A multiplex qPCR primer, kit and method for simultaneously detecting multiple listeria based on new molecular targets

By designing specific multiplex qPCR primers and probe sets, combined with fluorescently labeled nucleic acid probes, rapid and accurate detection and identification of six Listeria species were achieved, solving the problems of complex detection and high cost in existing technologies, and improving detection efficiency and sensitivity.

CN118879897BActive Publication Date: 2026-02-17GUANGDONG HUANKAI BIOLOGICAL SCI & TECH CO LTD +3
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202411214744.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-09-02
Publication Date
2026-02-17
Estimated Expiration
2044-09-02

AI Technical Summary

Technical Problem

Existing technologies are insufficient for the rapid and accurate simultaneous detection and identification of six common Listeria species. Furthermore, traditional methods are complex, costly, and prone to false positives or false negatives.

Method used

We designed highly specific multiplex qPCR primers and probes, combined with fluorescently labeled nucleic acid probes, to achieve simultaneous detection and identification of six Listeria species through a two-tube reaction system. We used specific novel molecular targets to reduce the probability of false positives and false negatives, and optimized the kit composition using premixed and lysis buffers.

Benefits of technology

It enables rapid, accurate, and convenient detection of six Listeria species, reducing the detection time to within 14 hours, increasing detection throughput, simplifying result interpretation, reducing costs, and providing high sensitivity, making it suitable for large-scale sample testing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118879897B_ABST
    Figure CN118879897B_ABST
Patent Text Reader

Abstract

The application belongs to the field of microbial molecule detection, and discloses a multiple qPCR kit and method for simultaneously detecting multiple listeria based on new molecular targets. The application designs corresponding primers and probes based on specific gene fragments of each listeria obtained by genomics mining, establishes a multiple qPCR method, and assembles the method into a portable kit. The multiple qPCR primer probe set of the application has high specificity, and only the six target bacteria of Listeria monocytogenes, Listeria innocua, Listeria ivanovii, Listeria welshimeri, Listeria seeligeri and Listeria grayi appear fluorescence signals in the specific fluorescence signal channel, so that the detection result is more accurate. The multiple qPCR kit of the application can complete sample detection within 14 hours, wherein the whole qPCR process only needs about 1 hour, the detection efficiency is high, the detection cost is low, and the kit is particularly suitable for large-scale sample investigation and actual detection, and the detection sensitivity can be as low as 1.0-11.1 CFU / Test.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of microbial molecular detection, and particularly relates to a multiplex qPCR primer, kit and method for simultaneously detecting six Listeria based on a new molecular target. BACKGROUND

[0002] Listeria is one of the most common foodborne pathogens, which widely distributes in the environment, food, human and animal hosts. Among them, Listeria monocytogenes, Listeria ivanovii, Listeria innocua, Listeria welshimeri, Listeria seeligeri and Listeria grayi are the most common six Listeria species isolated from food, patients and the environment. Listeria monocytogenes is one of the most common zoonotic pathogens, and human infection with Listeria monocytogenes can cause meningitis, endocarditis, pectoral myositis, miscarriage in pregnant women and septicemia, etc. The mortality rate (20%-30%) of the patients is much higher than that of other common foodborne pathogens, such as Salmonella enteritidis (about 0.38%), Campylobacter (0.02%-0.1%), and Vibrio (0.005%-0.1%). At present, Listeria monocytogenes has been listed as one of the foodborne pathogens to be detected in the WHO Food Safety Plan. Listeria ivanovii mainly has pathogenicity to animals, and research reports that it also has certain pathogenicity to humans. Listeria innocua, Listeria seeligeri, Listeria welshimeri and Listeria grayi are generally considered to be non-pathogenic bacteria. However, recent literature reports that Listeria innocua also has certain potential pathogenicity to humans, and in addition, these non-pathogenic bacteria have been reported to cause severe bacteremia, purulent meningitis, conjunctivitis and myelodysplastic syndrome-refractory anemia in humans. More importantly, since these non-pathogenic Listeria often co-contaminate food with Listeria monocytogenes and mask the presence of Listeria monocytogenes, they are considered to be potential indicators of the presence of Listeria monocytogenes. Overall, the presence of any Listeria in food is considered to be a potential indicator of poor health status, with only differences in severity of harm. Therefore, accurate detection and identification of common Listeria at the species level is of great significance to promote food quality and safety and greatly reduce the health risks faced by people with low immunity. However, due to the high level of similarity in the ecology, biochemistry and genomic characteristics of each Listeria species, it brings great difficulty to the identification of Listeria species.

[0003] Currently, the detection of Listeria is mainly based on the traditional culture and identification method specified in the national standard (GB 4789.30-2016). This method requires two-step pre-enrichment culture, and then biochemical identification of suspicious single colonies. The detection time is relatively long (more than 5 days), the operation is complex, the cost is high, and it is not conducive to large-scale rapid detection. In addition, when biochemical tests are used to identify Listeria, biochemical reactions are unstable, and results are obtained by subjective judgment, which leads to misjudgment of biochemical identification results, poor reproducibility, and single biochemical detection cannot meet the detection requirements of simultaneous detection and identification of six common Listeria. In recent years, molecular biology detection methods based on polymerase chain reaction (PCR) have gradually become one of the most potential detection technologies to replace traditional detection and identification methods due to their rapid, accurate and simple characteristics. Our research team has established a multiplex PCR method to detect pathogenic Listeria, including Listeria, Listeria monocytogenes and Listeria ivanovii. Lu et al. established a multiplex PCR method to simultaneously detect Listeria, Listeria monocytogenes, Listeria ivanovii, Listeria innocua, Listeria welshimeri, Listeria seeligeri and Listeria grayi. However, these ordinary PCR methods are complicated to operate, easy to contaminate and can only be used for qualitative analysis when used for Listeria species identification. The introduction of specific fluorescent probes in conventional PCR to construct quantitative real-time PCR (qPCR) technology can further improve the detection sensitivity and specificity. The qPCR method is simple to operate, and since it does not require subsequent gel electrophoresis steps, the possibility of cross contamination is greatly reduced. The multiplex PCR reaction can amplify multiple fragments in one reaction system, which has the advantage of large detection throughput compared with single reaction, and is more suitable for large-scale rapid detection of samples.

[0004] At present, there are many mature qPCR detection kits for Listeria monocytogenes at home and abroad, but there is no multiplex qPCR method and product for simultaneous detection and identification of six common Listeria. The main reason may be that the genome sequences of each Listeria species are highly similar and the gene sequences of strains within the same species are diverse, and it is a great challenge to mine specific targets for each species and design corresponding high-specificity primers / probes. If the primer specificity is poor, it will increase the probability of false positive and false negative in the detection process. Therefore, the development of a high-specificity multiplex qPCR kit that can simultaneously detect and identify six common Listeria is of great significance for rapid strain identification and monitoring of Listeria prevalence in food and environment. And the selection of reliable target genes and the design of corresponding specific primers and probes are particularly crucial. SUMMARY

[0005] The purpose of the present application is to overcome at least one deficiency of the prior art, and to provide a multiplex qPCR primer, kit and method for simultaneously detecting and identifying six Listeria based on new specific molecular targets.

[0006] The present application is based on the specific gene fragments of each Listeria obtained by genomics mining to design corresponding primers and probes, and to establish a multiplex qPCR method through optimization and assemble it into a portable kit to meet the needs of rapid screening and species identification of six common Listeria. The technical scheme adopted by the present application is:

[0007] In a first aspect, the application provides a multiplex qPCR primer probe set for simultaneous detection of multiple Listeria, comprising: a primer pair for detection of Listeria monocytogenes, comprising LM-1F: GACAGCACCATTTCCGAACG and LM-1R: ATCCCAATCTTCCTAACCACTGT; a primer pair for detection of Listeria ivanovii, comprising Ivanovii-2F: TATTCACGCCGACTCCCTCT and Ivanovii-2R: GGTCCTGTCCACAAGCAAGT; a primer pair for detection of Listeria welshimeri, comprising Welshimeri-1F: GTGTTGCTCCTTATGATGCTCTAG and Welshimeri-1R: GCTGTTAGAACCGTACCAATTCC; a primer pair for detection of Listeria seeligeri, comprising Seeligeri-2F: CGATATGACCAGTACAATAATCACGAAT and Seeligeri-2R: CCCAACGGTTCAAAATTTCTTG; a primer pair for detection of Listeria innocua, comprising Innocua-1F: TTTAGAAGTAAAGGAAGAAGCGTTGA and Innocua-1R: TTCTCGGCATTTCAGCTGTTT; and a primer pair for detection of Listeria grayi, comprising Grayi-1F: GTGTATCAGCGACTGTAGCAATAG and Grayi-1R: TGCACGTCCTACTCCAACAC.

[0008] In some examples of the multiplex qPCR primer probe set, the probes comprise: a nucleic acid probe for detection of Listeria monocytogenes, comprising LM-1P: TCTGCAAGTCTTCAATCTCTTGCTCCA; a nucleic acid probe for detection of Listeria ivanovii, comprising Ivanovii-2P: ACCCATTACCCCATATTTGGACCACCG; a nucleic acid probe for detection of Listeria welshimeri, comprising Welshimeri-1P: ATCAATCCTACAATAACACACACCACATCAGT; a nucleic acid probe for detection of Listeria seeligeri, comprising Seeligeri-2P: CAAAGAGCATGACAATTACCCCAACGCA; a nucleic acid probe for detection of Listeria innocua, comprising Innocua-1P: CAACCAGCCGCGCCGAAAAAAG; and a nucleic acid probe for detection of Listeria grayi, comprising Grayi-1P: AACAAACTGCTAGCCCTGCGGCAA.

[0009] In some examples of the multiplex qPCR primer probe set, different pairs of quencher and fluorescent group linked to different nucleic acid probes are different.

[0010] In some examples of the multiplex qPCR primer probe set, the 5' end of the nucleic acid probe corresponding to Listeria monocytogenes is labeled with a fluorescent group VIC, and the 3' end is labeled with a quencher BHQ1; the 5' end of the nucleic acid probe corresponding to Listeria ivanovii is labeled with a fluorescent group ROX, and the 3' end is labeled with a quencher BHQ2; the 5' end of the nucleic acid probe corresponding to Listeria welshimeri is labeled with a fluorescent group Cy5, and the 3' end is labeled with a quencher BHQ3; the 5' end of the nucleic acid probe corresponding to Listeria innocua is labeled with a fluorescent group VIC, and the 3' end is labeled with a quencher BHQ1; the 5' end of the nucleic acid probe corresponding to Listeria seeligeri is labeled with a fluorescent group FAM, and the 3' end is labeled with a quencher BHQ1; and the 5' end of the nucleic acid probe corresponding to Listeria grayi is labeled with a fluorescent group Cy5, and the 3' end is labeled with a quencher BHQ3.

[0011] In a second aspect of the present application, a multiplex qPCR kit for simultaneously detecting multiple Listeria is provided, which contains the multiplex qPCR primer probe set of the first aspect of the present application.

[0012] Preferably, the kit comprises premix A and premix B, the composition of the premix A comprises: 2x qPCR Mix, the upstream and downstream primers and the probe of Listeria monocytogenes, the upstream and downstream primers and the probe of Listeria ivanovii, the upstream and downstream primers and the probe of Listeria welshimeri, the concentration of each upstream primer is 0.35 μmol / L, the concentration of each downstream primer is 0.35 μmol / L, and the concentration of each probe is 0.35 μmol / L; the composition of the premix B comprises: 2x qPCR Mix, the upstream and downstream primers and the probe of Listeria seeligeri, the upstream and downstream primers and the probe of Listeria innocua, the upstream and downstream primers and the probe of Listeria grayi, the concentration of each upstream primer is 0.40 μmol / L, the concentration of each downstream primer is 0.40 μmol / L, and the concentration of each probe is 0.40 μmol / L.

[0013] Further preferably, the kit further comprises a negative control, a positive control and a lysis solution, the positive control is a mixture of DNA extracts of corresponding target Listeria strains, the negative control is DEPC water, and the lysis solution mainly comprises 5 mmol / L tris(hydroxymethyl aminomethane) and 0.02% (m / v) sodium dodecyl sulfate (SDS) solution.

[0014] In a third aspect of the present application, a multiplex qPCR method for simultaneously detecting multiple Listeria is provided, which comprises the following steps:

[0015] S1) Extracting the genomic DNA of the sample to be tested for standby;

[0016] S2) Adding the genomic DNA of the sample to be tested as a template into the multiplex qPCR kit reaction system for amplification,

[0017] The multiplex qPCR kit is as described in the second aspect of the present application;

[0018] S3) Setting the qPCR program and collecting the fluorescence signal in the amplification process, and determining whether the Listeria monocytogenes, Listeria ivanovii, Listeria welshimeri, Listeria innocua, Listeria seeligeri and Listeria grayi are detected by fluorescence signal analysis.

[0019] As preferred, the total qPCR reaction system is 25 μL, the A tube takes ROX, VIC and Cy5 detection channels, the B tube takes FAM, VIC and Cy5 detection channels, the qPCR program is 94℃ pre-denaturation for 60 s; 95℃ denaturation for 20 s, 58℃ annealing and extension for 30 s, a total of 40 cycles, and the fluorescence signal is collected at each cycle of the annealing and extension stage.

[0020] As further preferred, the positive control appears S-shaped amplification curve and its Ct value is < 30, the negative control does not appear obvious S-shaped typical amplification curve or the Ct value is > 35, and it is determined that the multiplex qPCR kit is not failed; the judgment standard of the target Listeria is: a) if the sample to be tested has a typical amplification curve after amplification of a certain gene channel, and the Ct value is ≤ 35, it is determined that the sample to be tested contains the Listeria corresponding to the channel; b) if the sample to be tested does not have a typical amplification curve after amplification of a certain gene channel, and the Ct value is ≥ 37, it is determined that the sample to be tested does not contain the Listeria corresponding to the channel; c) if the sample to be tested has a typical amplification curve after amplification of a certain gene channel, and 35 < Ct < 37, it is determined as an uncertain sample, and the DNA template amount needs to be appropriately increased for retesting.

[0021] The present application has the following beneficial effects:

[0022] The multiplex qPCR primer probe set provided by the present application has high specificity, is based on a specific new molecular target, and only detects the fluorescence signal of the six target Listeria monocytogenes, Listeria innocua, Listeria ivanovii, Listeria welshimeri, Listeria seeligeri and Listeria grayi in the specific fluorescence signal channel, reduces the probability of false positive or false negative, and the detection result is more accurate.

[0023] The multiplex qPCR kit provided by the application is rapid and efficient: compared with the traditional culture identification process which needs nearly a week of time, the whole sample detection process (including the pre-inoculation process of the sample) can be completed within 14h by using the method.

[0024] The multiplex qPCR kit provided by the application is high in sensitivity: the minimum detection limit (LOD) of the Listeria monocytogenes detected in the TaqMan multiplex qPCR kit is approximately 11.1 CFU / Test, the LOD of the Listeria ivanovii is approximately 1.1 CFU / Test, the LOD of the Listeria welshimeri is approximately 10.0 CFU / Test, the LOD of the Listeria innocua is approximately 44.8 CFU / Test, the LOD of the Listeria seeligeri is approximately 1.0 CFU / Test, and the LOD of the Listeria grayi is approximately 1.0 CFU / Test.

[0025] The multiplex qPCR kit provided by the application is simple and convenient to operate: the components and proportion of the kit are reasonable, the operation is simple and convenient, and the cross contamination is reduced to the maximum extent. BRIEF DESCRIPTION OF DRAWINGS

[0026] Figure 1 is the amplification curve and specificity of the Listeria monocytogenes single qPCR detection method.

[0027] Figures 2-6 is the amplification curve and specificity of the Listeria ivanovii, Listeria welshimeri, Listeria innocua, Listeria seeligeri and Listeria grayi single qPCR detection method.

[0028] Figure 7 is the six Listeria positive sample mixed by two tubes for multiplex qPCR detection example figure (A) A tube reaction system, including Listeria monocytogenes, Listeria ivanovii and Listeria welshimeri. (B) B tube reaction system, including Listeria innocua, Listeria seeligeri and Listeria grayi.

[0029] Figures 8-13The amplification curves of different concentrations of Listeria monocytogenes, Listeria ivanovii, Listeria welshimeri, Listeria innocua, Listeria seeligeri and Listeria grayi detected by the multiplex qPCR kit are shown in Figures 1A-1F, respectively.

[0030] Figure 14 The standard curves of different concentrations of Listeria detected by the multiplex qPCR kit are shown in Figures 2A-2F, wherein (A) is Listeria monocytogenes; (B) is Listeria ivanovii; (C) is Listeria welshimeri; (D) is Listeria innocua; (E) is Listeria seeligeri; and (F) is Listeria grayi. DETAILED DESCRIPTION

[0031] To further illustrate the technical means adopted by the present application and its effects, the technical solutions of the present application are further described below through specific embodiments, but the present application is not limited in the scope of the examples. The materials used in the following examples are not limited to the above-mentioned list, and other similar materials can be used instead. If the specific conditions of the instruments are not specified, the instruments are used according to the conventional conditions or the conditions recommended by the manufacturers. Unless otherwise specified, the reagents and methods used in the present application are conventional reagents and conventional methods in the technical field.

[0032] Example 1: Design and screening of primers and probes

[0033] 1) Design of primers and probes

[0034] According to the GenBank database and the whole genome DNA sequence of Listeria measured by the team, bioinformatics analysis was performed to screen six specific gene fragments of Listeria. For each of the six Listeria, primer 5 and Oligo 7 were used to design primers and probes, and the NCBI web page Primer BLAST tool was used to search and confirm the specificity of the designed primers and probes in all species. Under the premise of meeting the design principles of primers and probes, it was ensured that the amplification fragment was within 200 bp. The sequences of different primers and probes designed are shown in Table 1.

[0035] Table 1: Different primer and probe sequence table

[0036]

[0037]

[0038] 2) The final concentration of the upstream and downstream primers of different Listeria was set to 0.30 μmol / L, and the genomic DNA of the target Listeria strain was used as a positive control template. DEPC water was used as a blank control, and the six Listeria were used as negative controls. Single qPCR reaction was performed using the same reaction system to prove the effectiveness of the synthesized primers and probes.

[0039] 3) The designed primers and probes were combined in three groups in tubes A and B, respectively. The final concentration of each primer and probe was 0.30 μmol / L. The optimal primer and probe were selected from the group with the best combination detection result based on the cycle threshold (Ct) and fluorescence signal value (ΔRn).

[0040] The results showed that all primer and probe groups only amplified typical S-shaped amplification curves in the corresponding gene channel, and the Ct value was less than 25, indicating that the designed primers and probes were effective. The eight combinations of tubes A and B were tested in a unified reaction system, and the best amplification result of the three fluorescence channels of each combination of tubes A and B was selected. The preferred amplification primers and probes are shown in Table 2, and the amplification curves are shown in Figures 1-6 .

[0041] Table 2 Preferred primer and probe table

[0042]

[0043] Example 2: Construction and optimization of multiplex qPCR reaction method

[0044] 1) According to the preferred primers and probes of each Listeria, different final concentrations (0.2, 0.3, 0.35, 0.4, 0.45, and 0.5 μmol / L) of primers and probes were selected for single factor optimization experiment. The final single qPCR reaction system was determined by considering the cycle threshold (Ct) and fluorescence signal value (ΔRn) of the amplification curve.

[0045] 2) Using the same concentration of genomic DNA as the template, the optimal conditions of single qPCR were selected, and the appropriate concentration of primers was used for orthogonal test to optimize the multiplex qPCR reaction system. The optimal conditions of multiplex reaction were selected according to the Ct value, fluorescence intensity change, and sensitivity of the amplification curve, so that the six Listeria could be detected simultaneously by two tube reaction systems. The amplification program was 94°C pre-denaturation for 60 s, 95°C denaturation for 20 s, 58°C annealing and extension for 30 s, a total of 40 cycles, and the fluorescence signal was collected during the annealing and extension stage of each cycle.

[0046] The results of multiplex qPCR reaction system optimization are shown in Table 3 (tube A) and Table 4 (tube B), and the amplification curves of the multiplex reaction system are shown in Figure 7 .

[0047] Table 3, A tube reaction system optimization results

[0048]

[0049] Table 4, B tube reaction system optimization results

[0050]

[0051] Example 3: Preparation of multiplex qPCR kit

[0052] 1) Primer synthesis: oligonucleotide primers and probes were synthesized according to the sequences provided in Table 2;

[0053] 2) Preparation of premix A and premix B: 10x primer / probe mixture was prepared according to the optimization results of Example 2, and the components of premix A and B tubes were allocated as follows: 2x qPCR Mix: 10x primer / probe mixture: DEPC water = 5: 1: 2;

[0054] 3) Preparation of lysis solution: lysis solution containing 5 mmol / L Tris-base and 0.02% (m / v) SDS was prepared in a container, sterilized, and filtered to remove bacteria, 1 mL per tube;

[0055] 4) Preparation of positive control: 0.5-2 mL of bacteria in logarithmic growth phase (OD 600 about 0.6) was used to extract DNA of Listeria monocytogenes (FSCC(I)178002), Listeria ivanovii (FSCC(I)17802986), Listeria welshimeri (FSCC(I)178031), Listeria innocua (FSCC(I)17803049), Listeria grayi (FSCC(I)17802985) and Listeria grayi (FSCC(I)17802270) using a bacterial genomic DNA extraction kit, and the concentration was determined using a ultramicro UV-visible spectrophotometer. The DNA concentration was adjusted to 15-20 amplification Ct values with DEPC water and mixed, 200 μL per tube;

[0056] 5) Preparation of negative control: DEPC water was aliquoted at 200 μL per tube;

[0057] 6) Assembly of kit, including ①, premix A and premix B: brown screw cap and brown centrifuge tube, 2; ②, lysis solution: red screw cap, 1; ③, positive control: yellow screw cap, 1; ④, negative control: green screw cap, 1; provide instructions, package.

[0058] Example 4: Sensitivity verification of multiplex qPCR kit detection system

[0059] A certain amount of single colonies of Listeria monocytogenes (FSCC(I)178002), Listeria ivanovii (FSCC(I)17802986), Listeria welshimeri (FSCC(I)178031), Listeria innocua (FSCC(I)17803049), Listeria grayi (FSCC(I)17802985) and Listeria grayi (FSCC(I)17802270) were picked up with a sterile inoculation loop, transferred to 4.5 mL sterile normal saline and mixed well. The above bacterial solution was sequentially diluted by 10 times in sterile normal saline (dilution ratios were 10 1 , 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 ) respectively.

[0060] 1) Sample DNA extraction

[0061] 1 mL of the diluted bacterial solution was taken into a 1.5 mL sterile centrifuge tube, centrifuged at 5000 r / min for 5 min, and the supernatant was discarded. Then 30 μL of lysis solution was added, the bacterial body was suspended well, the tube wall was tapped to eliminate air bubbles, and heat lysis was performed at 99°C for 10 min. After lysis, centrifugation was performed at 12000 r / min for 15 min, and the supernatant was taken as the crude genomic DNA.

[0062] 2) Bacterial solution concentration determination

[0063] Another appropriate dilution (10 2 -10 5 ) bacterial solution (60 μL) was used for PDA plate coating, and the plate was incubated at 37°C for 24-48 h for counting, and each bacterial solution concentration was determined in triplicate. The corresponding colony count was determined according to GB 4789.2-2016 "Determination of total number of colonies in food microbiology test".

[0064] 3) Multiple qPCR amplification

[0065] The corresponding number of PCR reaction tubes were taken, and 20 μL of premix A or B was added to each tube. 5 μL of negative control, positive control and sample DNA was added to each reaction tube, the tube cap was tightly covered, centrifuged briefly, and the amplification reaction was immediately performed. The reaction was repeated 3 times.

[0066] 4) Result determination.

[0067] The positive control appears S-shaped amplification curve and its Ct value is < 30, the negative control does not appear obvious S-shaped typical amplification curve or Ct value is > 35, and it is determined that the multiplex qPCR kit is effective. Under this condition, if the amplification of the sample to be tested has a typical amplification curve and the Ct value is ≤ 35, it is determined that the sample to be tested contains the corresponding Listeria of the channel. If the amplification of the sample to be tested has no typical amplification curve and the Ct value is ≥ 37, it is determined that the sample to be tested does not contain the corresponding Listeria of the channel. If the amplification of the sample to be tested has a typical amplification curve and 35 < Ct < 37, it is determined to be an uncertain sample, and the DNA template amount needs to be appropriately increased for retesting.

[0068] In combination with the results of colony counting and multiplex qPCR, the limit of detection (LOD) of the multiplex qPCR kit is determined. The amplification curve results are shown in Figures 8-13 The standard curve results are shown in Figure 14 The calculation shows that the LOD of the multiplex qPCR kit is approximately 11.1 CFU / Test for (A) Listeria monocytogenes, 1.1 CFU / Test for (B) Listeria ivanovii, 10.0 CFU / Test for (C) Listeria welshimeri, 44.8 CFU / Test for (D) Listeria innocua, 1.0 CFU / Test for (E) Listeria seeligeri, and 1.0 CFU / Test for (F) Listeria grayi, indicating that the kit can sensitively detect the six kinds of Listeria at the same time through two-tube reaction.

[0069] Example 5: Specificity verification of multiplex qPCR kit detection system

[0070] The 87 strains of bacteria (including 54 strains of target Listeria and 33 strains of other common non-target bacteria) are used to verify the detection specificity of the multiplex qPCR kit prepared in Example 3. The Listeria strains specifically include Listeria monocytogenes strains (5 standard strains and 40 laboratory isolated strains), Listeria welshimeri strains (4 laboratory isolated strains), Listeria innocua (1 standard strain and 1 laboratory isolated strain), 1 standard strain of Listeria ivanovii, 1 standard strain of Listeria seeligeri, and 1 standard strain of Listeria grayi. The numbers of all laboratory isolated strains are shown in Table 5.

[0071] Table 5, Numbers of Laboratory Isolated Strains

[0072]

[0073]

[0074] The single colony half ring of each bacterium was picked up with a sterile inoculation ring, and the sample DNA extraction, multiplex qPCR amplification and result determination were performed according to Example 4. The detection results are shown in Tables 6 and 7. The positive control and the target Listeria monocytogenes, Listeria innocua, Listeria ivanovii, Listeria welshimeri, Listeria seeligeri and Listeria grayi only have positive amplification results in the corresponding fluorescence channels, and other strains do not have typical positive amplification results. The results show that the multiplex qPCR kit has high specificity.

[0075] Table 6, specificity verification results of the multiplex qPCR kit detection system of tube A

[0076]

[0077]

[0078] Table 7, specificity verification results of the multiplex qPCR kit detection system of tube B

[0079]

[0080]

[0081] Example 6: repeatability verification of the multiplex qPCR kit

[0082] The same batch (4) and different batches (4 batches) of multiplex qPCR kits were used to amplify the same concentration of genomic DNA according to Example 4, and the repeatability of the kit was verified, wherein the coefficient of variation = standard deviation / average. The results are shown in Tables 8 and 9. The coefficients of variation of the multiplex qPCR kit detection system established by the batch and batch detection are less than 2.89%, indicating that the multiplex qPCR kit detection system has good repeatability and stability.

[0083] Table 8, repeatability verification of the multiplex qPCR kit detection system of tube A

[0084]

[0085] Table 9, repeatability verification of the multiplex qPCR kit detection system of tube B

[0086]

[0087] Example 7: simultaneous detection of six kinds of Listeria in artificially contaminated lettuce samples by the multiplex qPCR kit

[0088] 1) Chicken sample pretreatment: Chicken samples were purchased from a local supermarket and sterilized by burning with alcohol cotton balls on a clean bench, then irradiated under a UV lamp for about 20 min. Each 25 g of chicken was taken with sterile scissors and placed in a sterile culture dish at 4°C for standby.

[0089] 2) National standard method detection: The samples were detected by referring to the national standard method (GB 4789.30-2016) to confirm that they did not contain six kinds of Listeria, which could be used for artificial pollution.

[0090] 3) Artificial inoculation: Each meat sample was transferred to a sterile homogenization bag and inoculated with 1 mL of mixed strain culture solution, each strain with a concentration of 10 3 ~ 10 0 CFU / mL, then 225 mL of LB1 was added and homogenized for 1 min. The samples were cultured at 30°C on a shaker (200 r / min) for 6, 8, 10, and 12 h. The concentration of the bacterial solution used for artificial pollution was determined by plate culture counting, and each bacterial solution concentration was done in triplicate. Uninoculated samples were used as negative controls.

[0091] 4) Multiple qPCR detection: Refer to Example 4 to extract genomic DNA and perform multiple qPCR detection.

[0092] The results are shown in Table 10. The developed multiple qPCR kit detected six artificially contaminated Listeria in chicken samples at a sensitivity of 10 2 CFU / g after 6 h of culture at 30°C, and the detection sensitivity increased to 10 0 CFU / g after 12 h of culture at 30°C.

[0093] Table 10. Results of multiple qPCR method for detecting six kinds of Listeria in artificially contaminated chicken samples

[0094]

[0095]

[0096] Example 8: Multiple qPCR kit for simultaneous detection of six kinds of Listeria in instant vegetable samples

[0097] The local supermarket purchases 15 instant vegetable samples, 25 g of each sample is taken by sterile scissors, placed in a sterile container containing 225 mL of LB1, homogenized, and then cultured at 30°C on a shaking table (200 r / min) for 12 h. The nucleic acid of the 15 instant vegetable samples is extracted according to the method of Example 4 and detected using the prepared multiplex qPCR kit, and the amplification curve and Ct value of different fluorescence channels are used to judge the positive and negative of the corresponding pathogenic bacteria nucleic acid. The samples are simultaneously detected by the national standard method. The results are shown in Table 11, and 2 positive L. innocua samples, 1 positive L. monocytogenes sample and 1 positive L. weihuiensis sample are detected from the 15 samples. The results show that the multiplex qPCR kit and method established by the present application are completely consistent with the detection results of the national standard method.

[0098] Table 11, detection results of real samples

[0099]

[0100] The above examples show and describe the basic principles and characteristics of the present application, and the results show that the kit of the present application has the characteristics of good accuracy and repeatability, high sensitivity, and is suitable for rapid detection and identification of six common species of Listeria in large-scale food and environmental samples.

[0101] The above is a further detailed description of the present application, which cannot be regarded as a limitation on the specific implementation of the present application. For ordinary skilled persons in the technical field to which the present application belongs, simple deductions or substitutions without departing from the concept of the present application are within the protection scope of the present application.

Claims

1. A multiplex qPCR primer probe set for simultaneous detection of multiple Listeria based on new molecular targets, divided into A tube and B tube reaction systems, wherein, A tube reaction system includes primers and probes of Listeria monocytogenes Listeria monocytogenes , Listeria ivanovii Listeria ivanovii , and Listeria welshimeri Listeria welshimeri , a B tube reaction system includes primers and probes of Listeria innocua Listeria innocua , Listeria septicua Listeria seeligeri , and Listeria grayi Listeria grayi , characterized in that the primer pair for Listeria monocytogenes detection includes LM-1F: GACAGCACCATTTCCGAACG and LM-1R: ATCCCAATCTTCCTAACCACTGT. A nucleic acid probe for detecting Listeria monocytogenes, comprising LM-1P: TCTGCAAGTCTTCAATCTCTTGCTCCA; A primer pair for detecting Listeria ivanovii, comprising Ivanovii-2F: TATTCACGCCGACTCCCTCT and Ivanovii-2R: GGTCCTGTCCACAAGCAAGT, A nucleic acid probe for detecting Listeria ivanovii, comprising Ivanovii-2P: ACCCATTACCCCATATTTGGACCACCG; A primer pair for detecting Listeria welshimeri, comprising Welshimeri-1F: GTGTTGCTCCTTATGATGCTCTAG and Welshimeri-1R: GCTGTTAGAACCGTACCAATTCC, A nucleic acid probe for detecting Listeria welshimeri, comprising Welshimeri-1P: ATCAATCCTACAATAACACACACCACATCAGT; A primer pair for detecting Listeria seeligeri, comprising Seeligeri-2F: CGATATGACCAGTACAATAATCACGAAT and Seeligeri-2R: CCCAACGGTTCAAAATTTCTTG, A nucleic acid probe for detecting Listeria seeligeri, comprising Seeligeri-2P: CAAAGAGCATGACAATTACCCCAACGCA; A primer pair for detecting Listeria innocua, comprising Innocua-1F: TTTAGAAGTAAAGGAAGAAGCGTTGA and Innocua-1R: TTCTCGGCATTTCAGCTGTTT, A nucleic acid probe for detecting Listeria innocua, comprising Innocua-1P: CAACCAGCCGCGCCGAAAAAAG; A primer pair for detecting Listeria grayi, comprising Grayi-1F: GTGTATCAGCGACTGTAGCAATAG and Grayi-1R: TGCACGTCCTACTCCAACAC, A nucleic acid probe for detecting Listeria grayi, comprising Grayi-1P: AACAAACTGCTAGCCCTGCGGCAA; Different nucleic acid probes have different pairs of quencher and fluorescent group connected thereto.

2. The multiplex qPCR primer probe set of claim 1, wherein, The nucleic acid probe corresponding to Listeria monocytogenes is labeled with a fluorescent group VIC at the 5' end and a quencher BHQ1 at the 3' end; The 5' end of the nucleic acid probe corresponding to L. ivanovii is labeled with a fluorescent group ROX, and the 3' end is labeled with a quenching group BHQ2; The 5' end of the nucleic acid probe corresponding to L. weihenstephanensis is labeled with a fluorescent group Cy5, and the 3' end is labeled with a quenching group BHQ3; The 5' end of the nucleic acid probe corresponding to L. innocua is labeled with a fluorescent group VIC, and the 3' end is labeled with a quenching group BHQ1; The 5' end of the nucleic acid probe corresponding to L. seeligeri is labeled with a fluorescent group FAM, and the 3' end is labeled with a quenching group BHQ1; The 5' end of the nucleic acid probe corresponding to L. grayi is labeled with a fluorescent group Cy5, and the 3' end is labeled with a quenching group BHQ3.

3. A multiplex qPCR kit for simultaneous detection of multiple Listeria, characterized by, The multiplex qPCR primer probe set according to claim 1 or 2.

4. The multiplex qPCR kit according to claim 3, characterized in that, The kit comprises premix A and premix B, the composition of the premix A comprises: 2× qPCR Mix, the upstream and downstream primers and probes of L. monocytogenes, the upstream and downstream primers and probes of L. ivanovii, the upstream and downstream primers and probes of L. weihenstephanensis, the concentration of each upstream primer is 0.35 µmol / L, the concentration of each downstream primer is 0.35 µmol / L, and the concentration of each probe is 0.35 µmol / L; The composition of the premix B comprises: 2× qPCR Mix, the upstream and downstream primers and probes of L. seeligeri, the upstream and downstream primers and probes of L. innocua, and the upstream and downstream primers and probes of L. grayi, wherein the concentration of each upstream primer is 0.40 µmol / L, the concentration of each downstream primer is 0.40 µmol / L, and the concentration of each probe is 0.40 µmol / L.

5. The multiplex qPCR kit according to claim 3 or 4, characterized in that, It also comprises a negative control, a positive control and a lysis solution, the positive control is a mixture of DNA extracts of corresponding target Listeria positive strains; the negative control is DEPC water; the composition of the lysis solution comprises 5 mmol / L tris (hydroxymethyl aminomethane) and 0.02 m / v% sodium dodecyl sulfate solution.

6. A multiplex qPCR method for simultaneously detecting multiple Listeria, the method is used for non-disease diagnosis and / or treatment purposes, comprising the following steps: Extracting genomic DNA of the sample to be tested for standby use; Adding the genomic DNA of the sample to be tested as a template into the reaction system of the multiplex qPCR kit for amplification, the multiplex qPCR kit is as claimed in any one of claims 3-5; Setting the qPCR program and collecting the fluorescence signal in the amplification process, and judging whether L. monocytogenes, L. ivanovii, L. weihenstephanensis, L. innocua, L. seeligeri and L. grayi are detected through fluorescence signal analysis.

7. The multiplex qPCR method according to claim 6, wherein, The total system of the qPCR reaction is 25 μL, the ROX, VIC and Cy5 detection channels are taken in the A tube, the FAM, VIC and Cy5 detection channels are taken in the B tube, the qPCR program is 94℃ pre-denaturation for 60 s; 95℃ denaturation for 20 s, 58℃ annealing and extension for 30 s, a total of 40 cycles, and the fluorescence signal is collected at each cycle of the annealing and extension stage.

8. The multiplex qPCR method according to claim 6 or 7, characterized in that, The positive control appears S-shaped amplification curve and its Ct value is < 30, the negative control does not appear obvious S-shaped typical amplification curve or Ct value is > 35, it is determined that the multiplex qPCR kit is not failed; the judgment standard of the target listerias is: a) if the amplification of the gene channel of the sample to be tested has a typical amplification curve, and the Ct value is ≤ 35, it is judged that the sample to be tested contains the listerias corresponding to the channel; b) if the amplification of the gene channel of the sample to be tested does not have a typical amplification curve, or the Ct value is ≥ 37, it is judged that the sample to be tested does not contain the listerias corresponding to the channel; c) if the amplification of the gene channel of the sample to be tested has a typical amplification curve, and 35 < Ct < 37, it is judged as an uncertain sample, and the DNA template amount needs to be appropriately increased for retest.

Citation Information

Patent Citations

  • Dual PCR method for simultaneously detecting Listeria monocytogene and Listeria ivanovii

    CN107988330A