A kit for detecting brown root pathogen, a detection method and application thereof

Abstract

The present invention discloses a kit for detecting brown root pathogen, a detection method and its application, the detection kit includes: amplification primers PnRAA1-5F / PnRAA1-3F or PnRAA2-5F / PnRAA2-3F; a biological probe PnProbe2 for detecting a specific target of brown root pathogen, the kit of the present invention is used to perform constant temperature nucleic acid amplification on the target gene PnEf1 of brown root pathogen, and then combined with a lateral flow chromatography test strip, finally realizing the visual interpretation of the detection result. The visual detection method for detecting brown root pathogen of the present invention has the characteristics of simple operation, rapid detection, low cost, high sensitivity, strong specificity and visualization; the RAA amplification method is combined with the lateral flow chromatography detection method to detect brown root pathogen, which can realize the rapid detection of brown root pathogen in the field or inbound quarantine, and provide a rapid and effective identification method for rapid detection of brown root pathogen and inbound plant quarantine.

Description

Technical Field

[0001] The invention relates to a detection system and a detection method for imported quarantine plant brown root pathogen (Pyrrhoderma noxium), in particular to a detection kit and a detection method for forest brown root pathogen, belonging to the field of biotechnology. Background Art

[0002] Pyrrhoderma noxium, also known as Phellinus noxius, is a pathogen of plant root rot widely distributed in subtropical and tropical regions. It can harm more than 200 species of plants in more than 50 families. It is listed in the List of Quarantine Pests for Plants Entering the Country of my country (List of Quarantine Pests for Plants Entering the Country of the People's Republic of China, updated in April 2021), and is referred to as brown root pathogen in this article.

[0003] Root rot caused by harmful red dermatophytes is a devastating soil-borne disease of plants. It mainly causes necrosis of plant roots and then leads to withering and death of the whole plant. It is commonly known as "forest killer" and "tree cancer". The damage of root rot in my country is showing an increasingly serious trend, causing huge landscape, ecological and economic losses. Root rot in my country mainly harms economic crops, garden plants and ancient trees in Taiwan, Hong Kong and Macao, as well as coastal provinces such as Hainan, Fujian and Guangdong. Surveys in recent years have found that root rot has been widely distributed in coastal areas of Guangdong Province, and has brought devastating damage to some ancient trees in Guangdong Province. The damage is showing an increasingly serious trend, causing huge landscape, ecological and economic losses. Therefore, it is urgent to carry out research on the prevention and control of root rot.

[0004] Through extensive investigations in Guangdong Province and the Macao Special Administrative Region in recent years, it was found that root rot has harmed ancient trees in the coastal areas of Guangdong Province and the Macao Special Administrative Region. Many ancient trees have been harmed and died. The affected ancient tree species include banyan (Ficus microcarpa), banyan (Ficus virens), camphor (Camphora officinarum), hackberry (Celtis sinensis), litchi (Litchi chinensis), longan (Dimocarpus longan), iron holly (Ilex rotunda), kapok (Bombax ceiba), etc. During the investigation, the root rot pathogen, harmful red dermatophyte, was isolated and collected. So far, a total of 16 strains of harmful red dermatophyte have been collected from different locations in Guangdong Province and the Macao Special Administrative Region.

[0005] The current method for identifying brown root rot fungi is to use the quarantine identification method in the current national standard of the People's Republic of China (GB_T 28095-2011), including traditional detection methods and molecular biological detection methods, specifically: according to the symptoms of brown root rot fungi on the host plant, suspicious samples are extracted for pathogen isolation and culture, and the pathogen is identified based on the morphological characteristics, biological characteristics and PCR specific reaction of the pathogen. The traditional root rot fungi detection method mainly relies on symptom identification and tissue isolation of pathogens, but this method is time-consuming, low in sensitivity, labor-intensive and highly professional, and cannot meet the purpose of rapid and easy diagnosis and timely providing a basis for prevention and control.

[0006] Using molecular biology techniques to diagnose diseases can detect pathogens before the plant shows symptoms, achieving rapid and accurate diagnosis. However, traditional molecular biology detection methods based on PCR technology rely on expensive instruments and equipment, have complex steps, and take a long time, making it difficult to meet the needs of rapid on-site detection.

[0007] At present, there are three detection methods for brown root pathogens: monoclonal antibody detection method, gene chip detection method, ITS specific amplification detection method and loop-mediated isothermal amplification detection method (LAMP). The materials required for the monoclonal antibody detection method are difficult to prepare and cannot be applied on a large scale. The gene chip detection method has the advantages of accuracy and large detection volume, but it still cannot do without traditional PCR technology, and the operation is complicated, and the technical level of the detection personnel is high. It is not suitable for large-scale application at the grassroots level and in the field. The ITS specific amplification detection method is also a detection method based on traditional PCR technology, which relies on expensive instruments and equipment, has complex steps, is time-consuming, and is highly professional.

[0008] Isothermal amplification technology (RPA, LAMP, RAA, etc.) can achieve nucleic acid amplification under constant temperature conditions. Compared with traditional PCR technology, it greatly reduces dependence on instruments and equipment, simplifies detection steps, and shortens detection time. Among them: loop-mediated isothermal amplification detection method (LAMP) can be carried out at a constant temperature (60℃~65℃), and the results can be obtained in just 1 hour. It can be combined with dyes so that the results can be judged by the naked eye. The minimum detection limit of DNA in this system is 1pg / μL, which is simple, rapid, efficient, sensitive and economical. However, there is still room for improvement in reaction temperature, reaction time and sensitivity; recombinase-mediated chain replacement nucleic acid amplification technology (recombinase-aided amplification, RAA) is a constant temperature nucleic acid rapid amplification technology. It is a technology that uses recombinases, single-stranded DNA binding proteins and DNA polymerases obtained from cells or fungi to amplify nucleic acids under constant temperature conditions. Under constant temperature conditions (37℃-42℃), recombinases, single-stranded DNA binding proteins and DNA polymerases undergo enzymatic reactions. With the help of template DNA binding proteins, primers open the double-stranded structure of template DNA and form new DNA complementary chains under the action of DNA polymerase, quickly completing unwinding, pairing and extension, and the amplified products grow exponentially.

[0009] RAA technology is easy to operate and can complete molecular-level testing of samples without the need for professional personnel. The test is fast and results can be obtained within 30 minutes. Moreover, the test can be performed at a constant temperature of 37-42°C, without the need for a thermal cycler or other expensive equipment. In addition, the results of RAA amplification products can also be presented in combination with a variety of methods such as gel electrophoresis, real-time fluorescence, and lateral flow chromatography strips. However, gel electrophoresis and real-time fluorescence methods still rely on laboratory instruments and equipment and have certain technical requirements for operators, which is not conducive to the operation of grassroots forestry workers and the rapid detection of pathogens in the field.

[0010] Lateral flow dipstick (LFD) is a fast, simple and inexpensive detection and analysis method. The specific antibodies in the test strip recognize the target antigen in the test solution to produce visible band results, and the test results can usually be obtained within a few minutes. At present, the LFD method is widely used in the detection of various human, animal, plant and other pathogens. However, whether it is traditional PCR detection technology, constant temperature nucleic acid amplification technology such as RAA, or visual detection technology combined with LFD method, the selection of target genes for pathogen detection is crucial. An effective and highly specific pathogen detection target gene determines whether the detection system can be successfully constructed. Therefore, screening specific target genes, specific amplification primers or specific detection probes for pathogens is a prerequisite for the construction of the detection system.

[0011] Effector molecules are key virulence factors secreted by pathogens, which play an important role in regulating the host immune defense response and promoting the infection of pathogens. A large number of studies have found that pathogens usually encode hundreds of effector molecule genes, which participate in the pathogenic process of pathogens through various pathways. In addition, different pathogens usually secrete some species-specific effector molecules in order to achieve their specific pathogenic strategies. Therefore, this type of species-specific effector molecule gene will be an important target resource for pathogen-specific detection and has good development and application potential.

[0012] The invention screens and obtains a brown root pathogen-specific effector molecule gene, named PnEf1, by a bioinformatics method, and takes the effector molecule gene as a target to design RAA primers and specific binding probes, and further designs a rapid detection kit to construct a RAA-LFD (recombinase-aided amplification combined lateral flow dipstick) detection system of brown root pathogen, that is, combining RAA nucleic acid technology with a lateral flow chromatography test strip. The method of the invention firstly performs constant temperature nucleic acid amplification on the target gene by using a RAA kit, and then combines the lateral flow chromatography test strip to finally realize the visual interpretation of the detection result. The brown root pathogen RAA-LFD detection system established by the invention has the advantages of rapidity, sensitivity, specificity, simple operation and the like, can be applied to on-site identification, and is of great significance to the rapid identification of brown root pathogen. Summary of the invention

[0013] The purpose of the present invention is to provide a kit for rapid detection of brown root pathogens based on RAA-LFD technology, a detection method and application thereof, as well as specific effector molecules for detecting brown root pathogens, in view of the technical problems that the existing detection process of brown root pathogens has harsh detection conditions, poor detection sensitivity, long detection time, large detection result errors, etc. The present invention aims to solve the technical problems that the detection conditions are harsh, the detection sensitivity is poor, the detection time is long, the detection result errors are large, etc., and to provide a kit for rapid detection of brown root pathogens based on RAA-LFD technology, a detection method and application thereof, as well as specific effector molecules for detecting brown root pathogens. The detection kit and the detection method of the present invention can be used for rapid detection and identification of brown root pathogens in wild plant growth sites and in imported plant quarantine sites; during the detection process, complex disease identification and a large amount of highly professional work are not required, the identification result is clear, and it can be judged by naked eye visualization; and the method of the present invention has the advantages of rapidity, high sensitivity, strong specificity, simple operation, etc., can be applied to on-site identification, and is of great significance for the rapid identification of brown root pathogens.

[0014] To achieve the purpose of the present invention, on the one hand, the present invention provides a kit for detecting brown root pathogenic bacteria, comprising RAA amplification primers, wherein the RAA amplification primers are PnRAA1-5F / PnRAA1-3F or PnRAA2-5F / PnRAA2-3F; the sequence number of the RAA amplification primers PnRAA1-5F / PnRAA1-3F is SEQ ID NO.4 / SEQ ID NO.5; the sequence number of the RAA amplification primers PnRAA2-5F / PnRAA2-3F is SEQ ID NO.6 / SEQ ID NO.7.

[0015] In particular, the RAA amplification primers are preferably PnRAA2-5F / PnRAA2-3F.

[0016] Particularly, the 5' end of the downstream primer of the RAA amplification primer is labeled with biotin and modified, and is denoted as: PnRAA1-3F-M or PnRAA2-3F-M, preferably PnRAA2-3F-M.

[0017] In particular, the sequence of the downstream primer PnRAA2-3F-M is as follows: Biotin-TGGTATTGTCTCCTAAGGAACAACCTGTCAAGTCA.

[0018] In particular, it also includes a biological probe PnProbe2 for detecting brown root pathogenic bacteria, wherein the sequence number of the biological probe PnProbe2 is SEQ ID NO.8.

[0019] In particular, the 5′ end of the probe is labeled with a FAM group, the 3′ end of the probe is labeled with a blocker modification, and the probe sequence greater than 30 bp is labeled with a tetrahydrofuran (THF) or a tetrahydrofuran derivative, named PnProbe2.

[0020] In particular, the sequence of the biological probe PnProbe2 is as follows: FAM-TTATTCCCTTGCGAGACTGATGACTTGTAC(THF)TCCAATTTATCTGATCT-(C3-Spacer), SEQ ID NO.8.

[0021] Another aspect of the present invention provides a method for detecting brown root pathogenic bacteria, comprising the following steps:

[0022] 1) extracting genomic DNA of brown root pathogenic bacteria to obtain genomic DNA of brown root pathogenic bacteria, which is recorded as Pn-gDNA;

[0023] 2) Using the extracted genomic DNA of brown rhizopus as a template, RAA isothermal amplification was performed using a RAA nucleic acid amplification kit to obtain the RAA amplification product Pn-RAA;

[0024] 3) After diluting the RAA amplification product, insert the lateral flow chromatography nucleic acid test strip into the diluted reaction solution for detection. If:

[0025] 3A) If red bands appear on both the control line (C line) and the test line (T line) in the reading area of ​​the lateral flow chromatography test strip, it indicates that brown root pathogens are present;

[0026] 3B) A red band appears on the control line (C line) in the reading area of ​​the lateral flow chromatography test strip, and the test line (T line) does not show color, which is judged as a negative result and does not contain brown root pathogens.

[0027] Among them, the primers for the RAA isothermal amplification reaction in step 2) are PnRAA1-5F / PnRAA1-3F or PnRAA2-5F / PnRAA2-3F; the sequence number of the RAA amplification primers PnRAA1-5F / PnRAA1-3F is SEQ ID NO.4 / SEQ ID NO.5; the sequence number of the RAA amplification primers PnRAA2-5F / PnRAA2-3F is SEQ ID NO.6 / SEQ ID NO.7.

[0028] In particular, the RAA amplification primers are preferably PnRAA2-5F / PnRAA2-3F.

[0029] Particularly, the 5' end of the downstream primer of the RAA amplification primer is labeled with biotin and modified, and is denoted as: PnRAA1-3F-M or PnRAA2-3F-M, preferably PnRAA2-3F-M.

[0030] In particular, the probe of the RAA isothermal amplification reaction in step 2) is the biological probe PnProbe2 for detecting brown root pathogenic bacteria, wherein the sequence number of the biological probe PnProbe2 is SEQ ID NO.8.

[0031] In particular, the RAA amplification system was configured according to the instructions of the RAA nucleic acid amplification kit (strip method).

[0032] In particular, the RAA isothermal amplification reaction system in step 2) is as follows: RAA amplification primer, biological probe PnProbe2, ddH2O, buffer V, template, and magnesium acetate.

[0033] The RAA amplification reaction also includes a RAA nucleic acid amplification kit.

[0034] RAA nucleic acid amplification kit, buffer V, primer pair PnRAA1-5F / PnRAA1-3F or PnRAA2-5F / PnRAA2-3F, biological probe PnProbe2, purified water, basic reaction unit, magnesium acetate.

[0035] In particular, the basic reaction unit, buffer V, and magnesium acetate are components of the RAA nucleic acid amplification kit.

[0036] In particular, the RAA isothermal amplification reaction described in step 2) is as follows: first, buffer V, RAA amplification primers, probes, and purified water (ddH2O) are placed in a basic reaction unit, mixed by hand and briefly centrifuged to collect the liquid at the bottom of the tube; then, magnesium acetate is added, and after sufficient mixing, templates are added respectively, and after sufficient mixing, the mixture is placed in a metal bath instrument preheated at 37°C for isothermal RAA amplification reaction to obtain RAA amplification products.

[0037] Particularly, the 5' end of the downstream primer of the RAA amplification primer is labeled with biotin.

[0038] In particular, the probe in the RAA amplification reaction is the biological probe PnProbe2, wherein the sequence number of the biological probe PnProbe2 is SEQ ID NO.8.

[0039] In particular, the 5′ end of the probe is labeled with a FAM group, the 3′ end of the probe is labeled with a blocker modification, and the probe sequence greater than 30 bp is labeled with a tetrahydrofuran (THF) or a tetrahydrofuran derivative, named PnProbe2.

[0040] In particular, the nucleic acid detection test paper described in step 3) is a universal nucleic acid detection test paper, wherein the detection line (T line) of the test paper is coated with an anti-Biotin antibody (biotin), and the quality control line (C line) of the test paper is coated with a secondary antibody (sheep anti-mouse and sheep anti-chicken) that can recognize antibodies. The labeled antibodies that are not captured by the T line are bound to the C line.

[0041] Other nucleic acid detection test strips currently known in the art are also applicable to the present invention.

[0042] Another aspect of the present invention provides a use of the above-mentioned kit in detecting brown root pathogenic bacteria.

[0043] In another aspect, the present invention provides an application of a specific effector molecule gene in the detection of brown root pathogen. The specific effector molecule gene is named PnEf1, and its base sequence is SEQ ID NO.3.

[0044] The present invention screens and obtains the specific effector molecule gene PnEf1 for detecting brown root pathogen by bioinformatics methods, and takes it as a target to design RAA amplification primers and specific binding probes, and constructs a RAA-LFD (recombinase-aided amplification combined lateral flow dipstick) detection system for brown root pathogen, that is, a technology combining RAA nucleic acid technology with lateral flow chromatography test strips is used to detect the presence or absence of brown root pathogen. The method of the present invention firstly performs constant temperature nucleic acid amplification on the target gene PnEf1 by using a RAA kit, and then combines the lateral flow chromatography test strip (LFD), and finally realizes the visual interpretation of the detection result.

[0045] The method of the present invention firstly performs constant temperature nucleic acid amplification on the target gene PnEf1 through the RAA kit, and then combines the lateral flow chromatography test strip (LFD) to finally realize the visual interpretation of the detection result. The RAA-LFD detection system of brown root pathogen established by the present invention has the advantages of rapidity, sensitivity, specificity, and simple operation, and can be applied to on-site identification, which is of great significance for the rapid identification of brown root pathogen.

[0046] Compared with the prior art, the present invention has the following beneficial effects:

[0047] 1. The present invention obtains the specific effector molecule gene PnEf1 for detecting brown root pathogen through bioinformatics screening, designs and screens RAA amplification primers and specific binding probes based on the effector molecule gene, and quickly detects brown root pathogen by combining RAA nucleic acid technology with lateral flow chromatography test strips. The primers of the detection kit of the present invention have strong targeting; the detection method using the kit has high specificity.

[0048] 2. The method for detecting brown root pathogen using the brown root pathogen detection kit of the present invention has high sensitivity. The RAA-LFD detection is performed using the gDNA of brown root pathogen as a template. The minimum gDNA concentration detected is 100 fg / μL, and the copy number detected is 5.5 copies / μL. The sensitivity is significantly improved, which is significantly stronger than the existing detection system.

[0049] 3. The brown root pathogen detection kit of the present invention is used to detect brown root pathogen, which has rapid detection, high efficiency and short detection time, and is particularly suitable for on-site rapid detection and identification. The brown root pathogen detection kit of the present invention is carried out in a short time, and reliable detection results can be obtained within 30 minutes, which is particularly suitable for field detection.

[0050] 4. The RAA-LFD rapid detection method constructed by the present invention, which targets the brown root pathogen-specific effector molecule gene PnEf1, is a rapid detection technology with high sensitivity and strong specificity. The entire detection process takes a short time, and the reaction can be completed at a constant temperature of 37-42°C. It is easy to operate and has no equipment requirements, so it can be applied on a large scale at the grassroots level. Moreover, the method of the present invention uses a universal nucleic acid detection test paper to achieve on-site visual detection of brown root pathogens. Compared with the traditional PCR method, it greatly shortens the time, does not require large instruments and professionals, and is particularly suitable for rapid detection in the field. It provides a new technical means for the prevention and control of brown root pathogens.

[0051] 5. The brown root pathogen detection kit of the present invention can be used for on-site real-time detection at wild tree growth and planting sites and entry inspection and quarantine sites. In addition, during the detection process, it is not necessary to use complex large-scale instruments and professional detection personnel. Whether the trees are infected with brown root pathogens can be quickly and accurately obtained. The detection speed is fast, and the detection method has strong sensitivity and specificity. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] Figure 1 It is a screening gel electrophoresis diagram of the amplification primers of the RAA gene of the brown root rot fungus specific effector molecule PnEf1 of the present invention, wherein lane 1 uses the gDNA of the root rot fungus as a template and PnRAA1-5F / PnRAA1-3F as primers; lane 2: uses PnEf1-T-Vector as a template and PnRAA1-5F / PnRAA1-3F as primers; lane 3: uses the gDNA of the root rot fungus as a template and PnRAA2-5F / PnRAA2-3F as primers; lane 4: uses PnEf1-T-Vector as a template and PnRAA2-5F / PnRAA2-3F as primers;

[0053] Figure 2 It is the nucleic acid test paper detection result of the RAA-LFD detection method of brown root pathogen established by the present invention, wherein: 1, 2, 3 are the detection results of RAA-LFD with PnEf1-T-Vector as template ((three replicates), 4: RAA-LFD detection result of negative control group with water as template;

[0054] Figure 3 It is the specific detection result of the RAA-LFD detection method of brown root pathogen of the present invention, wherein: 1: chestnut blight pathogen ((Cp); 2: gloeosporium anthracnose pathogen ((Cg); 3: yamada glutinosa ((Gy); 4: el-o'-green blight pathogen ((Ps); 5: Verticillium dahliae (Vd); 6: poplar rot pathogen (Cc); 7: brown root pathogen (Pn); 8: water (negative control);

[0055] Figure 4The results of the sensitivity test of the RAA-LFD detection method for brown root pathogen of the present invention are shown in Figure 2, wherein the concentrations of the template gDNA are: 1: 100 ng / μL; 2: 100×10 -1 ng / μL; 3: 100×10 -2 ng / μL; 4: 100×10 -3 ng / μL; 5: 100×10 -4 ng / μL; 6: 100×10 -5 ng / μL; 7: 100×10 -6 ng / μL; 8: 100×10 -7 ng / μL; 9: 100×10 -8 ng / μL; 10: water (negative control);

[0056] Figure 5 It is the RAA amplification reaction time screening result of the brown rhizoctonia solani RAA-LFD detection method of the present invention, wherein: 1, 2, 3 are RAA isothermal amplification reactions of 20min; 30min; 40min respectively; 4: water (negative control);

[0057] Figure 6 The actual sample detection results of the RAA-LFD detection method for brown root pathogen of the present invention are shown in the figure, wherein: 1: negative control (water); 2: healthy wood sample 1 (CK1); 3: healthy wood sample 2 (CK2); 4: forest sample (IF) damaged by brown root pathogen. DETAILED DESCRIPTION

[0058] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are exemplary only and do not constitute any limitation to the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the technical solution of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications and replacements all fall within the scope of protection of the present invention.

[0059] Experimental materials, instruments, and reagents

[0060] Test strains: Cryphonectria parasitica (Cp), Colletotrichum gloeosporioides (Cg), Verticillium dahliae (Vd), Cytospora chrysosperma (Cc), Pseudocryphonectriaelaeocarpicola (Ps), and Pyrrhoderma noxium (Pn) used in the present invention are all from the China Forestry Microbiological Culture Collection Center, and the culture collection numbers are: CFCC 52154, CFCC 58729, CFCC 82516, CFCC 89981, CFCC57515, and CFCC 70839;

[0061] Gymnosporangium yamadai (Gy) is a biotrophic strain that cannot be purified and preserved. It can only be collected from the diseased parts of the affected apples in the same year and its DNA extracted. Since Gymnosporangium yamadai has a strong host specificity, the Gymnosporangium yamadai that infects apple leaves was determined to be Gymnosporangium yamadai.

[0062] The gDNA of the above 7 pathogens were extracted by CTAB method; the extracted gDNA of the 7 pathogens were all stored in the Forest Pathology Laboratory of the College of Forestry, Beijing Forestry University.

[0063] Main instruments and reagents:

[0064] PCR instrument, metal bath, centrifuge, handheld centrifuge, agarose gel recovery kit, rapid plasmid extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.);

[0065] PCR Mix reaction solution (ABclonal), SanTaq PCR enzyme (Shanghai Sangon Biotechnology Co., Ltd.);

[0066] pMD19-T-Vector (Takara Biotechnology (Dalian) Co., Ltd.);

[0067] RAA Nucleic Acid Amplification Kit (Test Strip Method) (Jiangsu Qitian Gene Biotechnology Co., Ltd.)

[0068] Universal nucleic acid test strips (Biotin / Fam) set (Jiangsu Qitian Gene Biotechnology Co., Ltd.).

[0069] Example 1 Screening of Brown Rhizoctonia solani-specific effector molecule genes

[0070] 1) Download the genome data of brown rhizoctonia solani from the JGI (Joint Genome Institute) genome database (https: / / mycocosm.jgi.doe.gov / Pheno1 / Pheno1.home.html), extract the exoprotein gene data of brown rhizoctonia solani (including signal peptide), and screen the exoprotein genes of brown rhizoctonia solani based on the p value of signal peptide prediction greater than 0.8;

[0071] 2) Then, the exoprotein genes of brown rhizoctonia solani that have been functionally annotated in the Interpro, KOG and GO databases were removed;

[0072] 3) Then, the general screening criteria for candidate effector molecule genes were used for screening, i.e., the amino acid sequence length was less than or equal to 300 amino acids, rich in cysteine ​​(≥4), did not contain other transmembrane domains (contained only the transmembrane region of the signal peptide), and had no GPI anchor site;

[0073] 4) Finally, the candidate effector molecule genes screened were compared with the NR database of NCBI (National Center for Biotechnology Information) by Blastp, and the brown root pathogen-specific effector molecule gene was obtained and named PnEf1.

[0074] That is, candidate effector molecules are screened out from secreted proteins, and then those with bacterial species specificity are screened out from these candidate effector molecules, and finally the obtained target gene fragment is named PnEf1.

[0075] Through bioinformatics analysis of secreted protein data in the genome of brown rhizoctonia solani, the brown rhizoctonia solani-specific effector molecule gene PnEf1 was screened. The name of PnEf1 in NCBI is hypothetical protein PNOK_0936100 ((Accession number: PAV14808.1), the gene is 931bp long ((SEQ ID NO.3), contains 3 introns, and the protein sequence length is 249aa.

[0076] Example 2 Amplification of Brown Rhizoctonia solani-specific effector molecule gene fragments

[0077] 1. Use a nucleic acid extraction kit (CTAB method) to extract the genomic DNA of brown root pathogen (denoted as Pn-gDNA) and set aside;

[0078] The concentration of the extracted Pn-gDNA was determined using nanodrop200 and stored at -20°C.

[0079] The measurement results showed that the concentration of Pn-gDNA plasmid was 100ng / μL.

[0080] 2. Using the extracted genomic DNA of brown root pathogen as a template, PCR amplification was performed using the Pn1 / Pn2 primer pair; wherein:

[0081] The PCR amplification system is shown in Table 1;

[0082] Table 1 PnEf1 gene fragment PCR amplification system

[0083]

[0084] MIX is a premixed common PCR reaction solution, PCR Mix reaction solution

[0085] Primer Pn1: ATGAGGCCCTATTTCTACCTT;

[0086] Primer Pn2: TTAAAATCCGTCGTCATTGTCG.

[0087] Two-step PCR amplification procedure: pre-denaturation at 98°C for 45s; denaturation at 98°C for 10s, annealing and extension at 72°C for 1min, repeated for 30 cycles; final extension at 72°C for 5min.

[0088] 3. The PCR amplification product was separated by 1% agarose gel electrophoresis to check the target band (931 bp). If the band was correct, the PCR amplification product was recovered and purified using a common agarose gel DNA recovery kit to obtain the full-length gene fragment of brown root pathogen PnEf1 and sequenced (SEQ ID NO.3);

[0089] Example 3 Construction of Brown Rhizoctonia solani-T plasmid (Pn-T plasmid)

[0090] The full-length gene fragment of the purified brown rhizobacterium PnEf1 was connected to the T-vector. The specific operation method and steps were as follows: TM Follow the instructions of 19-T Vector Cloning Kit.

[0091] 1. Mix 2.5 μL of Solution 1, 2 μL of the full-length gene fragment of PnEf1 and pMD TM Add 0.5 μL of 19-T Vector to the PCR tube, centrifuge for 10 seconds to mix, and place in a 16°C metal bath for ligation reaction for 6-12 hours.

[0092] pMD TM 19-T Vector Cloning Kit Kit components: Solution 1 (Solution 1) and pMDTM 19-TVector.

[0093] 2. Add 50 μL of DH5α E. coli competent cells (ABclonal) into the PCR tube and mix well for heat shock transformation. The specific operation method is as follows:

[0094] Place on ice for 30 min, place in a 42°C metal bath for 45 s, place on ice for 5 min, add to 1000 μl of LB liquid culture medium, and incubate in a 37°C shaker for 45 min-1 h.

[0095] Then, the E. coli TA cloning transformation system solution was evenly spread on the plate containing ampicillin resistance (A + ) in LB solid medium, wherein the concentration of ampicillin is 50 mg / mL;

[0096] Then, the cells were inverted and placed in a 37°C constant temperature incubator for cultivation until colonies grew out. A single colony was picked and used as a template. Pn1 / Pn2 was used as a primer pair to perform a single cell PCR reaction. The positive clone strains containing PnEf1-T-Vector were screened by colony PCR.

[0097] Then, the positive clone strain was picked and the plasmid was extracted by shaking using a rapid plasmid extraction kit to obtain the PnEf1-T-vector plasmid, which was recorded as Pn-T plasmid.

[0098] The PnEf1-T-vector was sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing, and the PnEf1-T-vector plasmid with the PnEf1 fragment correctly inserted was obtained and stored in a -20°C refrigerator.

[0099] Example 4 Design of RAA primers for PnEf1 gene and screening of optimal RAA primers

[0100] According to the requirements of primer design of the RAA nucleic acid amplification kit, that is, the length of the RAA amplification product is 100-500 bp and the primer length is 30-35 bp, two pairs of RAA primers were designed for the PnEf1 gene, PnRAA1-5F / PnRAA1-3F and PnRAA2-5F / PnRAA2-3F. The primer information is shown in Table 2.

[0101] Table 2 Primer information used in the present invention

[0102]

[0103]

[0104] In order to evaluate the effect of two pairs of RAA primers, the PnEf1-T-vector prepared in Example 3 and the gDNA of brown rhizoctonia solani extracted in step 1) of Example 2 were used as templates, and PCR amplification was performed using two pairs of RAA primers designed in Table 2. The PCR amplification system (100 μL) was as follows: 2×Mix 50 μL, ddH2O 47 μL, Pn-T plasmid / Pn-gDNA 1 μL, upstream primer 1 μL, downstream primer 1 μL;

[0105] The PCR amplification program was as follows: pre-denaturation at 98°C for 3 min; denaturation at 98°C for 10 s, annealing at 56°C for 10 s, extension at 72°C for 10 s, repeated for 30 cycles; and final extension at 72°C for 5 min.

[0106] The PnEf1-RAA fragment was obtained by PCR amplification, and the PCR amplification product was detected by gel electrophoresis, that is, 2% agarose gel was used for electrophoresis in 1×TAE buffer, 130V, 25min, and the marker was 250bp. The best RAA primer was selected based on whether the target band was amplified and the amplification effect. The electrophoresis detection results are as follows Figure 1 .

[0107] The results showed that both primer pairs PnRAA1-5F / PnRAA1-3F and PnRAA2-5F / PnRAA2-3F could obtain target size bands (about 240bp), but the electrophoresis band effect of the primer pair PnRAA2-5F / PnRAA2-3F was better than that of the primer pair PnRAA1-5F / PnRAA1-3F (the bands were clearer and the dragging was lighter) ( Figure 1 ). Therefore, the present invention selects the PnRAA2-5F / PnRAA2-3F primer pair for subsequent RAA amplification of the PnEf1 gene.

[0108] Example 4 Design of probe for APnEf1 gene RAA amplification

[0109] The detection line (T line) of the lateral flow chromatography test strip used in the present invention is coated with an anti-Biotin antibody (biotin), and the quality control line (C line) is coated with a secondary antibody (sheep anti-mouse, sheep anti-chicken), which can recognize antibodies. The labeled antibodies not captured by the T line are combined with the C line, so that color is developed on the quality control line to ensure the effectiveness of the test strip. The lateral flow chromatography test strip used in the present invention is a conventional test strip known in the art.

[0110] Therefore, in order to be used in conjunction with LFD, the 5' end of the optimal RAA downstream primer obtained through screening needs to be labeled with biotin.

[0111] The anti-biotin antibody coated on the detection line of the lateral flow chromatography test strip combines with the biotin-labeled product obtained by RAA amplification of the present invention to develop color.

[0112] In addition, in order to further improve the specificity of the RAA reaction system, the detection kit of the present invention also designs a special probe that specifically binds to the target gene. The probe length is 46-52bp, the 5′ end of the probe is labeled with a FAM group, the 3′ end of the probe is labeled with a blocker modification, and a tetrahydrofuran (THF) or a tetrahydrofuran derivative is labeled at a position greater than 30bp of the probe sequence, named PnProbe2.

[0113] Since the RAA nucleic acid amplification kit (test paper method) contains nfo exonuclease, it will specifically cut THF or its derivatives to make the blocker modification at the 3' end of the probe ineffective, so that the polymerase can continue to extend and finally amplify an amplification product with both FAM label and Biotin label.

[0114] Therefore, only when the dual-labeled RAA amplification product passes through the lateral flow chromatography test strip and diffuses to the detection line, the biotin-labeled amplification product can be captured by the anti-biotin antibody to form an anti-biotin antibody-nucleic acid nanogold particle complex and develop color at the T line.

[0115] If red strips appear on both the quality control line (C line) and the test line (T line) in the reading area of ​​the lateral flow chromatography test strip, it indicates that brown root pathogenic bacteria are present; if a red strip appears on the quality control line (C line) and the test line (T line) does not show color, it is judged as a negative result and does not contain brown root pathogenic bacteria; if no strips appear on either the quality control line (C line) or the test line (T line), it indicates that the test strip or amplification reagent used may have been damaged, invalid, or operated incorrectly.

[0116] Example 5 Establishment and feasibility analysis of the RAA-LFD detection method for brown root pathogen

[0117] PnRAA2-5F / PnRAA2-3F obtained by screening in Example 4 were used as primers, and the 5' end of the downstream primer PnRAA2-3F for RAA amplification was labeled with biotin; PnProbe2 designed in Example 4A was used as a probe; PnEf1-T-Vector prepared in Example 3 was used as a template, and the target region of the specific effector molecule gene PnEf1 was amplified at a constant temperature using the RAA nucleic acid amplification kit.

[0118] 1. Use PnEf1-T-Vector prepared in Example 3 as template (three replicates) and water as template as negative control. According to the instructions of the RAA nucleic acid amplification kit (test strip method), configure the RAA amplification system (as shown in Table 3), add the reaction solution to the reaction unit (provided in the RAA nucleic acid amplification kit) after sufficient mixing, add 5 μL of magnesium acetate (provided in the RAA nucleic acid amplification kit) to each reaction unit after sufficient dissolution and mixing, and then add 1.5 μL of the template, mix thoroughly, and place in a 37°C metal bath for 40 minutes.

[0119] Table 3 RAA amplification reaction system

[0120]

[0121]

[0122] The specific reactions are as follows:

[0123] First: put buffer V, primer Pn-RAA2-5F, primer Pn-RAA2-3F-M (5' end labeled with biotin), PnProbe2, and purified water into the basic reaction unit, flick to mix, and centrifuge briefly to collect the liquid at the bottom of the tube;

[0124] Next: add 5 μL of magnesium acetate, mix thoroughly, add templates (PnEf1-T-Vector or water), mix thoroughly, and place in a metal bath preheated at 37°C for isothermal RAA amplification reaction for 40 minutes to obtain RAA amplification products;

[0125] 2. After the RAA amplification reaction is completed, the RAA amplification product is diluted 10 times with PBS buffer (i.e., 5 μL of the amplification product is added to 45 μL of PBS), and then the universal nucleic acid detection paper strip is inserted into the diluted reaction solution for detection. If the sample using PnEf1-T-vector as a template shows both C line and T line, while the negative control using water as a template only shows C line and no T line, it indicates that the detection method is feasible.

[0126] The nucleic acid test results are as follows Figure 2 The results showed that the universal nucleic acid test strips of the test samples using PnEf1-T-Vector as the template showed obvious T lines and C lines, while the negative control group showed no T lines but only C lines. The above results indicated that the RAA-LFD rapid detection system for brown root pathogens was successfully established in this study.

[0127] Example 6 Specificity Analysis of RAA-LFD Detection Method for Brown Rhizoctonia solani

[0128] 1. Nucleic acid extraction

[0129] The gDNA of pathogens of brown root pathogen, chestnut blight pathogen (Cryphonectriaparasitica), gloletotrichum gloeosporioides, Yamada balm rust (Gymnosporangium yamadai), Elaeocarpic blight pathogen (Pseudocryphonectria elaeocarpicola), Verticillium dahliae and poplar rot pathogen (Cytospora chrysosperma) were extracted by nucleic acid extraction kit (CTAB method), and marked as PE, Cp, Cg, Gy, Ps, Vd, Cc-gDNA respectively;

[0130] 2. RAA isothermal amplification reaction

[0131] Using the pathogen gDNA of brown root pathogen (Pn), chestnut blight pathogen, gloeosporium anthracnose pathogen, Yamada glue rust, Elaeocarp blight pathogen, Verticillium dahliae and poplar rot pathogen as template, the RAA nucleic acid amplification kit was used to perform RAA amplification on the pathogen gDNA of brown root pathogen, chestnut blight pathogen, gloeosporium anthracnose pathogen, Yamada glue rust, Elaeocarp blight pathogen, Verticillium dahliae and poplar rot pathogen, and the RAA amplification reaction products of the seven pathogens were obtained respectively (respectively labeled as Pn-RAA, Cp-RAA, Cg-RAA, Gy-RAA, Ps-RAA, Vd-RAA, Cc-RAA), wherein: the primers, amplification system and reaction conditions are the same as those in Example 5.

[0132] The RAA amplification product of each sample was diluted 10 times (i.e., 5 μL of the amplification product was added to 45 μL of PBS), and then the universal nucleic acid detection test strip was inserted into the diluted reaction solution for detection to evaluate the specificity of the RAA-LFD detection method for brown root pathogens. The test results are shown in Figure 2. Figure 3 .

[0133] Water was used as a negative control.

[0134] The above results show that the RAA-LFD detection method for brown root pathogen established in this study has good specificity. Only the reaction samples with brown root pathogen ((Pn) gDNA as template showed obvious T line and C line after the universal nucleic acid test strip, while the reaction samples with gDNA of other pathogens as templates showed only C line but no T line after the universal nucleic acid test strip like the negative control, indicating that the RAA-LFD detection system for brown root pathogen of the present invention has good specificity.

[0135] Example 7 Sensitivity Analysis of RAA-LFD Detection Method for Brown Rhizoctonia solani

[0136] Sensitivity is one of the important evaluation indicators for rapid detection of pathogens.

[0137] The gDNA of brown root pathogen extracted in Example 2 was used as a template, and the concentration of the gDNA stock solution of brown root pathogen was determined by a spectrophotometer nanodrop200. The concentration of the Pn-gDNA stock solution was 100 ng / μL, and the copy number was calculated. Eight groups were serially diluted in a 10-fold gradient.

[0138] 1) The gDNA concentration of the brown root pathogen extracted in step 1) of Example 2 was measured using a spectrophotometer nanodrop200, and the copy number was calculated. Then, 8 groups of gDNA were diluted in a 10-fold gradient to obtain 1×10 -6 ~100ng / μL, a total of 9 groups of brown rhizopus pathogen gDNA test samples (i.e., serial dilution solutions of Pn-gDNA);

[0139] 2) using the diluted gDNA of brown rhizopus as a template, and taking 1.5 μL of each, respectively, to perform RAA isothermal amplification, wherein the RAA isothermal amplification system is configured according to Table 3 of Example 5;

[0140] Then, the RAA amplification reaction was carried out according to the amplification reaction conditions described in Example 5. After the isothermal amplification reaction was completed, each reaction solution was diluted 10 times and inserted into a universal nucleic acid detection test strip for visual detection. The detection results were as follows: Figure 4 .

[0141] The sensitivity of the detection kit of the present invention was analyzed, and the maximum dilution multiple sample that can simultaneously show the T line and the C line is the minimum effective concentration of the RAA-LFD detection system using the gDNA of brown rhizoctonia solani as a template.

[0142] The results showed that when the dilution factor was 10 -4 When the gDNA concentration is 10 -2 ng / μL, the test strip can show an obvious T line; when the dilution factor is 10 -6 When the gDNA concentration is 10 -4 ng / μL, the test strip can show a shallow T line, the detection limit concentration of gDNA is 100fg / μL, and the detection copy number is 5.5copies / μL ( Figure 4 ).

[0143] The detection results show that the RAA-LFD detection method for brown root pathogen established in the present invention has good sensitivity, the minimum gDNA concentration detected is 100 fg / μL, and the copy number detected is 5.5 copies / μL.

[0144] Example 7A Analysis of the shortest reaction time of the RAA-LFD detection method for brown rhizoctonia solani

[0145] Three groups of gDNA of brown root pathogen extracted in Example 2 were used as templates, and samples were added according to the RAA reaction system and reaction steps of Example 5, and then placed in a 37° C. metal bath, and RAA reactions were performed for 20 min, 30 min, and 40 min, respectively;

[0146] After the reaction, the RAA amplification products were diluted 10 times with PBS buffer (i.e., 5 μL of amplification products were accurately aspirated and added to 45 μL of PBS, diluted 10 times), and then the reaction effects were detected using lateral flow chromatography test strips, that is, the universal nucleic acid detection strips were inserted into the diluted reaction solution for detection. The test results were as follows: Figure 5 .

[0147] The shortest reaction time required for the RAA-LFD detection system of brown root pathogen was determined based on the test results.

[0148] The results showed that obvious T lines could be detected after 20 min, 30 min and 40 min of RAA isothermal amplification reaction, and there was no significant difference in the detection effect. Therefore, in order to shorten the detection time of the RAA-LFD method for brown root rot fungi, the lateral flow chromatography test strips can be used for detection after 20 min of RAA isothermal amplification reaction during the detection of root rot fungi samples.

[0149] Example 8 Actual sample detection

[0150] The RAA-LFD detection method for brown root pathogens established in the present invention has good specificity and sensitivity. In order to evaluate whether the detection method can be applied to the actual sample detection process, gDNA and water (negative control) of healthy forest samples (CK1 and CK2) and forest samples (IF) damaged by brown root pathogens from two different regions were used as templates for actual sample detection.

[0151] 1. DNA extraction

[0152] Healthy trees from two different regions were collected as healthy samples; one tree affected by brown root pathogen was collected as a susceptible sample;

[0153] The gDNA of the samples was extracted by CTAB method (nucleic acid extraction kit), and the gDNA of two healthy samples (denoted as CK1 and CK2) and the gDNA of one infected sample (denoted as IF) were obtained.

[0154] 2. RAA amplification

[0155] RAA amplification was performed using RAA nucleic acid amplification kit (Jiangsu Qitian Gene Biotechnology Co., Ltd.) with CK1, CK2, IF, and water (as a negative control) as templates, respectively. RAA amplification was performed according to the following steps: First, 25 μL of buffer V, 2.1 μL of primer PnRAA2-5F, 2.1 μL of primer PnRAA2-3F-M, 13.7 μL of purified water, and 0.6 μL of probe were placed in the basic reaction unit, mixed by hand and centrifuged briefly; then, 5 μL of magnesium acetate was added and mixed thoroughly, and then templates (1.5 μL each of CK1, CK2, and IF) were added respectively, and after being mixed thoroughly, the mixture was placed in a metal bath instrument preheated at 37°C to perform RAA amplification reaction respectively; then, after 20 minutes of RAA amplification reaction, RAA amplification products were obtained respectively;

[0156] 3. Visual detection

[0157] Each RAA amplification product was diluted 10 times (i.e., 5 μL of amplification product was accurately pipetted into 45 μL of PBS and diluted 10 times), and then the lateral flow chromatography test strip (i.e., universal nucleic acid detection strip) was inserted into each diluted reaction solution for detection. The test results were as follows: Figure 6 .

[0158] The results showed that only the test strips of the reaction solution of the forest sample (IF) damaged by brown root pathogen showed obvious T lines, while the test strips of the reaction solutions of the other three groups of controls showed no T lines ( Figure 6 ).

[0159] The detection results of the reagent samples show that the RAA-LFD detection method for brown rhizoctonia solani established in the present invention has good effect in practical applications.

[0160] The present invention targets the gene PnEf1 specific to brown root pathogen obtained by screening, and utilizes RAA constant temperature amplification technology combined with lateral flow chromatography test strips, i.e., RAA-LFD detection method. The method of the present invention first performs constant temperature nucleic acid amplification of the target, and then integrates lateral flow chromatography technology, and finally realizes rapid visual detection of brown root pathogen. The present invention targets the PnEf1 gene of brown root pathogen, designs RAA primers, and further designs them into a rapid detection kit, which can complete visual detection within 30 minutes, has the advantages of rapidity, sensitivity, specificity, and simple operation, and can be applied to on-site identification, which is of great significance for rapid visual identification of brown root pathogen.

[0161] The above description is only a preferred embodiment of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A kit for detecting brown root pathogen, characterized in that: It includes RAA amplification primers and a biological probe PnProbe2 for detecting brown root pathogenic bacteria, wherein the RAA amplification primers are PnRAA2-5F / PnRAA2-3F; the sequence numbers of the RAA amplification primers PnRAA2-5F / PnRAA2-3F are SEQ ID NO.6 / SEQ ID NO.7; and the sequence number of the biological probe PnProbe2 is SEQ ID NO.

8.

2. The kit according to claim 1, characterized in that: The 5' end of the downstream primer of the RAA amplification primer is labeled with biotin and is denoted as: PnRAA2-3F-M.

3. A method for detecting brown root pathogen, characterized in that: The steps include: 1) extracting genomic DNA of brown root pathogenic bacteria to obtain genomic DNA of brown root pathogenic bacteria, which is recorded as Pn-gDNA; 2) Using the extracted genomic DNA of brown rhizoctonia solani as a template, isothermal amplification is performed using a RAA nucleic acid amplification kit to obtain a RAA amplification product Pn-RAA, wherein: the RAA nucleic acid amplification kit includes RAA amplification primers and a biological probe PnProbe2 for detecting brown rhizoctonia solani, wherein: The RAA amplification primers are PnRAA2-5F / PnRAA2-3F, and the sequence numbers of the primers PnRAA2-5F / PnRAA2-3F are SEQ ID NO.6 / SEQ ID NO.7; The sequence number of the biological probe PnProbe2 is SEQ ID NO.8; 3) After diluting the RAA amplification product, insert the nucleic acid test strip into the diluted reaction solution for detection. If: 3A) If red bands appear on both the control line and the test line in the reading area of ​​the lateral flow chromatography test strip, it indicates that brown root pathogens are present; 3B) A red band appears on the control line in the reading area of ​​the lateral flow chromatography test strip, and the detection line does not show color, which is judged as a negative result and does not contain brown root pathogens.

4. The method according to claim 3, characterized in that: The 5' end of the downstream primer of the RAA amplification primer is labeled with biotin and is denoted as: PnRAA2-3F-M.

5. Use of the kit as claimed in claim 1 or 2 in detecting brown root pathogenic bacteria.

Images