SEQ ID No. 5)
[0023] For 16S hotspot 1241:
[0024] 5'-CCGTGGCATTCTGATCCACGATTACTAGCGATTCCG-3' (SEQ ID No. 6)
[0025] For 23S hotspot 375:
[0026] 5'-CGCCTTTCCCTCACGGTACTGGTTCACTATCGG-3' (SEQ ID No. 7)
[0027] For 23S hotspot 1421:
[0028] 5'-TTGCTTCAGCACCGTAGTGCCTCGTCATCA-3' (SEQ ID No. 8)
[0029] For 23S hotspot 1641:
[0030] 5'-GCAGCCAGCTGGTATCTTCGACTGATTTCAGC-3' (SEQ ID No. 9)
[0031] Human tissue cell shielded primers: shielded primers used for single-cell RNA sequencing of human tissue cells and bacteria simultaneously, as shown in SEQ ID No.10 to 13.
[0032] 18SrRNA shielding primer
[0033] 5'-TAATGATCCTTCCGCAGGTTCACCTACGGA-3' (SEQ ID No. 10)
[0034] 18S rRNA hotspot shielding primers
[0035] 5'-CACTAAGCCATTCAATCGGTAGTAGCGACG-3' (SEQ ID No. 11)
[0036] 28S rRNA shielding primer
[0037] 5'-GACAAACCCTTGTGTCGAGGGCTGACTTTCAATAG-3' (SEQ ID No. 12)
[0038] 5.8S rRNA shielding primer
[0039] 5'-AAGCGACGTCAGACAGGCGTAGCCCCGGG-3' (SEQ ID No. 13)
[0040] In step (2), the Poly A polymerase and the shielding primer are preferably added simultaneously, and the final concentration of the shielding primer is 1-100 μM, preferably 40-60 μM, and most preferably 50 μM.
[0041] (3) Reverse transcription and first round of label addition: The RNA sequence with polyA added is reverse transcribed using a nucleotide sequence with a specific label to obtain a cDNA sequence; the nucleotide sequence with the specific label is shown in SEQ ID No. 14: 5'- / 5Phos / GCCAGABBBBBBBNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTV-3' (SEQ ID No. 14).
[0042] The 6 Ns represent randomly combined UMI tags, the 7 Bs represent barcode tags composed of ATCG bases (each well corresponds to a 7-base barcode tag sequence), V represents bases C, G or A, and GCCAGA is a universal sequence used to complement the adapter during the second round of tag connection.
[0043] (4) Second round of tag addition: Through a ligation reaction, the second round tag sequence is added to the cDNA sequence obtained in the first round using a complementary ligation adapter sequence to further increase the number of cell UMIs; the complementary ligation adapter sequence is shown in SEQ ID No. 15, and the second round tag sequence is shown in SEQ ID No. 16.
[0044] Complementary ligation linker sequence: 5'-TCTGGCGTAGGAGGTCGTC-3' (SEQ ID No. 15)
[0045] The 5' end TCTGGC is reverse complementary to the GCCAGA at the 5' end of the reverse transcription primer, the GTAGGAGG part is reverse complementary to the 3' end of the second round label sequence, and the last 4 bases are not complementary to the second round label sequence.
[0046] Second round tag sequence: 5'-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTBBBBBBBTCGCCCTCCTAC-3' (SEQ ID No. 16)
[0047] The GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT part is the sequencing adapter sequence of Illumina, which can be replaced with the adapter sequence of other sequencing platforms as needed. The 7 Bs are the barcode tags composed of ATCG bases.
[0048] According to the present invention, the second round tag sequence and the complementary linker sequence need to be annealed at low temperature before being added to the system. The design of the complementary linker sequence (SEQ ID No. 15) and the second round tag sequence (SEQ ID No. 16) ensures the smooth progress of the low temperature annealing process and avoids unnecessary reverse complementation problems caused by subsequent extension.
[0049] According to the method of the present invention, in step (4), an additional round of labeling can be added according to the number of cells to optimize sequencing efficiency and accuracy.
[0050] (5) Amplification and third round of label addition: Use random primers with labels to generate the second chain of the cDNA sequence obtained in step (4) and add the third round of labels.
[0051] According to a preferred embodiment, the random primer + third round tag sequence designed in this step is as follows: 5'-TACACTCTTTCCCTACACGACGCTCTTCCGATCTBBBBBBBGGTCCTTGNNNNNN-3' (SEQ ID No. 17).
[0052] BBBBBBB is the barcode tag sequence, NNNNNN is a random primer, and TACACTCTTTCCCTACACGACGCTCTTCCGATCT is the other side sequencing adapter sequence of Illumina, which can be replaced with the adapter sequence of other sequencing platforms as needed.
[0053] The barcode tag sequence of the present invention can be selected from the following sequences:
[0054]
[0055] (6) Library construction and amplification: After the product obtained in step (5) is purified, it is amplified using universal sequencing primers to construct a library suitable for sequencing.
[0056] According to one embodiment of the present invention, the purification treatment in step (6) uses Ampure XP magnetic beads to remove fragments below 100 bp and primer adapter sequences.
[0057] According to one embodiment of the present invention, the universal sequencing primer in step (6) is an Illumina sequencing double-end adapter primer.
[0058] According to the method of the present invention, the reactions of steps (3) to (5) are all carried out in a multi-well plate, and the corresponding next step is to mix the wells of the sub-packaging first, and then to carry out the next step reaction in the multi-well plate. For example, the reverse transcription of step (3) is carried out in a multi-well plate (such as a 96-well plate or a 384-well plate), step (4) first mixes the wells of the sub-packaging, treats the cell fluid, and then distributes the multi-well plate again for the second round of label addition, step (5) also first collects the cells into a tube, treats the cell fluid, and then distributes the multi-well plate for the second chain synthesis and the third round of label addition, and step (6) also first mixes the reactants, and then purifies and amplifies them to build a library.
[0059] The method of the present invention is applicable to all prokaryotes, such as fecal intestinal flora or other cultured prokaryotic strains. The fecal intestinal flora includes but is not limited to Escherichia coli, Bifidobacterium, Lactobacillus, Salmonella, etc.
[0060] Through the above steps, the present invention realizes a simple and efficient method for constructing a prokaryotic single-cell RNA sequencing library, providing strong technical support for the single-cell expression research of prokaryotes.
[0061] The method of the present invention utilizes the characteristic that PolyA polymerase specifically adds a polyA sequence to the 3' end of single-stranded RNA, and specifically blocks the 3' end of rRNA through a designed blocking primer, thereby effectively removing the interference of rRNA. The key to the method is that through a few specific blocking primers, it is possible to effectively bind and block the rRNA of almost all prokaryotes, which greatly simplifies the experimental steps and reduces the cost. In addition, the present invention can also achieve simultaneous sequencing of prokaryotic and eukaryotic single-cell RNA by designing blocking primers for human and other eukaryotic rRNA.
[0062] The present invention utilizes the characteristic of selectively adding polyA of PolyA polymerase, and does not require a separate rRNA removal step. Simply by using a few shielding primers, most of the rRNA in the single-cell prokaryotic RNA sequencing library can be removed and the polyA addition of prokaryotic mRNA can be completed. The present invention uses VTN primers for selective reverse transcription combined with random primers to achieve low-cost, simple steps to complete the construction of a single-cell library. In addition, by changing the shielding primer sequence, it can also be expanded to simultaneously build single-cell RNA libraries for prokaryotes and eukaryotes.
[0063] Other features and advantages of the present invention will be described in detail in the following detailed description. BRIEF DESCRIPTION OF THE DRAWINGS
[0064] The above and other objects, features and advantages of the present invention will become more apparent through a more detailed description of exemplary embodiments of the present invention with reference to the accompanying drawings.
[0065] Figure 1 The figure is a schematic diagram of a process for constructing a prokaryotic single-cell RNA sequencing library in an embodiment of the present invention.
[0066] 1. Cell treatment, 2. PolyA addition and rRNA shielding, 3. Reverse transcription and first round of label addition, 4. Mixing and aliquoting to add the second round of labels, 5. Amplification and third round of label addition and amplification library construction.
[0067] Figure 2 The distribution of UMIs in the double bacteria mixed experiment in Example 1 of the present invention is shown. 3,801 Acinetobacter baumannii (accounting for 58.11%) and 2,728 Escherichia coli (accounting for 41.71%) were detected, and the double rate was 0.19%. DETAILED DESCRIPTION
[0068] The preferred embodiments of the present invention will be described in more detail below. Although the preferred embodiments of the present invention are described below, it should be understood that the present invention can be implemented in various forms and should not be limited to the embodiments set forth herein.
[0069] 1. Cell fixation and permeabilization
[0070] The mixed bacterial solution of Acinetobacter baumannii and Escherichia coli was cultured until the cell concentration was 10 6 -10 7 cells / mL. The bacterial solution was centrifuged at 4°C, 5000 rcf for 5 minutes. After centrifugation, the bacterial pellet was resuspended in 1 mL of fresh, cold 4% formaldehyde solution (1×PBS) and incubated overnight at 4°C. The next morning, impurities were filtered out using a 40μm cell filter membrane, the cells were centrifuged and resuspended in 1 mL of cold 100mM Tris-HCl+RI ("RI" indicates RNase inhibitor, added to a final concentration of 0.1 U / μL). The cells were centrifuged at 3910×g for 5 minutes and resuspended in 250μL of 0.04% Tween-20 in 1×PBS and permeabilized on ice for 3 minutes. Then add 1 mL of cold PBS + RI, centrifuge the cells and resuspend each sample in 200 μL of lysozyme mixture on ice, which is composed of the following: 0.1M Tris-HCL pH7, 0.05M EDTA, 2.5mg / mL lysozyme, 0.25U / mL RNase inhibitor. Incubate the samples at 37°C for 15 minutes. Immediately after the cell wall digestion step, add 1 mL of cold PBS + RI, centrifuge the cells and count the cells using a flow cytometer.
[0071] 2. PolyA addition and rRNA shielding
[0072] To enrich for mRNA capture, in situ polyadenylation was performed using E. coli Poly(A) polymerase I (PAP). Reactions were performed in 50 μL volumes for 0.25M cell samples and 100 μL volumes for 0.6M cell samples. For each 0.6M cell bacterial pellet, 50 μL of water, 16 μL of blocking primer mix (final mix was 50 μM), 4 μL of SUPERase-In, 10 μL of 10× PAP buffer, 10 μL of 10mM ATP, and 10 μL of PAP were added. The reaction mixture was incubated at 37°C for 30 minutes, and then 1 mL of cold PBS+RI+1 μL of 10% Tween-20 was added to make the cells easier to pellet and centrifuged at 3910×g. The cells were then resuspended in 0.5 mL of cold PBS+RI.
[0073] 3. Reverse transcription and first round of tag addition
[0074] Round 1 plate barcoding and sample multiplexing were achieved via RT reactions in 384-well or 96-well plates. 384 V17N RT primers containing the UMI sequence and round 1 plate barcode (CB1) were synthesized at 100 μM. Primers were diluted to a working concentration of 10 μM with dd water and 2 μL of each primer was aliquoted into individual wells of a 384-well or 96-well plate. The RT reaction mixture was prepared using 240 μL 5× RT buffer, 24 μL dNTPs (N0447L, NEB, Ipswich, MA), 12 μL SUPERase In RNase inhibitor, and 24 μL Maxima H Minus reverse transcriptase. 3×10 7 10 cells were added to the mixture. Water was added to bring the volume of the reaction mixture to 960 μL. 8 μL of the reaction mixture was added to each well of the 96-well plate containing the RT primers, making the final volume in each well 10 μL. The plate was sealed and incubated using the following program: 50°C for 10 minutes, 8°C for 12 seconds, 15°C for 45 seconds, 20°C for 45 seconds, 30°C for 30 seconds, 42°C for 6 minutes, 50°C for 16 minutes, and 4°C hold.
[0075] 4. Mix and pack to add second round of labels
[0076] After RT, pool 96 reactions into one tube. At this point, add 5% Tween-20 to a final concentration of 0.04% in the cell mixture. If the total cell mixture is 830 μL after mixing, add 6.6 μL of 5% Tween-20. Then incubate the cells on ice for 3 minutes, then add PBS to a final concentration of 0.01% Tween-20 (i.e., add 2508 μL to 836 μL of sample, and divide the sample into multiple Eppendorf tubes and centrifuge). Then centrifuge the cells at 10,000 × g for 20 minutes at 4°C and remove the supernatant.
[0077] For the second round of ligation, first prepare the complementary ligation adapter oligonucleotides and the second round tag oligonucleotides for annealing. The second round tag oligonucleotides are diluted to 100 μM. The complementary ligation adapter oligonucleotides are diluted to 100 μM. After mixing, heat to 95℃ for 3 minutes, and then reduce the temperature to 20℃ at a rate of -0.1℃ / sec to anneal the oligonucleotides.
[0078] Resuspend the cells in 600 μL 1× T4 Ligase Buffer. Add the following additional reagents to prepare a master mix: 24.2 μL water, 37.5 μL 10× T4 Ligase Buffer, 5.6 μL BSA, and 27.9 μL T4 Ligase, making a final mixture volume of 695.2 μL. Add 5.76 μL of this mixture to each well of a 96-well plate containing 2.24 μL annealed 2nd round ligation oligonucleotides, for a final volume of 8 μL. Ligation was performed at 37°C for 30 minutes. The cells were then pooled into one tube.
[0079] 5. Second chain synthesis and third round of label addition
[0080] Add Tween-20 to a final concentration of 0.01% and count the cells. Keep no more than 100,000 cells, then centrifuge the cells at 7,000 × g for 10 minutes at 4°C. Carefully aspirate the supernatant, leaving about 30 μL to avoid removing the precipitate. Then add 1794 μL of PCR mix, divide them equally into 96-well plates, and add 1 μL of random primers with amplification sequence indexes respectively. Then 98°C for 1 minute, slowly decrease to 25°C (0.5°C / second), and incubate at 25°C for 30 minutes.
[0081] 6. Amplification and library construction
[0082] Then, the reactants were mixed and purified using Ampure XP magnetic beads to remove fragments below 100 bp and primer adapter sequences, and the purified products were eluted in a volume of 50 μL. 2 μL of illumina sequencing double-end adapter primers and 148 μL of PCR mix were added, and the mixture was incubated at 98°C for 30 seconds, and the following temperature was set for 30 cycles: 98°C for 10 seconds, 65°C for 20 seconds, 72°C for 30 seconds, and finally 72°C for 1 minute and then stored at 10°C.
[0083] 7. Quantitative sequencing
[0084] Ampure XP magnetic beads were used for purification, and fragments larger than 150 bp were recovered and quantified.
[0085] Illumina Novaseq6000 was used for 2×150bp sequencing, double-end index, and sequencing volume of 20G.
[0086] The single-cell capture efficiency of this method for a double-bacteria mixed bacterial solution was 18%. The rRNA ratio was 13%, the median number of genes detected in a single cell was 200-550, 3,801 Acinetobacter baumannii (58.11%) and 2,728 Escherichia coli (41.71%) were detected, and the double cell rate was 0.19%. For specific UMIs distribution, see Figure 2 .
[0087] 1. Cell fixation and permeabilization:
[0088] Take 1g of solid feces, add 1mL of fresh, cold 4% formaldehyde solution (1×PBS), and incubate overnight at 4°C. The next morning, filter out impurities using a 40μm cell filter, centrifuge the cells and resuspend them in 1mL of cold 100mM Tris-HCL+RI ("RI" indicates RNase inhibitor, added to a final concentration of 0.1 U / μL). Centrifuge the cells at 3910×g for 5 minutes and resuspend them in 250μL of 0.04% Tween-20 in 1×PBS and permeabilize them on ice for 3 minutes. Then add 1mL of cold PBS+RI, centrifuge the cells and resuspend each sample in 200 μL of lysozyme mixture on ice, the lysozyme mixture composition is as follows: 0.1MTris-HCL pH7, 0.05M EDTA, 2.5mg / mL lysozyme, 0.25U / mL RNase inhibitor. Incubate the samples at 37°C for 15 minutes. After the cell wall digestion step, immediately add 1 mL of cold PBS+RI, centrifuge the cells and count the cells using a flow cytometer.
[0089] 2. PolyA addition and rRNA shielding
[0090] To enrich for mRNA capture, in situ polyadenylation was performed using E. coli Poly(A) polymerase I (PAP). Reactions were performed in 50 μL volumes for 0.25M cell samples and 100 μL volumes for 0.6M cell samples. For each 0.6M cell bacterial pellet, 50 μL of water, 16 μL of blocking primer mix (final mix was 50 μM), 4 μL of SUPERase-In, 10 μL of 10× PAP buffer, 10 μL of 10 mM ATP, and 10 μL of PAP were added. The reaction mixture was incubated at 37°C for 30 minutes, and then 1 mL of cold PBS+RI+1 μL of 10% Tween-20 was added to make the cells easier to pellet and centrifuged at 3910×g. The cells were then resuspended in 0.5 mL of cold PBS+RI.
[0091] 3. Reverse transcription and first round of tag addition
[0092] Round 1 plate barcoding and sample multiplexing were achieved via RT reactions in 384-well or 96-well plates. 384 V17N RT primers containing the UMI sequence and round 1 plate barcode (CB1) were synthesized at 100 μM. Primers were diluted to a working concentration of 10 μM with dd water, and 2 μL of each primer was aliquoted into individual wells of a 384-well or 96-well plate. The RT reaction mixture was prepared using 240 μL 5× RT buffer, 24 μL dNTPs (N0447L, NEB, Ipswich, MA), 12 μL SUPERase In RNase inhibitor, and 24 μL Maxima H Minus reverse transcriptase. 3×10 7 10 cells were added to the mixture. Water was added to bring the volume of the reaction mixture to 960 μL. 8 μL of the reaction mixture was added to each well of the 96-well plate containing the RT primers, making the final volume in each well 10 μL. The plate was sealed and incubated using the following program: 50°C for 10 minutes, 8°C for 12 seconds, 15°C for 45 seconds, 20°C for 45 seconds, 30°C for 30 seconds, 42°C for 6 minutes, 50°C for 16 minutes, and 4°C hold.
[0093] 4. Mix and pack to add second round of labels
[0094] After RT, pool 96 reactions into one tube. At this point, add 5% Tween-20 to a final concentration of 0.04% in the cell mixture. If the total cell mixture is 830 μL after mixing, add 6.6 μL of 5% Tween-20. Then incubate the cells on ice for 3 minutes, then add PBS to a final concentration of 0.01% Tween-20 (i.e., add 2508 μL to the 836 μL sample, and divide the sample into multiple Eppendorf tubes for centrifugation). Then centrifuge the cells at 10,000 × g for 20 minutes at 4°C. Remove the supernatant.
[0095] For the second round of ligation, first prepare the annealing of the ligation oligonucleotide and the second round tag oligonucleotide. The second round tag oligonucleotide is diluted to 100 μM. The ligation oligonucleotide is diluted to 100 μM. After mixing, heat to 95℃ for 3 minutes, and then reduce the temperature to 20℃ at a rate of -0.1℃ / second to anneal the oligonucleotides.
[0096] Resuspend the cells in 600 μL 1× T4 Ligase Buffer. Add the following additional reagents to prepare a master mix: 24.2 μL water, 37.5 μL 10× T4 Ligase Buffer, 5.6 μL BSA, and 27.9 μL T4 Ligase, making a final mixture volume of 695.2 μL. Add 5.76 μL of this mixture to each well of a 96-well plate containing 2.24 μL annealed 2nd round ligation oligonucleotides, for a final volume of 8 μL. Ligation was performed at 37°C for 30 minutes. The cells were then pooled into one tube.
[0097] 5. Second chain synthesis and third round of label addition
[0098] Add Tween-20 to a final concentration of 0.01% and count the cells. Keep no more than 100,000 cells, then centrifuge the cells at 7,000 × g for 10 minutes at 4°C. Carefully aspirate the supernatant, leaving about 30 μL to avoid removing the precipitate. Then add 1794 μL of PCR mix, divide them equally into 96-well plates, and add 1 μL of random primers with amplification sequence indexes respectively. Then 98°C for 1 minute, slowly decrease to 25°C (0.5°C / second), and incubate at 25°C for 30 minutes.
[0099] 6. Amplification and library construction
[0100] Afterwards, the reaction mixture was mixed and purified using Ampure XP magnetic beads to remove fragments below 100 bp and primer adapter sequences, and the purified product was eluted in a volume of 50 μL. 2 μL of illumina sequencing double-end adapter primers and 148 μL of PCR mix were added, and the mixture was incubated at 98°C for 30 seconds, and the following temperature was set for 30 cycles: 98°C for 10 seconds, 65°C for 20 seconds, 72°C for 30 seconds, and finally 72°C for 1 minute and then stored at 10°C.
[0101] 7. Quantitative sequencing
[0102] Ampure XP magnetic beads were used to purify and recover fragments larger than 150 bp and quantify them.
[0103] Illumina Novaseq6000 was used for 2×150bp sequencing with double-end index.
[0104] The capture efficiency of single cells using this method is 10%~20%. The rRNA ratio is between 10%~30%, and the median number of genes detected in a single cell is between 200~550. Because the rRNA ratio is lower than other existing methods and the sequencing is performed on the 3' end of the RNA, only one sequence is measured for each RNA, which greatly reduces the sequencing data requirements.
[0105] According to the present invention, single-cell RNA detection can be performed on samples of complex prokaryotes, and then the differences in prokaryotic gene expression changes under different species, different environmental conditions, different host sources and treatment conditions can be compared.
[0106] The present invention has application potential in the study of the etiology, prevention, diagnosis, and mechanism of microbial functions, pathogen infection, tumor microenvironment, and various microbial-related diseases.
[0107] The embodiments of the present invention have been described above, and the above description is exemplary, not exhaustive, and is not limited to the disclosed embodiments. Many modifications and changes will be apparent to those skilled in the art without departing from the scope and spirit of the described embodiments.
Claims
1. A method for constructing a prokaryotic single-cell RNA sequencing library, characterized in that: The steps include: (1) Cell treatment: fix prokaryotic cells and permeabilize the cell membrane; (2) PolyA addition and rRNA shielding: PolyA sequence is added to the 3' end of the RNA fragment by Poly A polymerase, and the rRNA end is specifically blocked by a shielding primer to prevent the addition of polyA sequence; the sequence of the shielding primer is shown in SEQ ID No. 1-13; (3) Reverse transcription and first round of label addition: using a nucleotide sequence with a specific label to reverse transcribe the RNA sequence with polyA added to obtain a cDNA sequence; the nucleotide sequence with the specific label is shown in SEQ ID No. 14; (4) Second round of tag addition: Through a ligation reaction, the second round tag sequence is added to the cDNA sequence obtained in the first round using a complementary ligation adapter sequence to further increase the number of cell UMIs; the complementary ligation adapter sequence is shown in SEQ ID No. 15, and the second round tag sequence is shown in SEQ ID No. 16; (5) Amplification and third round of label addition: Use a random primer with a label to generate a second strand of the cDNA sequence obtained in step (4) and add a third round of label; the sequence of the random primer with a label is shown in SEQ ID No. 17; (6) Library construction and amplification: After purifying the product obtained in step (5), amplification is performed using universal sequencing primers to construct a library suitable for sequencing; The prokaryotes are derived from fecal intestinal flora.
2. The method according to claim 1, wherein: In step (1), the number of prokaryotic cells fixed is 1-10 20 indivual.
3. The method according to claim 1, wherein: In step (1), fixation and permeabilization are performed at a low temperature of 1-4°C, and RNase inhibitors are added.
4. The method according to claim 1, wherein: In step (2), Poly A polymerase and shielding primer are added simultaneously, and the final concentration of shielding primer is 1-100 μM.
5. The method according to claim 1, wherein: The reactions of steps (3) to (5) are all carried out in a perforated plate. In the corresponding next step, the perforated wells are first mixed and then the perforated plates are refilled for the next step reaction.
6. The method according to claim 1, wherein: In step (4), the second round tag sequence and the complementary linker sequence are first annealed at low temperature and then added to the system.
7. The method according to claim 1, wherein: In step (4), an additional round of labeling is added based on the number of cells to optimize sequencing efficiency and accuracy.
8. The method according to claim 1, wherein: The purification treatment in step (6) uses Ampure XP magnetic beads to remove fragments below 100 bp and primer adapter sequences; the universal sequencing primer is an Illumina sequencing double-end adapter primer.