Detection system, kit and method for detecting grape leafroll virus-3 based on RT-RAA and CRISPR / Cas13a

Abstract

The present invention belongs to the field of virus detection technology and relates to a detection system, kit, and method for detecting grape leafroll virus-3 based on RT-RAA and CRISPR / Cas13a. The detection system comprises independently packaged RAA isothermal amplification systems and CRISPR / Cas13a-LFD detection systems. The RAA isothermal amplification system includes RAA primer pairs designed based on the nucleic acid of grape leafroll virus-3, and the CRISPR / Cas13a-LFD detection system includes crRNA designed based on the nucleic acid of grape leafroll virus-3. This detection system achieves the purpose of simple, efficient, and visual detection of grape leafroll virus, with high sensitivity, accuracy, and specificity.

Description

Technical Field

[0001] The present invention belongs to the technical field of virus detection and relates to a detection system, a kit and a detection method for grape leafroll virus-3 based on RT-RAA and CRISPR / Cas13a. Background Art

[0002] Grapevine viral diseases are a major factor impacting the sustainable development of the grape industry. Grapevine leafroll is a serious viral disease that occurs extensively in grape-producing regions worldwide (Naidue et al. 2014). To date, 11 different serotypes of grapevine leafroll viruses have been reported worldwide, namely GLRaV-1, -2, -3, -4, -5, -6, -7, -8, -9, -Pr, -De, and -Car (Naidue et al. 2015). GLRaV-3 is the most important and widespread grapevine leafroll virus worldwide and is considered the virus most closely associated with leafroll (Naidue et al. 2014, 2015). Grapevine leafroll virus reduces vine vigor and height, delays bud break (Cuie et al. 2016; Markovi et al. 2014; Naidu et al. 2015), and delays grape ripening (Montereo et al. 2016; Naidu et al. 2015). It also causes poor bunch coloring and significantly reduces fruit sugar content (Montereo et al. 2016), soluble amino acids (Alabi et al. 2016; Montero et al. 2016), organic acids (Alabi et al. 2016), anthocyanins, and total phenolics (Lee and Martin 2009; Vega et al. 2011). Consequently, it significantly reduces fruit quality and can cause economic losses of US$25,000–40,000 per hectare, accounting for over 75% of an orchard's net income (Atallah et al. 2011). Grapevines primarily reproduce asexually, a method that allows viruses to accumulate in large quantities within the plant and be transmitted from generation to generation (Németh 1984). Unlike other fungal and bacterial diseases, once a plant is infected by a virus, it is difficult to eradicate it with chemical methods (Martelli 2012). Therefore, the application of reliable and appropriate virus detection methods is extremely important for controlling grapevine viruses.

[0003] Currently, the main methods for detecting grapevine leafroll virus-3 include indicator plant methods, serological identification, and nucleic acid detection. The indicator plant method is complex and time-consuming, making it unsuitable for rapid on-site diagnosis. Serological identification, primarily used for rapid screening of plant materials, involves the enzyme-linked immunosorbent assay (ELISA, Clark and Adams 1977), the most widely used virus detection technique. However, comparative analysis has shown that its sensitivity is lower than that of molecular methods such as RT-PCR (Fayeke et al. 2009; Youssef et al. 2009). Typically, ELISA detection of non-toxic materials requires retesting with RT-PCR (Panatton et al. 2011). RT-PCR is the most commonly used molecular diagnostic method and the current gold standard for nucleic acid detection. However, this method requires expensive equipment and specialized personnel, and generally takes 2-3 hours. Therefore, it lacks the advantages of rapidity and portability, and cannot meet the key requirements for rapid on-site testing.

[0004] CRISPR-Cas (Clustered regularly interspaced short palindromic repeats, CRISPRs) is an adaptive immune defense system that evolved over long periods of time in bacteria and archaea, combating invading phages and foreign genetic material. Cas proteins, guided by RNA, can target and degrade foreign target nucleic acids. The CRISPR-Cas9 protein family has been widely applied in numerous fields, including gene editing, antiviral agents, and bioimaging. CRISPR-Cas13a belongs to the sixth family of Cas enzymes. The CRISPR / Cas13a system uses crRNA (guide RNA) to recognize specific target RNA sequences. The specific recognition process is as follows:

[0005] Recognition and binding of pre-crRNA: The newly transcribed pre-crRNA recognizes and binds to the rec lobe of Cas13a through its 5' end stem-loop structure, forming an intermediate transition state of the pre-crRNA and Cas13a complex;

[0006] Formation of mature crRNA: The conformation of the conserved residues between the helical-1 and hepn2 domains in the nuc region changes, forming an acid-base catalytic center that catalyzes the cleavage of pre-crRNA to form mature crRNA. At this time, the crRNA-Cas13a complex is in an inactive state.

[0007] Activation of the enzymatic cleavage activity of the crRNA-Cas13 complex: When the target ssRNA (single-stranded RNA) enters the crRNA-Cas13a complex and forms base-complementary pairing with the crRNA, it induces a conformational change in Cas13a, thereby activating the enzymatic cleavage activity of the crRNA-Cas13a complex;

[0008] Degradation of target RNA: Under the guidance of crRNA, the hepn domain of Cas13a catalyzes the enzymatic cleavage of target ssRNA.

[0009] The core of the technology is: Based on the target sequence, researchers need to design a guide RNA probe (crRNA) that can target the target sequence. If the guide RNA recognizes the specific sequence, the Cas13a nuclease can be activated. Once the Cas13a nuclease is activated and has RNA enzyme activity, it will function to cut off the special RNA reporter molecule, which will appear as a band on the nucleic acid test strip dedicated to the Cas system. The presence or absence of the target sequence can be easily confirmed by the different positions of the bands.

[0010] At present, there are no reports on the application of CRISPR / Cas13a detection technology to the detection of grape leafroll virus-3. Summary of the Invention

[0011] The present invention aims to provide a detection system and kit for detecting grapevine leafroll virus-3 based on RT-RAA and CRISPR / Cas13a. The detection system and kit designed based on the characteristics of CRISPR / Cas13a are used to detect grapevine leafroll virus-3 and have the advantages of rapid detection, high sensitivity and high specificity.

[0012] The present invention also aims to provide a detection method for grape leaf roll virus-3 based on RT-RAA and CRISPR / Cas13a, in which isothermal amplification primers and specific probes are designed by obtaining specific sequence fragments of grape leaf roll virus-3. The detection test uses the isothermal amplification product as a template, and uses Cas13a nuclease and a prepared specific RNA probe to perform an enzyme digestion reaction. The reaction product is diluted and loaded onto a lateral flow test strip, and the band changes of the test strip are observed to achieve the purpose of rapid detection.

[0013] The technical solution of the present invention for solving the above-mentioned technical problems is as follows.

[0014] A detection system for grape leafroll virus-3 based on RT-RAA and CRISPR / Cas13a, comprising an independently packaged RAA isothermal amplification system and a CRISPR / Cas13a-LFD detection system; wherein the RAA isothermal amplification system comprises an RAA primer pair designed based on grape leafroll virus-3 nucleic acid, the RAA primer pair comprising an upstream primer GLRaV-3-RAA-F and a downstream primer GLRaV-3-RAA-R, the sequences of which are as follows:

[0015] GLRaV-3-RAA-F:

[0016] GAAATTAATACGACTCACTATAGGGTGCTCTAGTTAAGGTCAGGAGTGATGTGGC; the nucleotide sequence is shown in SEQ ID NO.1;

[0017] GLRaV-3-RAA-R:

[0018] CTCGTCCGTTAGCGTATTCGTTAAAGTGTC; the nucleotide sequence is shown in SEQ ID NO.2;

[0019] Among them, GAAATTAATACGACTCACTATAGGG is the T7 promoter sequence;

[0020] The CRISPR / Cas13a-LFD detection system includes a crRNA designed based on the nucleic acid of grape leafroll virus-3. The nucleotide sequence of the crRNA is as follows:

[0021] crRNA: GAAATTAATACGACTCACTATAGGGGATTTAGACTACCCCAAAAACGAAGGGGACTAAAACTAAACCTTAGCCCCACAAGCCACCGAAC; the nucleotide sequence is shown in SEQ ID NO.3;

[0022] Among them, GAAATTAATACGACTCACTATAGGG is the T7 promoter sequence; GATTTAGACTACCCCAAAAACGAAGGGGACTAAAAC is the common sequence of the cas13a hairpin structure.

[0023] Furthermore, the detection system is used to detect grape leafroll virus-3.

[0024] A kit for detecting grapevine leafroll virus-3 based on RT-RAA and CRISPR / Cas13a, comprising the above-mentioned detection system for detecting grapevine leafroll virus-3 based on RT-RAA and CRISPR / Cas13a.

[0025] Furthermore, the kit also includes Cas13a protein and a reagent or kit for RAA amplification.

[0026] Furthermore, the kit is used to detect grape leafroll virus-3.

[0027] A method for detecting grape leafroll virus-3 using the above kit comprises the following steps:

[0028] S1. Extract grape leafroll virus-3 cDNA as a template and perform RAA amplification using the primer pair consisting of the upstream primer GLRaV-3-RAA-F and the downstream primer GLRaV-3-RAA-R of the above kit;

[0029] S2. The RAA amplified product was added to the CRISPR-Cas13a system for incubation; the CRISPR-Cas13a system includes the specific crRNA in the above kit;

[0030] S3. Detect the incubation products of CRISPR-Cas13a using LFD.

[0031] Furthermore, in step S1, the RAA amplification system includes the following reagents and amounts: 25 μL of basic buffer, 2.1 μL of upstream primer and downstream primer each, 2 μL of cDNA template, 5 μL of magnesium acetate solution (280 nM), and purified water to 50 μL; wherein, the concentrations of the upstream primer and downstream primer are both 10 μmol / L, and the concentration of the cDNA template is 100 μg / mL.

[0032] Furthermore, in step S1, during RAA amplification, the reaction tube containing the reactants was placed in a metal bath, incubated at 40°C for 4 minutes, and then taken out. The reaction solution was further mixed and incubated at 40°C for another 26 minutes.

[0033] Furthermore, in step S2, the CRISPR-Cas13a system includes the following reagents and amounts: using LwCas13a nuclease 4μl (45nM), crRNA probe 2μl (22.5nM), FB-RNA reporter molecule 2μl (125nM), RNase inhibitor (2μl), NTP buffer mix (25mmol / L) 4μL, and T7 polymerase (1μl), using detection buffer to supplement to 19μl, and adding 1μl of the amplification product of step S1 for incubation; after diluting the detection product 10 times with lateral flow test strip diluent, load it onto the lateral flow test strip, let it stand for 3-5min, and observe the results.

[0034] Furthermore, in step S2, the incubation temperature is 37° C. and the incubation time is 40 min.

[0035] The above-mentioned preferred reaction conditions can further improve the detection efficiency of grape leafroll virus-3.

[0036] Furthermore, in step S3, when the CRISPR-Cas13a incubation product is detected using LFD, a positive result is: both the test line and the control line are displayed or only the test line is developed; a negative result is: only the control line is visible; an invalid result is: neither the test line nor the control line appears.

[0037] The beneficial effects of the detection system, kit and method for detecting grape leafroll virus-3 based on RT-RAA and CRISPR / Cas13a of the present invention are that specific crRNA and RAA primers are designed according to the relatively conserved sequence of grape leafroll virus, and a detection method for grape leafroll virus is established. When crRNA recognizes the target sequence, it activates Cas13a protein to cut the reporter probe, and then a lateral flow test strip (LFD) is used to read the test results, thereby achieving the purpose of simple, efficient and visual detection of grape leafroll virus; the RAA-CRISPR / Cas13a-LFD method provided by the present invention can be rapidly amplified under the conditions of 37°C and 40 minutes, and the reporter probe is converted into amplified protein. The test result can be observed within 3-5 minutes after the product is added to the test strip, that is, the test result can be determined by visual observation through LFD; this method has high sensitivity, with a minimum detection limit of up to 1 copies / μL, and high accuracy; compared with conventional PCR, this method has the advantages of no power supply restrictions on the detection instrument, shorter detection time and faster detection, and realizes rapid nucleic acid amplification detection under non-laboratory conditions, providing reliable protection for grape leaf roll virus and epidemiological surveys; this method has good specificity and can specifically detect the presence of multiple GLRaVs, with no cross-reaction with grape fan leaf virus (GLFV) and grape spot virus (GFkV); this method has good repeatability and stability and can be promoted and applied in practice. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 This is the peak diagram of the GLRaV-3 Primer1 amplification product in Example 1;

[0039] Figure 2 This is the peak diagram of the GLRaV-3 Primer2 amplification product in Example 1;

[0040] Figure 3 This is the peak diagram of the GLRaV-3 Primer3 amplification product in Example 1;

[0041] Figure 4This is the peak diagram of the GLRaV-3 Primer4 amplification product in Example 1;

[0042] Figure 5 This is the peak diagram of the GLRaV-3 Primer5 amplification product in Example 1;

[0043] Figure 6 This is the test result of the gene editing system of combination 1-7;

[0044] Figure 7 The results of the 7 primer-probe combination system for GLRaV-3 were verified;

[0045] Figure 8 This is the sensitivity detection result of GLRaV-3 Primer5+crRNA1-5 (Lateral Flow Detection);

[0046] Figure 9 This is the sensitivity detection result of GLRaV-3 Primer5+crRNA1-5 (Fluorescence Detection);

[0047] Figure 10 This is the sensitivity detection result of GLRaV-3 Primer4+crRNA3-4 (Lateral Flow Detection);

[0048] Figure 11 This is a schematic diagram for interpreting LFD test results;

[0049] Figure 12 This is the result of PCR reaction sensitivity test;

[0050] Figure 13 This is the sensitivity detection result of GLRaV-3 Primer4+crRNA3-4 (Lateral Flow Detection);

[0051] Figure 14 This is the sensitivity detection result of GLRaV-3 Primer4+crRNA3-4 (FluorescenceDetection);

[0052] Figure 15 GLRaV-3 Primer4+crRNA3-4 specific detection results (Lateral Flow Detection);

[0053] Figure 16 GLRaV-3 Primer4+crRNA3-4 specific detection results (Fluorescence Detection); DETAILED DESCRIPTION Example

[0054] 1. Materials and Methods

[0055] 1.1 Virus samples and kits

[0056] Grape leafroll virus-3 (GLRaV-3), grape fan leaf virus (GLFV), and grape spot virus (GFkV) were all detected, isolated, identified, and then preserved in our laboratory.

[0057] The viral RNA extraction kit and plasmid mini-extraction kit were purchased from Tiangen Biochemical Technology Co., Ltd., DH5α competent cells were purchased from Beijing Bomade Gene Technology Co., Ltd.; the column-type RNA rapid concentration and purification kit and the San Prep column-type DNA gel recovery kit were purchased from Shanghai Sangon Bioengineering Co., Ltd.; the RAA nucleic acid amplification kit was purchased from Jiangsu Qitian Gene Biotechnology Co., Ltd.; TB Green Premix Ex Taq TMⅡ (Tli RNase H Plus) (2X), T-Vectorp MDTM 19 vector, and RNase Inhibitor were purchased from Ta Ka Ra; NTP buffer mix, T7 RNA polymerase mix, and Standard Taq buffer (10×) were purchased from New England Biolabs; HEPES was purchased from Solarbio; MgCl2 was purchased from Coolaber; RNA FAM and Biotin dual-labeled probes and Cas12 / Cas13a detection strips were purchased from Guangzhou Bolais Technology Biological Co., Ltd.; and Cas13a protein was purchased from Meige Biotechnology.

[0058] 1.2 Nucleic acid extraction

[0059] With reference to the method of Gambino et al. (2008), RNA was extracted from leaves infected with Grape Leaf Roll Virus-3, Grape Fan Leaf Virus (GLFV), Grapevine Virus A (GVA), Grapevine Virus B (GVB), and Grapevine Spot Virus (GFkV) using the CTAB method.

[0060] The specific steps are as follows:

[0061] (1) Grind the leaf tissue in liquid nitrogen until it is powdery, and take 0.1 g of the sample into a 2 mL enzyme-free centrifuge tube containing 600 μL of C TAAB and 40 μL of a thiol reducing agent mixture;

[0062] (2) Incubate in a 65°C water bath for 10 min, shaking upside down 2-3 times;

[0063] (3) Add 600 μL of chloroform-isoamyl alcohol, mix well, and centrifuge at 11,000 rpm and 4°C for 10 min;

[0064] (4) Aspirate 500 μL of supernatant, add 500 μL of chloroform-isoamyl alcohol, mix well, and centrifuge at 11000 rpm and 4°C for 10 min;

[0065] (5) Aspirate 400 μL of supernatant, add 200 μL of 6 M lithium chloride, and precipitate at -20°C for 2 h;

[0066] (6) Centrifugation at 12000 rpm, 4°C for 10 min;

[0067] (7) Discard the supernatant, add 500 μL of 75% ethanol to wash the precipitate, and centrifuge at 11,000 rpm for 30 s at 4°C;

[0068] (8) Discard the supernatant, add 400 μL of anhydrous ethanol to wash the precipitate, and centrifuge at 11,000 rpm for 30 s at 4°C;

[0069] (9) Aspirate the anhydrous ethanol and let the centrifuge tube mouth dry for 5 minutes;

[0070] (10) Add 30 μL of RNase-free water to dissolve the RNA.

[0071] The concentration and purity of the extracted RNA were determined using an ultra-micro UV spectrophotometer, and the integrity of the extracted RNA was detected by 1% agarose gel electrophoresis. RNA of qualified quality was stored at -80°C until use.

[0072] 1.3 cDNA synthesis

[0073] The extracted RNA was used as a template to synthesize the first-strand cDNA using the HiScript II Q RT SuperMix for qPCR (+gDNA wiper) kit.

[0074] The specific steps are as follows:

[0075] (1) Genomic DNA removal;

[0076] In an RNase-free centrifuge tube, add 1 μg RNA template, 4 μL 4×g DNA wiper mix, and RNase-free ddH2O to a volume of 16 μL, then pipette to mix thoroughly; incubate at 42°C for 2 min.

[0077] (2) Preparation of reverse transcription reaction system;

[0078] Add 4µl of 5×HiScript II qRT Super Mix II to the reaction mixture in step 1 and mix thoroughly by pipetting.

[0079] (3) Reverse transcription reaction;

[0080] Incubate at 50°C for 15 min; inactivate at 85°C for 5 s.

[0081] After reverse transcription, the cDNA product was stored at -20°C until use.

[0082] 1.4 RAA primer design and crRNA design

[0083] Primers were designed using NCBI Primer BLAST with default parameters: amplicon size (100-300 nt), primer annealing temperature (54°C-67°C), primer size (30-35 nt), and 5 primer pairs for DNA sequence synthesis.

[0084] Five pairs of specific RAA primers were designed based on the coat protein gene sequence of GLRaV-3.

[0085] Among them, the primer sequences designed by adding the T7 RNA polymerase initiation sequence (GAAATTAATACGACTCACTATAGGG) to the 5' end of the upstream primer are shown in the following table:

[0086] Name Sequence (5' to 3') GLRaV-3-F1 GAAATTAATACGACTCACTATAGGGTAGTCCAATACCCTGTTCATATACTCATAG (SEQ ID NO.4) GLRaV-3-1R+5R GTACCAGATATTCATTCTTTACTTCCTCAC (SEQ ID NO.5) GLRaV-3-F2 GAAATTAATACGACTCACTATAGGGGTTGTGGGGCTAAGGTTTACTGCGATATTTTGG (SEQ ID NO.6) GLRaV-3-R2 ATAACAGACACCGTTCCGTCCGTGGAGAGATT (SEQ ID NO.7) GLRaV-3-F3 GAAATTAATACGACTCACTATAGGGCTAGGGCTGTGGAAGTATTCAAAACTGGTCT (SEQ ID NO.8) GLRaV-3-R3 TACCTCGTCCGTTAGCGTATTCGTTAAAGTG (SEQ ID NO.9) GLRaV-3-F4 GAAATTAATACGACTCACTATAGGGTGCTCTAGTTAAGGTCAGGAGTGATGTGGC (SEQ ID NO.1) GLRaV-3-R4 CTCGTCCGTTAGCGTATTCGTTAAAGTGTC (SEQ ID NO.2) GLRaV-3-F5 GAAATTAATACGACTCACTATAGGGTATATTTGAAGGGGAGAATAACAGAGCTTTTC (SEQ ID NO.10)

[0087] In the above table, GLRaV-3-1R+5R means that this primer can be used as the downstream primer of Primer1 and Primer5.

[0088] The crRNA sequences are shown in the following table:

[0089] Name Sequence (5' to 3') crRNA1-5 GAAATTAATACGACTCACTATAGGGGATTTAGACTACCCCAAAAACGAAGGGGAC TAAAACCAGACACCGTTCCGTCCGTGGAGAGATT (SEQ ID NO.11) crRNA3-4 GAAATTAATACGACTCACTATAGGGGATTTAGACTACCCCAAAAACGAAGGGGAC TAAAACTAAACCTTAGCCCCACAAGCCACCGAAC (SEQ ID NO.12) crRNA4-3 GAAATTAATACGACTCACTATAGGGGATTTAGACTACCCCAAAAACGAAGGGGAC TAAAACAGCCTCAGTCCGCTATTACCTGCCAAAA(SEQ ID NO.13) crRNA2 GAAATTAATACGACTCACTATAGGGGATTTAGACTACCCCAAAAACGAAGGGGAC TAAAACATCTCCACCACCCACTGTGTATCTATGA(SEQ ID NO.14)

[0090] Among them, GAAATTAATACGACTCACTATAGGG is the T7 promoter sequence; GATTTAGACTACCCCAAAAACGAAGGGGACTAAAAC is the universal sequence of the Cas13a hairpin structure. crRNA1-5 indicates that the crRNA probe can be used for Primer1 and Primer5; similarly, crRNA3-4 and crRNA4-3 indicate that the crRNA probe can be used for Primer3 and Primer4.

[0091] Primers and crRNA were synthesized and labeled by Shanghai Sangon Biotechnology Co., Ltd.

[0092] crRNA preparation: Synthesized DNA probes (crRNA sequences) were prepared by in vitro transcription. When designing the probes, attention was paid to the inclusion of a T7 promoter sequence at the 5' end. The two DNA strands were annealed to form a double-stranded structure at a final concentration of 10 μM. In vitro transcription was performed using the Hi Scribe T7Quick High Yield RNA Synthesis kit (New England Biolabs). The transcription product (crRNA probe) was purified using RNAXP magnetic beads, and the product concentration was determined using a Qubit assay.

[0093] RAA amplification was performed using GLRaV-3 cDNA as a template. The reaction system was 50 μL, including 25.0 μL of buffer, 13.8 μL of purified water, 2.1 μL of upstream primer (10 μM), 2.1 μL of downstream primer (10 μM), 2 μL of DNA template (100 μg / mL), and 94.6 μL of magnesium acetate. Amplification was performed at 37°C for 30 min.

[0094] The amplification products were detected by Q-sep100, and the peaks of the amplification products of the five primer pairs were as follows: Figure 1-Figure 5 shown.

[0095] The results of the amplification products of the five primer pairs using the Qsep100 bioanalyzer are shown in the following table.

[0096] Primer pair name Fragment size bp Theoretical fragment size bp Target product concentration ng / ul GLRaV-3 Primer1 242 236 3.04 GLRaV-3 Primer2 372 324 1.88 GLRaV-3 Primer3 301 263 1.08 GLRaV-3 Primer4 183 178 1.28 GLRaV-3 Primer5 179 173 1.41

[0097] Qsep analysis revealed that the fragment sizes of the GLRaV-3 Primers 1, 4, and 5 amplification products were generally consistent with theoretical sizes, meeting expectations. The fragment sizes of Primers 2 and 3 were slightly larger than theoretical sizes, but within the instrument's detection tolerance. The peak shape of Primer 3 was not a single peak but a smear pattern, which was inconsistent with expectations. The total amount of amplification product from all five primer pairs met the requirements of subsequent experiments.

[0098] Next, the detection system was tested. Specifically, the detection system verified that the number of template plasmid copies was 8.68*10 9 copies / ul (plasmid stock solution); primer dosage: 240pM; RAA time: 40min; test strip test results as follows Figure 6 and Figure 7 As shown. Among them, Figure 6 This is the test result of the combination 1-7 gene editing system (Lateral Flow Detection). ZL represents plasmid; NTC represents negative quality control. Figure 7 Verification results of the GLRaV-3 7-primer-probe combination system (Fluorescence Detection).

[0099] Seven primer-probe combinations were validated. Both the dipstick and fluorescence assays showed that the Primer2 + crRNA2 combination failed validation, while all other combinations passed. Combining the dipstick and fluorescence assay results confirmed that Primer4 + crRNA3-4 was the optimal combination. The RAA amplification peak pattern of Primer 3 did not meet expectations, so the Primer3 combination was eliminated. Comparing the Primer1 and Primer5 combinations, fluorescence assays showed that the Primer5 + crRNA1-5 combination was preferred.

[0100] The sensitivity of the Primer5+crRNA1-5 combination and the Primer4+crRNA3-4 combination were tested using the test strip method and fluorescence method, respectively. Experimental conditions: RAA amplification system primer dosage 240pM; amplification time 40min; DNA template: plasmid copy number 10 8 , 10 7 , 10 6 , 10 5 , 10 4 , 10 3 , 10 2 , 10, 1 copies / ul; template input amount: 1ul.

[0101] GLRaV-3 Primer5+crRNA1-5 sensitivity detection results (Lateral Flow Detection) are as follows Figure 8 , GLRaV-3 Primer5+crRNA1-5 sensitivity detection results (Fluorescence Detection) are as follows Figure 9 As shown: The results showed that the primer and probe combination of GLRaV-3 Primer5+crRNA1-5: the lower limit of plasmid copy number detection by the test strip method and fluorescence method was 10 copies / ul.

[0102] GLRaV-3 Primer4+crRNA3-4 sensitivity detection results (Lateral Flow Detection) are as follows Figure 10 As shown; the results showed that the GLRaV-3 Primer4+crRNA3-4 combination, the test strip method can detect the lower limit of plasmid copy number is 10 copies / ul.

[0103] The above results show that the plasmids were diluted to 10 8 , 10 7 , 10 6 , 10 5 , 10 4 , 103 , 10 2 , 10, and 1 copies / ul. The two pairs of primer-probe combinations were tested for sensitivity using the test strip method and fluorescence method respectively. Among them, the combination of Primer4+crRNA3-4 had the highest sensitivity, and the detection limit could reach 1 copies / ul; the detection limit of the Primer5+crRNA1-5 combination could reach 10 copies / ul, and the sensitivity was poor.

[0104] Therefore, Primer4+crRNA3-4 is the optimal primer combination, that is, the sequences of Primer4 upstream primer GLRaV-3-RAA-F and downstream primer GLRaV-3-RAA-R are as follows.

[0105] GLRaV-3-RAA-F:GAAATTAATACGACTCACTATAGGGTGCTCTAGTTAAGGTCAGGAGTGATGTGGC;

[0106] GLRaV-3-RAA-R: CTCGTCCGTAGCGTATTCGTTAAAGTGTC;

[0107] Among them, GAAATTAATACGACTCACTATAGGG is the T7 promoter sequence.

[0108] The crRNA3-4 sequence is as follows: GAAATTAATACGACTCACTATAGGGGATTTAGACTACCCCAAAAACGAAGGGGACTAAAACTAAACCTTAGCCCCACAAGCCACCGAAC;

[0109] Among them, GAAATTAATACGACTCACTATAGGG is the T7 promoter sequence; GATTTAGACTACCCCAAAAACGAAGGGGACTAAAAC is the common sequence of the cas13a hairpin structure.

[0110] 1.5 Establishment of the RAA-CRISPR / Cas13a-LFD method for detecting grape leafroll virus-3

[0111] Extract the viral cDNA to be tested as a template and prepare a 50 μL RAA reaction system: 25 μL of basal buffer, 2.1 μL each of upstream and downstream primers, 2 μL of cDNA template, 5 μL of 280 nM magnesium acetate solution, and bring the volume up to 50 μL with purified water. The concentrations of both upstream and downstream primers are 10 μmol / L, and the concentration of the cDNA template is 100 μg / mL. First, add all reactants except magnesium acetate to an amplification tube containing lyophilized enzyme. Gently mix by hand, then add 5 μL of magnesium acetate solution to the cap. Place the reaction tube in a metal bath and incubate at 40°C for 4 minutes. Remove the tube, mix further, and incubate at 40°C for an additional 26 minutes.

[0112] Use LwCas13a nuclease (45 nM), crRNA probe (22.5 nM), FB-RNA reporter (125 nM), RNase inhibitor (0.25 μl), ATP (1 mM), GTP (1 mM), UTP (1 mM), CTP (1 mM), and T7 polymerase (0.4 μl). Use detection buffer to make up to 9 μl, add 1 μl of the RAA amplification product from step 1.4, and incubate at 37°C for 40 min. Dilute the test product 10-fold with lateral flow strip diluent, load it onto a lateral flow strip, let it sit for 3-5 min, and observe the results.

[0113] Among them, FB-RNA reporter molecules:

[0114] Sequence (5'to3'): / 56-FAM / mArArUrGrGrCmAmArArUrGrGrCmA / 3 Bio /

[0115] When using LFD to detect CRISPR-Cas13a incubation products, a positive result is: both the test line and the control line are displayed or only the test line is developed; a negative result is: only the control line is visible; an invalid result is: neither the test line nor the control line appears.

[0116] Figure 11 This is a schematic diagram of the results interpretation when using LFD to detect CRISPR-Cas13a incubation products; the specific results interpretation is as follows:

[0117] 1. Positive (+): The C line is colored and the T line is visible to the naked eye, which is considered positive, indicating that the nucleic acid probe is cleaved by the CAS enzyme and the CAS enzyme is activated;

[0118] 2. Negative (-): The C line is colored, but the T line is not colored, indicating that the nucleic acid probe is not cleaved by the CAS enzyme and the CAS enzyme is not activated;

[0119] 3. Invalid: Neither the C nor the T line shows color, indicating an operator error or the test strip has deteriorated and is invalid. In this case, read the instructions carefully again and retest. If the problem persists, please contact the supplier. Example

[0120] 2. Sensitivity test

[0121] 2.1 Construction of standard plasmids

[0122] 2.1.1 Preparation of competent cells

[0123] Take Escherichia coli DH5a strain, streak it on LB medium, and culture it at 37℃ overnight; pick about 10 colonies and inoculate them on LB liquid medium, centrifuge at 4℃ and 4000g for 10 minutes; resuspend the bacterial precipitate in 100ml of pre-chilled TB buffer, incubate on ice for 10 minutes, and centrifuge at 4℃ and 4000g for 10 minutes; then resuspend the bacterial precipitate in 20ml of TB buffer, add dimethyl sulfoxide to a concentration of 7%, mix gently, and incubate on ice for 10 minutes; dispense 100μl of the above solution into 1.5ml centrifuge tubes and place them in an ultra-low temperature refrigerator for later use.

[0124] 2.1.2 PCR amplification

[0125] PCR amplification was performed using GLRaV-3 cDNA as a template. The upstream primer was 5'-ACAGCCATGA AGTTCGCAGG-3' (SEQ ID NO. 15) and the downstream primer was 5'-CAACCGTGTCCTAT CGCCAG -3' (SEQ ID NO. 16) (to verify whether the sequence was 546 bp). The PCR reaction system (to verify the leaf curl virus-3 PCR system) was 25 ul, containing 2.5 μl 10× PCR buffer, 2 μl 25 mM MgCl2, 0.5 μl 10 μM upstream and downstream primers (e.g., LC1 / LC2), 0.5 μl 10 mM dNTPs, 0.2 μl Taq DNA polymerase, and 2 μl cDNA template. Sterile double-distilled water was added to 25 μl. The reaction procedure was as follows: pre-denaturation at 98°C for 5 min; denaturation at 98°C for 15 s, annealing at 57°C for 30 s, and extension at 72°C for 30 s, for a total of 35 cycles; final extension at 72°C for 10 min; and hold at 4°C.

[0126] 2.1.3 Collection and purification of PCR amplification products

[0127] The PCR product was purified using the Star Prep Gel Extraction Kit (GenStar, Beijing, China). The steps are as follows:

[0128] (1) Add the amplified PCR product to the prepared agarose gel wells with a pipette and run it in an electrophoresis instrument at 120V for 40 minutes. Then take out the agarose gel and place it under a UV lamp. Wear gloves and use a surgical blade to accurately cut out the gel piece containing the DNA band of the target fragment, leaving as little excess gel as possible. Then place the gel piece containing the target band into a 1.5ml centrifuge tube.

[0129] (2) Add gel binding solution twice the volume of the gel and place in a 56°C water bath for 10 minutes. After the gel is completely melted, transfer the solution to the centrifuge column and centrifuge at 12,000 rpm at room temperature for 1 minute. Discard the waste liquid.

[0130] (3) Add 700 μl of anhydrous ethanol dilution buffer to wash the recovery column repeatedly, centrifuge at 12,000 rpm for 1 min at room temperature, discard the waste liquid, and repeat the above steps once;

[0131] (4) Centrifuge the column at 12,000 rpm for 2 min at room temperature to ensure removal of residual anhydrous ethanol;

[0132] (5) Move the centrifuge column to a new centrifuge tube, add 40 μl of DNA elution buffer to rinse, centrifuge at room temperature and 12,000 rpm for 1 minute, and collect the supernatant to obtain the recovered DNA.

[0133] 2.1.4 Connection and Conversion

[0134] (1) Take out the competent cells stored in the ultra-low temperature refrigerator in advance and place them on ice to thaw;

[0135] (2) After the competent cells have melted, take out 50 μl of competent cells and add 5 μl of ligation product, mix gently with a pipette, and place on ice for 30 min;

[0136] (3) Place the mixture in a 42°C water bath for 100 seconds, then place on ice for 5 minutes;

[0137] (4) Add 300 μl of LB liquid medium to a new centrifuge tube, then add the ligation product, place it in a 37°C incubator, and culture at 200 rpm for 1 hour;

[0138] (5) Take 100 μl of culture medium and place it on solid LB medium containing ampicillin, spread it evenly with a sterilized glass rod, and then invert and place it flat in a 37°C constant temperature incubator for overnight culture.

[0139] 2.1.5 Plasmid extraction

[0140] The plasmid was extracted according to the instructions of the plasmid miniprep kit.

[0141] The detailed steps are as follows:

[0142] (1) Take 4 ml of overnight cultured E. coli and centrifuge at 9000 g for 1 min to collect the culture.

[0143] (2) Add 250 μl of Buffer 1 solution containing RNase A and pipette thoroughly to suspend the precipitate;

[0144] (3) Then add 250 μl of Buffer 2 and gently invert several times to mix until the solution becomes clear;

[0145] (4) Add 350 μl of Buffer 3 solution, mix gently several times, and let it stand at room temperature for 5 minutes after a white flocculent precipitate appears;

[0146] (5) Centrifuge at 12000 g for 10 min at room temperature;

[0147] (6) Pipette the supernatant into a centrifuge column and centrifuge at 12000g for 1 min at room temperature;

[0148] (7) Discard the filtrate, add 700 μl of eluent to the centrifuge column, centrifuge at 12,000 g for 1 min, and repeat this step;

[0149] (8) Place the centrifuge tube back into the collection tube and centrifuge at 12,000 g for 2 minutes at room temperature to remove any remaining liquid.

[0150] (9) Discard the filtrate, place the centrifuge column in a new centrifuge tube, add 80 μl TE Buffer to the centrifuge column, and let it stand at room temperature for 2 minutes;

[0151] (10) Centrifuge at 12000g for 1 min. The supernatant is the plasmid DNA.

[0152] The constructed standard plasmid was diluted to 10 8 -10 0 copies / ul, and store at -20℃ for future use.

[0153] Explanation of the plasmid copy number calculation formula:

[0154] MW stands for grams per mole, and the unit is dolton; 1 dolton means 1 g / mol;

[0155] 1 mole = 6.02*10 23 Molecular number (copy number);

[0156] Average molecular weight (MW): dsDNA = number of bases * 660 Daltons / base;

[0157] The copy number calculation formula is: 6.02*10 23 Copies / mole*(concentration) / (MW g / mol)=copies / ml;

[0158] That is, copies / ul=(6.02*10 23 )*(ng / ul*10 -9 ) / (DNA Length*660)=(9.12*10 11 )*(ng / ul) / (DNA Length);

[0159] The plasmid used in this project is as follows: vector 2710 bp, target fragment 546 bp, total plasmid length 3256 bp; the plasmid was tested by Qubit three times, with an average concentration of 31 ng / ul; the copy number is approximately copies / ul = (9.12*10 11 )* 31 / 3256=8.68*10 9 .

[0160] 2.2 Sensitivity testing

[0161] The GLRaV-3 standard plasmid was diluted to different concentrations (10 8 -10 0 Copies / μL) were used as templates and ddH2O as negative control. PCR-agarose gel electrophoresis, fluorescence, and RAA-CRISPR / Cas13a-LFD methods were used to determine the minimum detection limit.

[0162] PCR reaction system: see 2.1.3.

[0163] Fluorescence method: Use LwCas13a nuclease (45nM), crRNA probe (22.5nM), FT-RNA reporter molecule (125nM), RNase inhibitor (0.25μl), ATP (1mM), GTP (1mM), UTP (1mM), CTP (1mM) and T7 polymerase (0.4μl). Use detection buffer to make up to 9μl, and add 1μl of the amplification product in step 2.1.3. Incubate at 37°C for 40-90min on a Quant StudioTM 6 Flex real-time fluorescence quantitative PCR instrument and collect fluorescence signals (1 fluorescence signal per minute).

[0164] RAA-CRISPR / Cas13a-LFD detection method: 10 8 -100 The optimized reaction system was used as a template to determine the minimum detection limit of the method.

[0165] PCR reaction sensitivity test results are as follows Figure 12 As shown; GLRaV-3 Primer4+crRNA3-4 sensitivity detection results (Lateral Flow Detection) are as shown Figure 13 As shown; GLRaV-3 Primer4+crRNA3-4 sensitivity detection results (Fluorescence Detection) are as shown Figure 14 shown.

[0166] according to Figure 12-14 The sensitivity evaluation results showed that the minimum detection limit of the PCR method was 10 2 The lower limit of plasmid copy number detection by test strip method and fluorescence method is 10 0 copies / ul, and its sensitivity is 100 times higher than that of PCR method.

[0167] 2.3 Specificity test

[0168] Probe primer combination: Primer4 + crRNA3-4; Experimental conditions: RAA amplification system primer dosage 240pM; Amplification time 40min; DNA templates: Specific samples 2 (Leaf Curl Virus-3), 2' (Leaf Curl Virus-3), 3 (Grape Fan Leaf Virus), 5' (Grape Spot Virus), a1 (Leaf Curl Virus-3), a3 (Leaf Curl Virus-3), plasmid, NTC; RAA template input amount: 2ul.

[0169] GLRaV-3 Primer4+crRNA3-4 specific detection results (Lateral Flow Detection) are as follows Figure 15 As shown; GLRaV-3 Primer4+crRNA3-4 specific detection results (Fluorescence Detection) are as shown Figure 16 shown.

[0170] In summary, ZL is a plasmid sample, NTC is a negative control, and the remaining samples are specific test samples. The plasmid sample tested positive, while the NTC test was negative, as expected. Test samples 2, 2', a1, and a3 tested positive, while test samples 3 and 5' tested negative. The fluorescence test results were generally consistent with those of the test strip, with a slight increase at the end of the 5' fluorescence curve.

Claims

1. A detection system for grapevine leafroll virus-3 based on RT-RAA and CRISPR / Cas13a, characterized in that: Includes independently packaged RAA isothermal amplification system and CRISPR / Cas13a-LFD detection system; The RAA isothermal amplification system includes an RAA primer pair designed based on grape leafroll virus-3 nucleic acid, and the RAA primer pair includes an upstream primer GLRaV-3-RAA-F and a downstream primer GLRaV-3-RAA-R, and the sequences thereof are as follows: GLRaV-3-RAA-F:GAAATTAATACGACTCACTATAGGGTGCTCTAGTTAAGGTCAGGAGTGATGTGGC; GLRaV-3-RAA-R: CTCGTCCGTAGCGTATTCGTTAAAGTGTC; The CRISPR / Cas13a-LFD detection system includes a crRNA designed based on the grape leafroll virus-3 nucleic acid, and the nucleotide sequence of the crRNA is as follows: crRNA:GAAATTAATACGACTCACTATAGGGGATTTAGACTACCCCAAAAA CGAAGGGGACTAAAACTAAACCTTAGCCCCACAAGCCACCGAAC.

2. A kit for detecting grapevine leafroll virus-3 based on RT-RAA and CRISPR / Cas13a, characterized in that: The invention comprises the detection system for detecting grape leafroll virus-3 based on RT-RAA and CRISPR / Cas13a as described in claim 1.

3. The kit according to claim 2, wherein Also included are Cas13a proteins and reagents or kits for RAA amplification.

4. A method for detecting grape leafroll virus-3 using the kit according to claim 2 or 3, characterized in that: The steps include: S1. Extract grape leafroll virus-3 cDNA as a template, and use the upstream primer GLRaV-3-RAA-F and the downstream primer GLRaV-3-RAA-R of the kit to perform RAA amplification; S2. The RAA amplification product is added to the CRISPR-Cas13a system for incubation; the CRISPR-Cas13a system includes the specific crRNA in the kit; S3. Detect the incubation products of CRISPR-Cas13a using LFD.

Images