Isothermal gene amplification method, gene detection method, virus detection method, and kits used therefor
The isothermal gene amplification method addresses the inefficiencies of PCR by combining DNA and RNA amplification steps, facilitating rapid and economical RNA virus detection.
Patent Information
- Application Number
- JP2023522046
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2021-05-18
- Publication Date
- 2025-12-09
- Estimated Expiration
- 2041-05-18
AI Technical Summary
PCR methods for RNA virus detection require temperature adjustments and specialized equipment, making them time-consuming, labor-intensive, and expensive.
An isothermal gene amplification method involving steps for amplification reaction template generation, DNA amplification, and RNA amplification, utilizing enzymes and primers to generate and extend DNA and RNA strands without temperature changes.
Enables easy and cost-effective detection of RNA viruses in a short time, improving amplification efficiency through combined DNA and RNA amplification steps.
Smart Images

Figure 0007782864000001 
Figure 0007782864000002 
Figure 0007782864000003
Abstract
Description
[Technical Field]
[0001] The present invention relates to an isothermal gene amplification method, a gene detection method, a virus detection method, and kits used therefor. [Background technology]
[0002] In recent years, there have been outbreaks of RNA viral infections, such as human and avian influenza and severe acute respiratory syndrome (SARS), and recently, the global pandemic caused by the novel coronavirus (SARS-CoV-2) has become a global problem. Detection of RNA viruses is essential to prevent the spread of such RNA viral infections. Patent Document 1 listed below discloses a primer set for determining the NA subtype of avian influenza viruses using the PCR method. [Prior art documents] [Patent documents]
[0003] [Patent Document 1] Japanese Patent Application Laid-Open No. 2010-252659 Summary of the Invention [Problem to be solved by the invention]
[0004] However, PCR requires the temperature of the reaction solution to be adjusted, which requires special equipment such as a thermal cycler, making it time-consuming, labor-intensive, and expensive.
[0005] Therefore, an object of the present invention is to provide a novel isothermal gene amplification method that can detect RNA of infectious disease pathogens such as viruses, easily, and at low cost in a short time. [Means for solving the problem]
[0006] In order to achieve the above-mentioned object, the isothermal gene amplification method (hereinafter also referred to as "amplification method") of the present invention is an isothermal gene amplification method for a target sequence in an RNA genome, and includes the following steps: (A) an amplification reaction template generation step; (B) a DNA amplification step for increasing the amplification reaction template; and (C) an RNA amplification step. (A) the amplification reaction template generation step, which includes the following steps (A1) to (A3): (A1) A nucleic acid sequence comprising a promoter sequence for RNA polymerase on the 5' side and a sequence corresponding to the target sequence in the RNA genome on the 3' side. 3 a first primer containing a complementary sequence complementary to the sequence at the ' end of the target sequence in the RNA genome; 3 a reverse transcription step in which the first primer is hybridized to the sequence at the 3' end of the first primer and the 3' end of the first primer is extended by reverse transcription activity of a reverse transcriptase to generate a composite double-stranded strand of the RNA genome and an extended DNA strand; (A2) a single-stranded DNA generating step of degrading the RNA genome of the complex double-stranded structure formed in (A1) by the RNA degradation activity of the reverse transcriptase to generate a single-stranded DNA containing the first primer sequence; (A3) a double-stranded DNA generating step in which a second primer having the same sequence as the 3'-side sequence of the target sequence is hybridized to a sequence complementary to the target sequence of the single-stranded DNA generated in the step (A2), and the 3'-end of the second primer is extended by the DNA synthesis activity of the reverse transcriptase to generate a single-stranded DNA containing the second primer sequence, thereby generating a double-stranded DNA that serves as the amplification reaction template; (B) a DNA amplification step for increasing the amplification reaction template, which includes the following steps (B1) and (B2): (B1) a primer hybridization step in which, in the presence of a single-stranded DNA binding protein, the second primer is hybridized to the 3' side of the single-stranded DNA containing the first primer and the first primer is hybridized to the 3' side of the single-stranded DNA containing the second primer sequence in the double-stranded DNA of the amplification reaction template of (A3) by a recombinase; (B2) a double-stranded DNA generating step of extending the 3' end of the first primer and the 3' end of the second primer by the strand-displacing DNA synthesis activity of the strand-displacing DNA polymerase in the presence of the single-stranded DNA binding protein to generate a double-stranded DNA identical to the amplification reaction template of (A3); (C) An RNA amplification step including the following steps (C1) to (C4): (C1) a single-stranded RNA synthesis step in which single-stranded RNA is synthesized using the RNA synthesis activity of an RNA polymerase, using as a template a sequence 3' downstream of the promoter sequence in the double-stranded DNA of the amplification reaction template of (A3); (C2) a reverse transcription step in which the second primer is hybridized to the 5' end of the single-stranded RNA of (C1) and the 3' end of the second primer is extended by the reverse transcription activity of the reverse transcriptase to generate a complex double-stranded DNA of the single-stranded RNA and extended DNA; (C3) a step of degrading the single-stranded RNA of the complex double strand of (C2) by the RNA degradation activity of the reverse transcriptase to generate single-stranded DNA; (C4) A double-stranded DNA production step in which the first primer is hybridized to the 3' end of the single-stranded DNA of (C3), the 3' end of the first primer is extended by the DNA synthesis activity of the reverse transcriptase, and the 3' end of the single-stranded DNA of (C3) is extended using the promoter sequence of the RNA polymerase of the first primer as a template, thereby producing a double-stranded DNA identical to the amplification reaction template produced in (A3).
[0007] The kit used in the gene amplification method of the present invention (hereinafter also referred to as "first kit") comprises the following (a1) to (a3), (b1) to (b3), and (c1): (a1) the reverse transcriptase; (a2) the first primer; (a3) the second primer; (b1) the recombinase; (b2) the single-stranded DNA binding protein; (b3) the strand-displacing DNA polymerase; (c1) The RNA polymerase.
[0008] The gene detection method of the present invention is a method for detecting a gene of the target sequence in an RNA genome, comprising a gene amplification step and an amplified gene detection step, The gene amplification step is carried out by the gene amplification method of the present invention.
[0009] The kit used in the gene detection method of the present invention (hereinafter also referred to as the "second kit") comprises the following (a1) to (a3), (b1) to (b3), (c1), and (d1) to (d3): (a1) the reverse transcriptase; (a2) the first primer; (a3) the second primer; (b1) the recombinase; (b2) the single-stranded DNA binding protein; (b3) the strand-displacing DNA polymerase; (c1) the RNA polymerase; (d1) the immobilized antibody; (d2) substrate; (d3) Labeled material.
[0010] The virus detection method of the present invention is a method for detecting an RNA virus, which detects a sequence specific to the RNA virus in a viral genome as a target sequence, The detection of the target sequence is carried out by the gene detection method of the present invention.
[0011] The virus detection kit of the present invention (hereinafter also referred to as the "third kit") is a detection kit used in the method for detecting an RNA virus of the present invention, and includes the first kit or second kit of the present invention. [Effects of the Invention]
[0012] According to the present invention, infectious disease pathogens such as viruses can be detected easily and at low cost in a short time. [Brief explanation of the drawings]
[0013] [Figure 1] FIG. 1 is a schematic diagram showing the mechanism and main steps of the isothermal gene amplification method of the present invention. [Figure 2] FIG. 2 is a schematic diagram showing an example of the main steps in the first gene detection method of the present invention. [Figure 3] FIG. 3 is a diagram showing an example of an electrochemical detection method in the second gene detection method of the present invention. [Figure 4] FIG. 4 is a schematic diagram showing the target sequence and primers in Example 1. [Figure 5] FIG. 5 is a photograph showing a gel image of the amplification products after the reaction in Example 1. [Figure 6] FIG. 6 is a photograph showing a gel image of the amplification products after the reaction in Example 1. [Figure 7] FIG. 7 is a photograph showing a gel image of the amplification products after the reaction in Example 1. [Figure 8] FIG. 8 is a schematic diagram showing the target sequence and primers in Example 2. [Figure 9] FIG. 9 is a photograph showing a gel image of the amplification products after the reaction in Example 2. [Figure 10] FIG. 10(A) is a schematic diagram illustrating the configuration of the LFD in Example 3, and FIG. 10(B) is a photograph showing the results of the lateral flow immunoassay in Example 3. [Figure 11] FIG. 11 is a schematic diagram showing the target sequence and primers in Example 4. [Figure 12] FIG. 12(A) is a schematic diagram showing the reaction steps in Example 4, and FIG. 12(B) is a photograph showing a gel image of the amplification product after the reaction in Example 4. [Figure 13] FIG. 13 is a photograph showing a gel image of the amplification products after the reaction in Example 5. [Figure 14] FIG. 14 is a photograph showing a gel image of the amplification products after the reaction in Example 5. [Figure 15] 15(A) and (B) are photographs showing gel images of the amplification products after the reaction in Example 5. [Figure 16] FIG. 16 is a photograph showing a gel image of the amplification products after the reaction in Example 5. [Figure 17] FIG. 17 is a photograph showing a gel image of the amplification products after the reaction in Example 5. [Figure 18] FIG. 18 is a photograph showing a gel image of the amplification products after the reaction in Example 5. [Figure 19] 19(A) to 19(C) are photographs showing gel images of the amplification products after the reaction in Example 6. DETAILED DESCRIPTION OF THE INVENTION
[0014] The key feature of the present invention is, for example, the combination of a (B) DNA amplification step and a (C) RNA amplification step. The inventors have found that while the amplification efficiency is not particularly high when either the (B) DNA amplification step or the (C) RNA amplification step is performed alone, the reaction efficiency is significantly improved when both the (B) and (C) amplification reaction steps are combined. Furthermore, as shown in the Examples below, the amount of RNA amplification product is overwhelmingly greater than the amount of DNA amplification product in the amplification products amplified by the amplification method of the present invention. Therefore, it is presumed that the (B) DNA amplification step provides a template, which is an amplification reaction intermediate (amplicon), thereby improving the efficiency of the (C) RNA amplification reaction. However, the present invention is in no way limited to this presumption.
[0015] In the gene amplification method of the present invention, for example, the promoter sequence of RNA polymerase contained in the first primer is a T7 promoter sequence; In one embodiment, the RNA polymerase is T7 RNA polymerase.
[0016] The gene amplification method of the present invention may be embodied in such a manner that, for example, the RNA genome is a sense strand, the first primer is an antisense primer, and the second primer is a sense primer.
[0017] In the gene detection method of the present invention, for example, in the gene amplification step, one of the first primer and the second primer has an antigen incorporated at its 5' end that can specifically bind to an immobilized antibody immobilized on a substrate, and the other of the first primer and the second primer has a first binder incorporated at its 5' end; In the amplified gene detection step, the antigen of one of the primers of the gene amplification product produced in the gene amplification step binds to the immobilized antibody, thereby immobilizing the gene amplification product to the substrate, and the first conjugate of the other primer binds to a label containing a second conjugate that specifically binds to the first conjugate via the second conjugate, thereby immobilizing the label to the substrate, and the label moiety immobilized to the substrate may be detected. Hereinafter, this type of gene detection method may be referred to as, for example, the "first gene detection method of the present invention."
[0018] In the gene detection method of the present invention, for example, the first binder may be biotin, the second binder may be streptavidin, and the label may be a colored microparticle having the streptavidin immobilized on its surface.
[0019] In the gene detection method of the present invention, for example, the detection step may be performed by applying a voltage to a working electrode and a counter electrode in the presence of a redox substance that binds to the double-stranded portion of the target sequence amplified in the amplification step, and measuring the current between the two electrodes. Hereinafter, the gene detection method of this type may be referred to as, for example, the "second gene detection method of the present invention."
[0020] The gene detection method of the present invention may be configured such that, for example, in the detection step, if the current values of both electrodes are higher than a predetermined reference current value within a specific voltage range, a positive determination is made that the target sequence nucleic acid is present in the genome, and if the current values of both electrodes are lower than the reference current value, a negative determination is made that the target sequence nucleic acid is not present in the genome.
[0021] In the gene detection method of the present invention, for example, the detection step comprises measuring a current between the two electrodes in the presence of a probe nucleic acid capable of specifically and complementary binding to the amplification product; The probe nucleic acid may have one end bound to a magnetic particle whose surface is coated with gold, and the other end bound to the redox substance.
[0022] In the gene detection method of the present invention, for example, the redox substance may be methylene blue.
[0023] In the present invention, the term "pathogen" is not particularly limited as long as it has DNA or RNA and causes disease in living organisms. The living organisms are not particularly limited and include animals (humans, livestock, etc.) and plants. Specific examples of the pathogen include viruses such as coronaviruses (including, for example, SARS-CoV, the virus that causes SARS, SARS-CoV-2, the virus that causes COVID-19, and MERS-CoV, the virus that causes MERS), influenza virus, norovirus, hepatitis B virus, and hepatitis C virus; bacteria such as mycoplasma, Staphylococcus aureus, Streptococcus pneumoniae, Haemophilus influenzae, ESBL-producing bacteria, Neisseria gonorrhoeae, Mycobacterium tuberculosis, hemolytic streptococci, Clostridium difficile, enterobacteria, enterococci, Acinetobacter, Pseudomonas aeruginosa, Staphylococcus aureus, Campylobacter, non-typhoidal Salmonella, Salmonella typhi, Shigella, group A streptococci, group B streptococci, non-tuberculous mycobacteria, and spirochetes; and fungi such as tinea fungi and Candida.
[0024] <Gene amplification method> As described above, the gene amplification method of the present invention is an isothermal gene amplification method for a target sequence in an RNA genome, and is characterized by comprising the following steps: (A) an amplification reaction template generation step; (B) a DNA amplification step for increasing the amount of the amplification reaction template; and (C) an RNA amplification step; other steps and conditions are not particularly limited. (A) the amplification reaction template generation step, which includes the following steps (A1) to (A3): (A1) A nucleic acid sequence comprising a promoter sequence for RNA polymerase on the 5' side and a sequence corresponding to the target sequence in the RNA genome on the 3' side. 3 a first primer containing a complementary sequence complementary to the sequence at the ' end of the target sequence in the RNA genome; 3 a reverse transcription step in which the first primer is hybridized to the sequence at the 3' end of the first primer and the 3' end of the first primer is extended by reverse transcription activity of a reverse transcriptase to generate a composite double-stranded strand of the RNA genome and an extended DNA strand; (A2) a single-stranded DNA generating step of degrading the RNA genome of the complex double-stranded structure formed in (A1) by the RNA degradation activity of the reverse transcriptase to generate a single-stranded DNA containing the first primer sequence; (A3) a double-stranded DNA generating step in which a second primer having the same sequence as the 3'-side sequence of the target sequence is hybridized to a sequence complementary to the target sequence of the single-stranded DNA generated in the step (A2), and the 3'-end of the second primer is extended by the DNA synthesis activity of the reverse transcriptase to generate a single-stranded DNA containing the second primer sequence, thereby generating a double-stranded DNA that serves as the amplification reaction template; (B) a DNA amplification step for increasing the amplification reaction template, which includes the following steps (B1) and (B2): (B1) a primer hybridization step in which, in the presence of a single-stranded DNA binding protein, the second primer is hybridized to the 3' side of the single-stranded DNA containing the first primer and the first primer is hybridized to the 3' side of the single-stranded DNA containing the second primer sequence in the double-stranded DNA of the amplification reaction template of (A3) by a recombinase; (B2) a double-stranded DNA generating step of extending the 3' end of the first primer and the 3' end of the second primer by the strand-displacing DNA synthesis activity of the strand-displacing DNA polymerase in the presence of the single-stranded DNA binding protein to generate a double-stranded DNA identical to the amplification reaction template of (A3); (C) An RNA amplification step including the following steps (C1) to (C4): (C1) a single-stranded RNA synthesis step in which single-stranded RNA is synthesized using the RNA synthesis activity of an RNA polymerase, using as a template a sequence 3' downstream of the promoter sequence in the double-stranded DNA of the amplification reaction template of (A3); (C2) a reverse transcription step in which the second primer is hybridized to the 5' end of the single-stranded RNA of (C1) and the 3' end of the second primer is extended by the reverse transcription activity of the reverse transcriptase to generate a complex double-stranded DNA of the single-stranded RNA and extended DNA; (C3) a step of degrading the single-stranded RNA of the complex double strand of (C2) by the RNA degradation activity of the reverse transcriptase to generate single-stranded DNA; (C4) A double-stranded DNA production step in which the first primer is hybridized to the 3' end of the single-stranded DNA of (C3), the 3' end of the first primer is extended by the DNA synthesis activity of the reverse transcriptase, and the 3' end of the single-stranded DNA of (C3) is extended using the promoter sequence of the RNA polymerase of the first primer as a template, thereby producing a double-stranded DNA identical to the amplification reaction template produced in (A3).
[0025] Hereinafter, (A) the amplification reaction template generation step, (B) the DNA amplification step for increasing the amount of the amplification reaction template, and (C) the RNA amplification step will be described in order.
[0026] The RNA genome may be, for example, a sense strand or an antisense strand, but is preferably a sense strand. When the RNA genome is a sense strand, the specificity of gene amplification by the gene amplification method of the present invention can be improved, for example, as shown in the Examples below.
[0027] The term "isothermal amplification method" generally refers to a method in which a nucleic acid amplification reaction is carried out isothermally. In the gene amplification method of the present invention, the conditions for the amplification reaction are not particularly limited and can be appropriately determined by, for example, a person skilled in the art. In the amplification method of the present invention, the reaction temperature is not particularly limited and is preferably set, for example, to a temperature close to or lower than the melting temperature (Tm) of the primer. Furthermore, it is preferable to set the stringency level taking the melting temperature (Tm) of the primer into consideration. Specific examples of the reaction temperature include 33 to 47°C, 35 to 45°C, and 37 to 43°C. In the amplification method of the present invention, the reaction time is not particularly limited and can be appropriately determined by, for example, a person skilled in the art. Specific examples of the reaction time include 5 to 60 minutes, 10 to 30 minutes, and 10 to 20 minutes. As shown in the Examples below, the specificity of amplification in the amplification method of the present invention can be improved. Therefore, the reaction time is preferably, for example, 20 minutes or less.
[0028] The target sequence is, for example, a sequence to be amplified in the RNA genome of a target pathogen, and is not particularly limited. The length of the target sequence is not particularly limited, and is, for example, 100 to 400 bases long.
[0029] The first primer is, for example, a single-stranded polynucleotide, and includes a promoter sequence for RNA polymerase on its 5' side and a sequence corresponding to the target sequence in the RNA genome on its 3' side. 3 The first primer is not particularly limited except that it contains a complementary sequence (hereinafter also referred to as a "target binding sequence") that is complementary to the sequence at the other end of the first primer. For example, the first primer may be a primer that binds to the target sequence in the RNA genome under the reaction conditions of the isothermal gene amplification method of the present invention. 3The first primer is capable of hybridizing to the sequence on the 5' side of the target sequence. The length of the target binding sequence in the first primer is not particularly limited as long as it is capable of hybridizing to the sequence on the 5' side of the target sequence, and is, for example, 20 to 35 bases long. For example, when the RNA genome is a sense strand, the first primer is an antisense primer, and when the RNA genome is an antisense strand, the first primer is a sense primer, but is preferably an antisense primer. When the RNA genome is a sense strand and the first primer is an antisense primer, the specificity of gene amplification by the gene amplification method of the present invention can be improved, for example, as shown in the Examples described below.
[0030] For example, all of the first primers may contain an RNA polymerase promoter sequence, or some of the first primers may contain an RNA polymerase promoter sequence. In the latter case, for example, the first primers that do not contain an RNA polymerase promoter sequence may have incorporated at their 5' ends a first binding substance used in the gene detection method of the present invention, which will be described later. Specifically, the first primers that do not contain an RNA polymerase promoter sequence may be biotinylated first binding primers in which biotin is incorporated as the first binding substance. This is preferable because it allows for easy detection of amplification products in the gene detection method of the present invention, which will be described later.
[0031] The base sequence of the target binding sequence of the first primer is not particularly limited and can be appropriately determined depending on the sequence of the target nucleic acid. The target binding sequence can be determined, for example, by a conventionally known method. It is typically designed to hybridize to the nucleic acid under stringent conditions so that the target sequence in the RNA genome is included in the amplification product. "Stringent conditions" can be determined, for example, depending on the melting temperature (Tm) (°C) of the duplex between the first primer and its complementary strand, the salt concentration of the hybridization solution, and other factors. For example, see "Molecular Cloning: A Laboratory Manual 2nd Ed.," edited by Sambrook et al., Cold Spring Harbor Laboratory Press (1989). For example, hybridization at a temperature slightly lower than the melting temperature of the primer used allows the primer to specifically hybridize to a nucleic acid having the target nucleic acid sequence. Such primers can be designed using commercially available primer construction software, such as Primer3 (Whitehead Institute for Biomedical Research). The "stringent conditions" may be, for example, low stringency, medium stringency, or high stringency. "Low stringency conditions" are, for example, 5x SSC, 5x Denhardt's solution, 0.5% SDS, 50% formamide, and 32°C. "Medium stringency conditions" are, for example, 5x SSC, 5x Denhardt's solution, 0.5% SDS, 50% formamide, and 42°C. "High stringency conditions" are, for example, 5x SSC, 5x Denhardt's solution, 0.5% SDS, 50% formamide, and 50°C. Those skilled in the art can set the degree of stringency by appropriately selecting conditions such as temperature, salt concentration, probe concentration and length, ionic strength, and time.The "stringent conditions" are, for example, those described in the aforementioned "Molecular Cloning: A Laboratory Manual 2nd Edition" edited by Sambrook et al. nd The conditions described in "Cold Spring Harbor Laboratory Press (1989)" can also be used.
[0032] In the present invention, the basic skeleton of the first primer and the second primer described below is not particularly limited and may be, for example, an oligonucleotide, a modified oligonucleotide, an oligonucleoside, a modified oligonucleoside, a polynucleotide, a modified polynucleotide, a polynucleoside, a modified polynucleoside, DNA, a modified DNA, RNA, a chimeric molecule thereof, or any other structure. The nucleic acid may be, for example, one capable of forming base pairs, and in the case of a nucleic acid sample or a target nucleic acid sequence, may function as a template for complementary strand synthesis. The basic skeleton of the first primer and the second primer is preferably, for example, an oligonucleotide, a polynucleotide, DNA, or a modified form thereof. In the present invention, "nucleotide" refers to, for example, either a deoxynucleotide or a ribonucleotide, and "oligonucleotide" and "polynucleotide" may be composed of, for example, either deoxynucleotides or ribonucleotides, or may contain both. In the present invention, the number of bases constituting a nucleic acid is not particularly limited. The term "nucleic acid" is generally synonymous with the term "polynucleotide." The term "oligonucleotide" is generally used to refer to a polynucleotide having a particularly small number of bases. Generally, a polynucleotide having a length of, for example, 2 to 100 bases, more generally, about 2 to 50 bases, is called an "oligonucleotide," but is not limited to these numerical values. In the present invention, the term "polynucleotide" includes, for example, polynucleotides and oligonucleotides.
[0033] The RNA polymerase promoter sequence is a sequence specifically recognized by RNA polymerase, and known RNA polymerase promoter sequences can be used. Specific examples of the RNA polymerase promoter sequence include the T7 promoter sequence specifically recognized by the T7 RNA polymerase derived from bacteriophage T7, and the SP6 promoter sequence specifically recognized by the SP6 RNA polymerase derived from bacteriophage SP6. Specific examples of the T7 promoter sequence include a polynucleotide represented by the nucleotide sequence shown in SEQ ID NO: 1 (5'-aattctaatacgactcactatagggaga-3'). Specific examples of the SP6 promoter sequence include a polynucleotide represented by the nucleotide sequence shown in SEQ ID NO: 2 (5'-atttaggtgacactatagaa-3').
[0034] The reverse transcriptase is a DNA polymerase that transcribes single-stranded RNA into single-stranded DNA (reverse transcription), and is an enzyme that has reverse transcription activity and RNA degradation activity. The reverse transcriptase is not particularly limited, and for example, known reverse transcriptases can be used. Specific examples of the reverse transcriptase include M-MuLV reverse transcriptase, AMV reverse transcriptase, Transcriptor reverse transcriptase, SuperScript (registered trademark) Transcriptor reverse transcriptase, and MultiScribe reverse transcriptase.
[0035] The second primer is, for example, a single-stranded polynucleotide and is not particularly limited other than having the same sequence as the 3'-side sequence of the target sequence. The phrase "having the same sequence as the 3'-side sequence of the target sequence" means, for example, having the same nucleotide sequence as the consecutive nucleotide sequence from the 3'-end to the 5'-side of the target sequence in the RNA genome. The length of the second primer is not particularly limited and is, for example, 15 to 30 bases, 20 to 30 bases, or 22 to 27 bases. For example, when the RNA genome is the sense strand, the second primer is a sense primer. When the RNA genome is the antisense strand, the second primer is an antisense primer, but is preferably a sense primer. When the RNA genome is the sense strand and the second primer is a sense primer, the specificity of gene amplification by the gene amplification method of the present invention can be improved, for example, as shown in the Examples below.
[0036] The double-stranded DNA that is the amplification reaction template generated in the step (A3) is, for example, an amplification intermediate in the gene amplification method of the present invention, and is also called an amplicon or an amplification reaction template.
[0037] The recombinase is a protein that catalyzes the recombination reaction between homologous DNA sequences, and can be, for example, a known recombinase used in the general RPA (Recombinase Polymerase Amplification) method. Specific examples of the recombinase include UvsX recombinase derived from bacteriophage T4, Cre recombinase derived from bacteriophage P1, Flp recombinase derived from yeast, and integrase derived from bacteriophage φ31.
[0038] The single-stranded DNA-binding protein is a protein that specifically binds to single-stranded DNA and is also called an SSB (single-strand DNA-binding protein). Examples of the single-stranded DNA-binding protein that can be used include known single-stranded DNA-binding proteins used in the general RPA (recombinase polymerase amplification) method. Specific examples of the SSB include single-stranded DNA-binding proteins derived from Escherichia coli, Drosophila, and Xenopus laevis, the bacteriophage T4 gene 32 protein, and other such proteins derived from other species.
[0039] The strand-displacing DNA polymerase is a DNA polymerase capable of synthesizing a complementary strand while dissociating a double-stranded region in the extension direction during the synthesis of a DNA strand complementary to a template DNA, i.e., a polymerase having strand displacement ability (strand displacement activity). The strand-displacing DNA polymerase may be, for example, a known strand-displacing DNA polymerase used in a typical RPA (Recombinase Polymerase Amplification) method. The strand-displacing DNA polymerase may be, for example, mesophilic, mesophilic, or thermostable. Furthermore, the strand-displacing polymerase may be, for example, a naturally occurring enzyme, an enzyme prepared by genetic engineering, or a mutant enzyme with artificial mutations. Such a polymerase is preferably, for example, a DNA polymerase, more preferably a DNA polymerase substantially lacking 5'→3' exonuclease activity. Specific examples of DNA polymerases having strand displacement ability include DNA polymerases derived from thermophilic Bacillus bacteria such as Bacillus stearothermophilus (hereinafter referred to as "B.st"), Bacillus caldotenax (hereinafter referred to as "B.ca"), and Bacillus thermostearophilus, as well as mutants thereof lacking 5'→3' exonuclease activity, DNA polymerase I derived from Escherichia coli (E. coli), and its Klenow fragment.Other examples include Vent DNA polymerase, Vent (Exo-) DNA polymerase, DeepVent DNA polymerase, DeepVent (Exo-) DNA polymerase, Φ29 phage DNA polymerase, MS-2 phage DNA polymerase, Z-Taq DNA polymerase, Pfu DNA polymerase, Pfu turbo DNA polymerase, KOD DNA polymerase, 9°Nm DNA polymerase, Therminater DNA polymerase, Aac DNA polymerase, Gca DNA polymerase, and Bsm DNA polymerase.
[0040] The strand-displacing DNA polymerase may also be a DNA polymerase that also has reverse transcription activity. Examples of such strand-displacing DNA polymerases include BcaBEST DNA polymerase and Bca(exo-)DNA polymerase. With such a DNA polymerase, for example, a reverse transcription reaction from total RNA or mRNA and a DNA polymerase reaction using cDNA as a template can be carried out with a single polymerase. Furthermore, a DNA polymerase can also be used in combination with the reverse transcriptase, such as MMLV reverse transcriptase.
[0041] In the gene amplification method of the present invention, the RNA polymerase is, for example, a DNA polymerase that catalyzes a transcription reaction that reads the base sequence of a DNA template strand and synthesizes complementary RNA, and any known RNA polymerase can be used. Specific examples of the RNA polymerase include T7 RNA polymerase derived from bacteriophage T7 and SP6 RNA polymerase derived from bacteriophage SP6. The T7 RNA polymerase exhibits specificity for the T7 promoter sequence.
[0042] Next, the gene amplification method of the present invention will be described in detail with reference to Figure 1. Figure 1 is a schematic diagram showing the mechanism and main steps of the isothermal gene amplification method of the present invention. In the following explanation, for example, a case will be described in which a T7 promoter sequence is used as the promoter sequence of the RNA polymerase and T7 RNA polymerase is used as the RNA polymerase, but the present invention is not limited thereto.
[0043] First, the (A) amplification reaction template generation step is carried out as shown in Figure 1. Specifically, a first primer containing a T7 promoter sequence at its 5' end is hybridized to the 3' end of the target sequence of the target RNA genome, and the 3' end of the first primer is extended using reverse transcriptase to generate a complex double-stranded strand of the RNA genome and the extended DNA strand (A1, reverse transcription step).
[0044] Next, the RNA genome in the complex double strand is degraded by the RNA degradation activity of the reverse transcriptase to generate a single-stranded DNA containing the first primer (A2, single-stranded DNA generation step).
[0045] Then, a second primer having the same sequence as the 3' sequence of the target sequence is hybridized to a sequence complementary to the target sequence of the single-stranded DNA generated in step (A2), and the 3' end of the second primer is extended by the DNA synthesis activity of the reverse transcriptase to generate single-stranded DNA containing the second primer sequence, thereby generating double-stranded DNA, which is the amplification reaction template (A3, double-stranded DNA generation step).
[0046] Next, (B) a DNA amplification step for increasing the amount of amplification reaction template and (C) an RNA amplification step are carried out as shown in Figure 1. The (B) DNA amplification step and the (C) RNA amplification step will be described in order below. As shown in Figure 1, the (B) DNA amplification step and the (C) RNA amplification step are, for example, steps in which reactions proceed in parallel and are carried out in parallel. However, the present invention is not limited thereto, and for example, either the (B) DNA amplification step or the (C) RNA amplification step may be carried out first.
[0047] In the (B) DNA amplification step for increasing the amplification reaction template, first, in the presence of a single-stranded DNA binding protein, a recombinase is used to hybridize the second primer to the 3' end of the single-stranded DNA containing the first primer in the double-stranded DNA of the amplification reaction template generated in (A3) above, and hybridize the first primer to the 3' end of the single-stranded DNA containing the second primer sequence (B1, primer hybridization step).
[0048] Next, in the presence of the single-stranded DNA binding protein, the 3' end of the first primer and the 3' end of the second primer are extended by the strand-displacing DNA synthesis activity of the strand-displacing DNA polymerase to generate a double-stranded DNA identical to the amplification reaction template in (A3) (B2, double-stranded DNA generation step). Here, "synthesizing a double-stranded DNA identical to the amplification reaction template" means that the double-stranded DNA generated in step (B2) and the amplification reaction template generated in (A3) are substantially identical double-stranded DNAs. The term "substantially identical" means, for example, that the sense strand and antisense strand of the double-stranded DNA generated in step (B2) and the amplification reaction template generated in (A3) can hybridize to the antisense strand and sense strand of the other, respectively. Specifically, the double-stranded DNA produced in step (B2) and the amplification reaction template produced in step (A3) may have completely identical sequences (full match) or may have sequences with some bases that differ (mismatch). The mismatch may be, for example, a sequence in which one of the two sequences differs from the other sequence by at least one of base deletion, substitution, and insertion. The number of bases deleted, substituted, or inserted in the sequence is preferably less than 10% of the total number of bases in the double-stranded DNA and the amplification reaction template. The complete identity, i.e., no deletion, substitution, or insertion, is particularly preferred. Furthermore, the deletion, substitution, or insertion in the sequence may occur at a site other than, for example, the C-terminus of the sequence.
[0049] Thereafter, (B1) to (B2) are repeated using the double-stranded DNA generated in step (B2) that is the same as the amplification reaction template until the reaction is terminated, thereby producing double-stranded DNA that is the same as the amplification reaction template.
[0050] In the (C) RNA amplification step, first, single-stranded RNA is synthesized using the RNA synthesis activity of T7 RNA polymerase, using the sequence 3' downstream of the T7 promoter in the double-stranded DNA of the amplification reaction template in (A3) as a template sequence (C1, single-stranded RNA synthesis step).
[0051] Next, the second primer is hybridized to the 5' end of the single-stranded RNA synthesized in (C1), and the 3' end of the second primer is extended by the reverse transcription activity of the reverse transcriptase, thereby generating a complex double-stranded strand of the single-stranded RNA and extended DNA (C2, reverse transcription step).
[0052] Next, the single-stranded RNA of the complex double-stranded structure produced in (C2) is degraded by the RNA degradation activity of the reverse transcriptase to produce single-stranded DNA (C3, single-stranded DNA production step).
[0053] Then, the first primer is hybridized to the 3' end of the single-stranded DNA produced in (C3), and the 3' end of the first primer is extended by the DNA synthesis activity of the reverse transcriptase. The 3' end of the single-stranded DNA in (C3) is also extended using the T7 promoter sequence of the first primer as a template to produce a double-stranded DNA identical to the amplification reaction template produced in (A3) (C4, double-stranded DNA production step). Here, "synthesizing a double-stranded DNA identical to the amplification reaction template" means that the double-stranded DNA produced in (C4) and the amplification reaction template produced in (A3) are substantially identical double-stranded DNAs. The term "substantially identical" means, for example, that the sense and antisense strands of the double-stranded DNA produced in (C4) and the amplification reaction template produced in (A3) can hybridize to the antisense and sense strands of the other, respectively. Specifically, the double-stranded DNA produced in step (C4) and the amplification reaction template produced in step (A3) may have a completely identical sequence (full match) or may have a sequence in which some bases are different (mismatch). The mismatch may be, for example, a sequence in which one of the two sequences differs from the other sequence by at least one of base deletion, substitution, and insertion. The number of bases deleted, substituted, or inserted in the sequence is preferably less than 10% of the total number of bases in the double-stranded DNA and the amplification reaction template. The completely identical sequence, i.e., no deletion, substitution, or insertion, is particularly preferred. Furthermore, the deletion, substitution, or insertion in the sequence may occur, for example, excluding the C-terminus of the sequence.
[0054] Thereafter, using the double-stranded DNA generated in step (C4) that is the same as the amplification reaction template, steps (C1) to (C4) are repeated until the reaction is terminated to produce the single-stranded RNA and the double-stranded DNA that is the same as the amplification reaction template.
[0055] As described above, the key feature of the isothermal gene amplification method of the present invention is that it combines the (B) DNA amplification step and the (C) RNA amplification step. Thus, for example, when the (B) DNA amplification step and the (C) RNA amplification step are performed in parallel, it is presumed that the (B) DNA amplification step supplies a template, which is an amplification reaction intermediate (amplicon), and the efficiency of the (C) RNA amplification reaction is improved. However, the present invention is not limited to this presumption.
[0056] Furthermore, the isothermal gene amplification method of the present invention may include, for example, an RNA extraction step of extracting the RNA genome from a sample prior to carrying out the steps (A), (B), and (C). The sample may be, for example, a biological sample collected from a subject or an environmental sample collected from the environment.
[0057] In the present invention, the sample (also referred to as a specimen) is not particularly limited and includes, for example, biological samples such as saliva, nasal aspirate, nasal wash, nasal swab, nasal discharge, throat swab, rinse, whole blood, serum, plasma, sweat, and urine, and is preferably a viscous specimen. The viscous specimen is not particularly limited and includes, for example, saliva, nasal aspirate, nasal wash, nasal swab, nasal discharge, throat swab, and rinse. The specimen is not limited to liquid specimens, and may also be solid specimens dissolved in a buffer solution or the like, such as biological specimens such as cells and feces, and foods such as animal and plant foods and processed foods. The buffer solution is not particularly limited and includes, for example, the aforementioned buffer solutions.
[0058] In the RNA extraction step, the RNA extraction method is not limited in any way, and conventionally known methods such as guanidine isothiocyanate and phenol-chloroform extraction can be used. Alternatively, commercially available RNA extraction reagents can be used.
[0059] <First Kit> As described above, the kit (first kit) used in the isothermal gene amplification method of the present invention comprises the following (a1) to (a3), (b1) to (b3), and (c1). The first kit of the present invention allows the isothermal gene amplification method of the present invention to be carried out easily and conveniently. (a1) the reverse transcriptase; (a2) the first primer; (a3) the second primer; (b1) the recombinase; (b2) the single-stranded DNA binding protein; (b3) the strand-displacing DNA polymerase; (c1) The RNA polymerase.
[0060] The first kit of the present invention is characterized by including the above (a1) to (a3), (b1) to (b3), and (c1), and other configurations and conditions are not particularly limited. In the first kit of the present invention, the reverse transcriptase, the first primer, the second primer, the recombinase, the single-stranded DNA binding protein, the strand-displacing DNA polymerase, and the RNA polymerase are not particularly limited, and the descriptions of the isothermal gene amplification method of the present invention can be cited.
[0061] The first kit of the present invention may include components other than (a1) to (a3), (b1) to (b3), and (c1). Examples of such components include instructions for use. The first kit of the present invention may further include, for example, a substrate such as a dNTP mix (dATP, dTTP, dCTP, dGTP); a buffer solution such as Tris-HCl buffer, Trisine buffer, sodium phosphate buffer, or potassium phosphate buffer; a catalyst such as magnesium chloride, magnesium acetate, or magnesium sulfate; an additive such as dimethyl sulfoxide (DMSO) or betaine (N,N,N-trimethylglycine); a cationic complex; or an enzyme stabilizer. The enzyme stabilizer is not particularly limited and may include, for example, glycerol, bovine serum albumin, or a sugar. Among these, sugars are preferred, and monosaccharides or oligosaccharides are more preferred, and trehalose, sorbitol, or mannitol, or a mixture of two or more thereof, are even more preferred. The first kit of the present invention may further include a melting temperature adjuster. Examples of the melting temperature adjuster include DMSO, betaine, formamide, glycerol, or any combination thereof, and preferably DMSO. In the first kit of the present invention, the ratio of these reagents is not particularly limited and can be appropriately determined by a person skilled in the art. The first kit of the present invention may include, for example, a commercially available reagent. Specific examples of the commercially available reagent include, for example, Twist Amp® Basic Kit (TwistDx).
[0062] In the first kit of the present invention, the reagents (a1) to (a3), (b1) to (b3), and (c1) and the other components may be contained in separate containers or may be contained in the same container. The first kit of the present invention can also be referred to as an isothermal gene amplification reagent for use in the isothermal gene amplification method of the present invention, for example.
[0063] Furthermore, when the isothermal gene amplification method of the present invention includes the RNA extraction step, the first kit of the present invention may further include, for example, a commercially available RNA extraction reagent.
[0064] <Gene detection method> As described above, the gene detection method of the present invention is a gene detection method for detecting a gene of the target sequence in the RNA genome, and includes a gene amplification step and an amplified gene detection step, characterized in that the gene amplification step is carried out by the gene amplification method of the present invention, and other steps and conditions are not limited in any way. For example, the descriptions of the gene amplification method of the present invention and the first kit can be used for the gene detection method of the present invention.
[0065] In the gene detection method of the present invention, the amplified gene detection step is not particularly limited, and any known method for detecting amplified genes, such as agarose gel electrophoresis, can be used, but it is preferably carried out by the first or second gene detection method of the present invention, which will be described later. Specific examples of the amplified gene detection step will be described below, but the amplified gene detection step in the gene detection method of the present invention is not limited to the implementation of the gene detection methods in the following examples.
[0066] <First gene detection method> A specific example of the first gene detection method of the present invention will be described. In the first gene detection method, for example, in the gene amplification step, one of the first primer and the second primer has an antigen incorporated at its 5' end that can specifically bind to an immobilized antibody immobilized on a substrate, and the other of the first primer and the second primer has a first binder incorporated at its 5' end, and in the amplified gene detection step, the antigen of one of the primers in the gene amplification product produced in the gene amplification step binds to the immobilized antibody, thereby immobilizing the gene amplification product on the substrate, and the first binder of the other primer binds to a label containing a second binder that specifically binds to the first binder via the second binder, thereby immobilizing the label on the substrate, and the label moiety immobilized on the substrate is detected.
[0067] In the first gene detection method of the present invention, the detection step can refer to, for example, various steps, conditions, reagents, etc. in a general lateral flow immunoassay (LFIA). Specifically, the first gene detection method of the present invention can be carried out, for example, by the method shown in the Examples below.
[0068] The antigen incorporated into the 5'-terminal of either the first primer or the second primer is not particularly limited, as long as it is a known antigen capable of forming an antigen-antibody complex with an immobilized antibody described below. A specific example of the antigen is digoxin. In the following description, the first primer or the second primer into which the antigen has been incorporated is also referred to as a labeled primer.
[0069] The binding between the 5' end of either the first primer or the second primer and the antigen may be, for example, direct or indirect. Examples of the indirect binding include binding via a linker.
[0070] The immobilized antibody is not particularly limited as long as it is capable of binding to the antigen bound to the first primer or the second primer, i.e., capable of forming the antigen-antibody complex. When the antigen is, for example, digoxin, the antibody can be an anti-digoxin antibody. The method for immobilizing the immobilized antibody on the substrate is not particularly limited, and a conventionally known method can be used, for example, by applying an antibody solution containing the immobilized antibody to the porous body of the substrate using a coating device or the like, and then air-drying the antibody using a dryer or the like.
[0071] The first binder is not particularly limited as long as it is a substance capable of specifically binding to the second binder described below, and examples thereof include biotin or a biotin analog. Examples of the biotin analog include desthiobiotin. In the following description, when the first binder is biotin, the primer into which the first binder is incorporated, of the first primer and the second primer, is also referred to as a biotinylated primer.
[0072] The bond between the 5' side of either the first primer or the second primer and the first conjugate may be, for example, a direct bond or an indirect bond. An example of the indirect bond is a bond via a linker.
[0073] The second binder is not particularly limited as long as it can specifically bind to the first binder, and when the first binder is biotin, the second binder may be, for example, avidin or an avidin analogue. Examples of the avidin analogue include streptavidin and neutravidin.
[0074] The labeling substance is, for example, a colored microparticle having the second binder immobilized on its surface. The colored microparticles are not particularly limited, and examples thereof include colored latex particles, metal colloid particles, colored polymethyl methacrylate particles, colored polylactic acid particles, colored porous glass particles, colored silica particles, colored agarose particles, and colored dextran particles. The colored latex particles are not particularly limited, and examples thereof include blue latex particles and red latex particles. The metal colloid particles are not particularly limited, and examples thereof include gold colloid particles and platinum colloid particles. The average particle diameter of the colored insoluble carrier particles is not particularly limited, and in the case of the colored latex particles, it is, for example, in the range of 0.05 μm to 5 μm, preferably in the range of 0.1 μm to 1 μm, and in the case of the metal colloid particles, it is, for example, in the range of 2 nm to 100 nm, preferably in the range of 10 nm to 50 nm.
[0075] The substrate can be, for example, a substrate used in a known lateral flow immunoassay. The substrate includes, for example, a support, a porous membrane (a porous body), a conjugate pad, and a sample pad. The porous membrane, shorter than the support, is disposed on the support, the conjugate pad is disposed at one end of the surface of the porous membrane, and the sample pad is disposed at the other end of the conjugate pad opposite the end where the porous membrane is disposed. The sample pad is a sample supply section to which a sample containing the gene amplification product produced in the gene amplification step is supplied, and the sample pad side is upstream of the sample flow. On the surface of the porous membrane, detection sections to which the immobilized antibodies are immobilized are formed in order from the upstream side, and an absorbent pad, for example, is disposed at the other end opposite the end where the conjugate pad is disposed. The conjugate pad may be entirely or partially disposed on the porous membrane. The sample pad may be entirely placed on the conjugate pad, or only a portion of the sample pad may be placed on the conjugate pad.
[0076] The material of the support is not particularly limited, and examples thereof include polyethylene terephthalate, polyethylene, polystyrene, polyester, cellulose acetate, etc. The shape of the support is not particularly limited, and examples thereof include a film, a sheet, a plate, etc. The shape and size of the support are not particularly limited, and can be appropriately set depending on other components, etc.
[0077] The porous membrane is not particularly limited as long as it exhibits capillary action, and examples thereof include cellulose membranes, cellulose acetate membranes, cellulose nitrate membranes, and other cellulose derivative membranes, glass filters, and filter paper. In the present invention, the shape of the porous membrane is not particularly limited, and examples thereof include rectangular and circular membranes. In the present invention, the size of the porous membrane is not particularly limited and can be appropriately determined. In the present invention, the porous body is not limited to the porous membrane, and may be, for example, granular substances or fine particle powders such as polymer beads, glass beads, titanium dioxide, cellulose, salts, and hydrophobized polysaccharides, and is not particularly limited as long as it has a porous structure. In the present invention, the shape and size of the porous body are not particularly limited and can be appropriately determined. The porous membrane can be placed on the support by a conventional method, and specifically, it can be fixed to the support using double-sided tape or an adhesive.
[0078] The material of the conjugate pad is not particularly limited and may be, for example, polyethylene, glass fiber, rayon, nylon, paper, cellulose, etc. The shape and size of the conjugate pad are not particularly limited and may be appropriately determined. The conjugate pad retains, for example, the labeled substance containing the second conjugate.
[0079] A specific example of the first gene detection method of the present invention will be described with reference to Fig. 2. Fig. 2 is a schematic diagram showing the main steps of extracting RNA from a saliva sample of a subject and detecting genes by the first gene detection method of the present invention.
[0080] First, a saliva sample is collected from a subject using a saliva sample collection tube (e.g., SalivaBio Oral Swab (trade name), Salimetrics, LLC.) (Step-1). Next, a commercially available RNA extraction reagent (e.g., NP40 detergent-containing buffer) is added to the saliva sample and mixed to dissolve virus particles and extract RNA (Step-2). Next, the dissolved sample is mixed with the first kit of the present invention to carry out the gene amplification step. The gene amplification step can be carried out, for example, at 41°C for 15 minutes. Then, the sample containing the amplification product generated in the gene amplification step is applied to a substrate (also called a lateral flow dipstick (LFD)) on which an antibody that specifically binds to the antigen bound to the first or second primer is immobilized. If the saliva sample contains a target sequence of the target genomic RNA, the antigen of the labeled primer in the amplification product will bind to the immobilized antibody on the substrate. Then, the biotin incorporated in the biotinylated primer in the amplification product reacts with the streptavidin-conjugated label in the LFD, causing the detection unit to develop color due to the label. Therefore, whether or not the sample contains a target sequence can be determined based on the presence or absence of color development in the detection unit, i.e., the target gene in the sample can be detected.
[0081] <Kit used in the first gene detection method> (Second kit) A kit (second kit) used in the first gene detection method of the present invention comprises the following (a1) to (a3), (b1) to (b3), (c1), and (d1) to (d3). The second kit of the present invention allows, for example, the first gene detection method of the present invention to be carried out easily. (a1) the reverse transcriptase; (a2) the first primer; (a3) the second primer; (b1) the recombinase; (b2) the single-stranded DNA binding protein; (b3) the strand-displacing DNA polymerase; (c1) the RNA polymerase; (d1) the immobilized antibody; (d2) substrate; (d3) Labeled material.
[0082] The second kit of the present invention is characterized by including the above-mentioned ((a1) to (a3), (b1) to (b3), (c1), and (d1) to (d3), and other configurations and conditions are not particularly limited. In the second kit of the present invention, the reverse transcriptase, the first primer, the second primer, the recombinase, the single-stranded DNA binding protein, the strand-displacing DNA polymerase, the RNA polymerase, the immobilized antibody, the substrate, and the label are not particularly limited, and the descriptions of the isothermal gene amplification method, the first kit, and the first gene detection method of the present invention can be cited. The second kit of the present invention is also referred to as a gene detection reagent for use in, for example, the gene detection method of the present invention.
[0083] <Second gene detection method> In the second gene detection method of the present invention, for example, in the detection step, if the current values of both electrodes are higher than a predetermined reference current value within a specific voltage range, a positive judgment is made that the target sequence nucleic acid is present in the genome, and if the current values of both electrodes are lower than the reference current value, a negative judgment is made that the target sequence nucleic acid is not present in the genome.
[0084] In the second gene detection method of the present invention, the detection step may be performed by measuring the current between the two electrodes in the presence of a probe nucleic acid that can specifically and complementarily bind to the amplification product, and the probe nucleic acid may be a probe nucleic acid having a gold-coated magnetic particle bound to one end thereof and the redox substance bound to the other end thereof.
[0085] In the second gene detection method of the present invention, the redox substance is, for example, methylene blue.
[0086] Figure 3 illustrates the principle of the detection process in the second gene detection method. DEPSOR (Disposable Electrochemical Printed Sensor) is a technology developed by the present inventors. Figure 3 shows two detection modes. One mode uses a probe nucleic acid, with gold-coated magnetic nanoparticles (AuMNP) bound to one end of the probe nucleic acid and a redox substance (methylene blue, MB) bound to the other end. The probe nucleic acid has a complementary sequence that specifically binds to the amplified product in the gene amplification process. The electron tunneling effect caused by the interaction between gold and the redox substance can be adjusted by the length of the probe nucleic acid. When a voltage is applied between the working and counter electrodes in the presence of the probe nucleic acid, the value of the current flowing between the two electrodes changes depending on the presence or absence of the target sequence in the amplified product. This change can be used to determine the presence or absence (positive or negative) of the target sequence. In the other mode, when a redox substance (MB) is present, a voltage is applied to the working electrode and the counter electrode. The current flowing between the two electrodes changes depending on whether the redox substance binds (e.g., intercalates) to the complementary double-stranded portion formed in the amplified product. This change can be used to determine whether the target sequence is present or absent (positive or negative).
[0087] <Kit used in the second gene detection method> (Third kit) A kit used in the second gene detection method of the present invention (hereinafter also referred to as the "third kit") comprises the following (a1) to (a3), (b1) to (b3), (c1), (d1), and (d2). The third kit of the present invention allows, for example, the second gene detection method of the present invention to be carried out easily. (a1) the reverse transcriptase; (a2) the first primer; (a3) the second primer; (b1) the recombinase; (b2) the single-stranded DNA binding protein; (b3) the strand-displacing DNA polymerase; (c1) the RNA polymerase; (d1) Working electrode and counter electrode; (d2) a redox substance or a nucleic acid probe that binds to the double-stranded portion of the amplification product;
[0088] The third kit of the present invention is characterized by including the above (a1) to (a3), (b1) to (b3), (c1), (d1), and (d2), with other configurations and conditions not being particularly limited. In the third kit of the present invention, the reverse transcriptase, the first primer, the second primer, the recombinase, the single-stranded DNA binding protein, the strand-displacing DNA polymerase, the RNA polymerase, the working electrode and counter electrode, and the redox substance or nucleic acid probe that binds to the double-stranded portion of the amplified product are not particularly limited, and the descriptions of the isothermal gene amplification method, the first kit, and the second gene detection method of the present invention can be used. The third kit of the present invention may also be referred to as a gene detection reagent for use in the gene detection method of the present invention, for example.
[0089] <Virus detection method> The virus detection method of the present invention is a method for detecting an RNA virus, The method for detecting an RNA virus is a method for detecting a sequence specific to the RNA virus in the viral genome as a target sequence, and is characterized in that the detection of the target sequence is carried out by the gene detection method of the present invention.
[0090] The virus detection method of the present invention is characterized in that the detection of the target sequence is carried out by the gene detection method of the present invention, and, for example, other steps and conditions are not particularly limited. For the target sequence detection step in the virus detection method of the present invention, for example, the descriptions of the isothermal gene amplification method and the gene detection method of the present invention can be used.
[0091] <Virus detection kit> The virus detection kit of the present invention is a detection kit used in the virus detection method of the present invention, characterized by including the second kit or third kit of the present invention, and other configurations are not particularly limited. For the virus detection kit of the present invention, for example, the descriptions of the isothermal gene amplification method, first kit, first and second gene detection methods, second kit, third kit, and virus detection method of the present invention can be used. The virus detection kit of the present invention is also referred to as a virus detection reagent for use in the virus detection method of the present invention, for example. [Example]
[0092] Next, examples of the present invention will be described. However, the present invention is not limited to the following examples. Commercially available reagents were used according to their protocols unless otherwise specified.
[0093] [Example 1] It was confirmed that the target sequence can be amplified by the amplification method of the present invention.
[0094] (1) Preparation of RNA genome samples The sequence of the SARS-CoV-2 nucleocapsid gene (N gene) was identified from GenBank (accession number Mn908947), and a 134-nt single-stranded DNA fragment corresponding to the RNA sequence at positions 28707-28840 was synthesized in vitro using standard methods. A T7 RNA polymerase promoter sequence was added to the end of the DNA fragment, and a double-stranded DNA construct was synthesized by overlap extension PCR using the following DNA oligomers (overlap extension primers 1-3, SEQ ID NOs: 3-5, purchased from Eurofins Genomics, Tokyo, Japan). RNA transcripts were synthesized from the double-stranded DNA construct using a cell-free transcription kit (RiboMAX, Promega) and purified using a commercially available RNA purification kit (RNeasy, Qiagen). The concentration of the purified RNA transcript was measured using a spectrophotometer (Nanodrop ND-2000, Thermo Fisher Scientific, Waltham, MA) and was 100%.9 The standard template was serially diluted from 0.01 to 1 RNA copy / μl in TE buffer to prepare SARS-CoV-2 sense and antisense RNA genome samples (406 nt). The target sequence (SEQ ID NO: 6) in the prepared RNA genome sample is shown in Figure 4. Overlap extension primer 1 (forward primer, SEQ ID NO: 3) 5´- aaaatgaaag atctcagtcc aagatggtat ttctactacc taggaactgg gccagaagct ggacttccct atggtgctaa caaagacggc atcatatggg ttgcaactga gggagccttg -3´ Overlap extension primer 2 (forward primer, SEQ ID NO: 4) 5´- ttgcaactga gggagccttg aataacaccaa aagatcacat tggcacccgc aatcctgcta acaatgctgc aatcgtgcta caacttcctc aaggaacaac attgccaaaa ggcttctacg cagaagggag cagaggcggc agtcaagcct cttctcgttc ctcatcacgt agtcgcaaca gttcaagaaa ttcaactcca -3´ Overlap extension primer 3 (reverse primer, SEQ ID NO: 5) 5´- tgctctcaag ctggttcaat ctgtcaagca gcagcaaagc aagagcagca tcaccgccat tgccagccat tctagcagga gaagttcccc tactgctgcc tggagttgaa tttcttgaac -3´
[0095] 4 is a schematic diagram showing the location in the SARS-CoV-2 genome of the target sequence (SEQ ID NO: 6, 134 nt) in the RNA genome of SARS-CoV-2 in this example, and the positions where the target sequence hybridizes with each primer in the following primer sets 1 and 2. In the nucleotide sequences of the primers shown below, the underlined sequence is the T7 promoter sequence. Target sequence in the RNA genome of SARS-CoV-2 (SEQ ID NO: 6, 134 nt) cacattggcacccgcaatcctgctaacaatgctgcaatcgtgctacaacttcctcaaggaacaacattgccaaaaggcttctacgcagaagggagcagaggcggcagtcaagcctcttctcgttcctctctccc Primer set 1 Forward primer 1 (SEQ ID NO: 7) 5´-CACATTGGCA CCCGCAATC-3´ Reverse primer 2 (SEQ ID NO: 8) 5´- AATTCTAATACGACTCACTATAGGGAGA GAGGAACGAGAAGAGGCTTG-3´ Primer set 2 Forward primer 3 (SEQ ID NO: 9) 5´- AATTCTAATACGACTCACTATAGGGAGA CACATTGGCACCCGCAATC-3´ Reverse primer 4 (SEQ ID NO: 10) 5´-GAGGAACGAGAAGAGGCTTG-3´
[0096] (2) (A) DNA amplification step to increase the amplification reaction template First, for the SARS-CoV-2 sense RNA genome sample prepared in (1) above, the amount of the genome sample was 20 ng (0.87 × 10 11 ), 20pg (0.87 × 10 8 ), 20fg (0.87 × 10 5) to prepare genome samples. Next, 5.0 μl of substrate stock solution, 5 μl of primer stock solution, and 2.5 μl of each concentration of sense RNA genome sample were placed in a PCR tube, mixed, and incubated at 65°C for 5 minutes, followed by an additional 5 minutes at 41°C to prepare a reaction mixture. The substrate stock solution consisted of 17.6 μl of nuclease-free water (NFW), 5.6 μl of 1 M MgCl2, 19.8 μl of 1.9 M Tris HCl (pH 8.6), 0.6 μl of 40 U / μl RNase Inhibitor, 3.3 μl of 100 mM DTT, 41.3 μl of 2.0 mM dNTPs, 17.1 μl of 58 mM NTPs, and 4.8 μl of 250 mM ITP. The composition of the primer stock solution was 32.5 μl of NFW, 21.5 μl of 2 M KCl, 6.6 μl of 50 μM sense forward primer (the forward primer 1), 6.6 μl of 50 μM antisense reverse primer containing a T7 promoter in the 5' sequence (the reverse primer 2), and 42.9 μl of dimethyl sulfoxide.
[0097] Then, 2.5 μl of enzyme stock solution was added to the reaction mixture to initiate the reaction, and the reaction was carried out for 10 to 30 minutes at 41° C. The enzyme stock solution contained 4.0 μl of 10 mg / ml Bovine Serum Albumin, 4.4 μl of 20,000 unit / ml AMV Reverse Transcriptase (Life Sciences Inc, Petersburg, FL), 11.1 μl of 60% Sorbitol, and 35.5 μl of T7 RNA Polymerase Solution (Toyobo).
[0098] (3) (B) DNA amplification step and (C) RNA amplification step The (B) DNA amplification step and (C) RNA amplification step were performed using commercially available reagents (TwistAmp® Basic Kit (TwistDx, Cambridge, MA)). Specifically, each of the resulting amplification products was mixed with 5 μl of primer mix (10 μM digoxin-modified sense / forward primer and 10 μM biotin-modified antisense / reverse primer) and 29.5 μl of primer-free supplement buffer. Next, the resulting mixture (49.5 μl) was added with the dried enzyme pellet provided with the TwistAmp® Basic Kit, and then 2.5 μl of 280 mM magnesium acetate was added to initiate the reaction. The mixture was then incubated at 41°C for 10 minutes. The amplified products were then analyzed using a 1-inch 6% denaturing polyacrylamide gel (ref) and stained with SYBR Gold. Digoxin-modified sense / forward primer (SEQ ID NO: 11) 5´-Digoxigenin-CACATTGGCA CCCGCAATC-3´ Biotin-modified antisense / reverse primer (SEQ ID NO: 12) 5´-Biotin-GAGGAACGAGAAGAGGCTTG-3´
[0099] In addition, the amplification product in step (2) was analyzed using a 1-inch 6% denatured polyacrylamide gel (ref) and SYBR Gold staining without undergoing the amplification step (3) (the (B) DNA amplification step and (C) RNA amplification step in the amplification method of the present invention), and this was designated Comparative Example 1.
[0100] The results are shown in Figure 5. Figure 5 is a photograph showing a gel image of the amplified products after the reaction. In Figure 5, the leftmost lane is a DNA marker lane, the second to fourth lanes from the left are lanes showing the amplification results of Comparative Example 1-1, and the fifth to seventh lanes from the left are lanes showing the amplification results of Example 1-1. In each of the lanes showing Comparative Example 1-1 and Example 1-1, 20 ng (0.87 x 10 11), lane containing 20 pg (0.87 × 10 8 ), lane containing 20 fg (0.87 × 10 5 5, the amplification results of Comparative Example 1-1 show that the genomic RNA was 20 pg (0.87 × 10 8 ), neither the band at the position of 134 nt, which indicates the RNA amplification product of the target sequence in the genomic RNA, nor the band at the position of 156 nt, which indicates the DNA amplification product of the target sequence, can be confirmed. In contrast, in Example 1-1, in which the amplification method of the present invention was used, when the genomic RNA was 20 fg (0.87 × 10 5 Even with such a small amount of genomic RNA, both a band at 134 nt, which indicates an RNA amplification product of the target sequence, and a band at 156 nt, which indicates a DNA amplification product of the target sequence, were confirmed. This demonstrates that the gene detection method using the isothermal gene amplification method of the present invention has an extremely low limit of detection (LOD) for genomic RNA and can detect target sequences with high sensitivity.
[0101] The amplification method of the present invention was also carried out in the same manner, except that the amount of genomic RNA was further diluted until it reached 20 ag (87).
[0102] The results are shown in Figure 6. Figure 6 is a photograph showing a gel image of the amplified product after the reaction. In Figure 6, the leftmost lane is a DNA marker lane, the second lane from the left is a lane that was not subjected to post-amplification treatment, the third lane from the left is a lane in which 5 μl of the amplified product was treated with DNase at 37°C for 15 minutes after adding 0.5 U of RQ1 RNase-Free DNase (Promega), and the fourth lane from the left is a lane in which 5 μl of the amplified product was treated with RNase at 37°C for 20 minutes after adding 2.5 U of RNase H (Thermo Scientific) and 2.5 U of RNase ONE Ribonuclease (Promega). As shown in Figure 6, according to the amplification method of the present invention, even with a very small amount of genomic RNA (20 ag(87)), both a band at 134 nt, indicating an RNA amplified product of the target sequence in the genomic RNA, and a band at 156 nt, indicating a DNA amplified product of the target sequence, were confirmed. This demonstrates that the gene detection method using the isothermal gene amplification method of the present invention has an extremely low limit of detection (LOD) for genomic RNA and can detect target sequences with high sensitivity.
[0103] Next, the amount of genomic RNA was increased to 20 ng (0.87 × 10 11 ) and the influence of the presence or absence of the reverse primer 2 (SEQ ID NO: 8) on the amplification method of the present invention was confirmed.
[0104] The results are shown in Figure 7. Figure 7 is a photograph showing a gel image of the amplification product after the reaction. In Figure 7, the leftmost lane is a DNA marker lane, the second lane from the left is a lane without a primer set (negative control), the third lane from the left is a lane in which the amplification method of the present invention was performed without reverse primer 2, and the fourth lane from the left is a lane in which the amplification method of the present invention was performed with reverse primer 2. As shown in Figure 7, in the absence of reverse primer 2, neither the band at 134 nt indicating the RNA amplification product of the target sequence nor the band at 156 nt indicating the DNA amplification product of the target sequence was observed. However, in the presence of reverse primer 2, both the band at 134 nt indicating the RNA amplification product of the target sequence and the band at 156 nt indicating the DNA amplification product of the target sequence were observed. This demonstrates the importance of using primers containing a T7 promoter sequence in the amplification method of the present invention.
[0105] [Example 2] It was confirmed that the isothermal gene amplification method of the present invention can detect genes even in the presence of a saliva sample.
[0106] Instead of the SARS-CoV-2 nucleocapsid gene, the sequence of the CoV-229E spike protein gene (S gene) was identified from GenBank (accession number KU291448), and a 135-nt single-stranded DNA fragment corresponding to the RNA sequence from bases 25151 to 25285 was synthesized in vitro using standard methods. A CoV-229E RNA genome sample (135 nt) was prepared in the same manner as in Example 1(1), except that the DNA oligomer shown below was used. The target sequence (SEQ ID NO: 13) in the prepared RNA genome sample is shown in Figure 8. Overlap extension primer 4 (forward primer, SEQ ID NO: 14) 5´- gctaattggg actctaattg ggcctttgtt gcatttagct tccttatggc cgtatcaaca ctcgttatgt gggtgatgta ctttgcaaat agtttcagac ttttccgacg tgctcgaact ttttgggcat ggaatcctga ggttaatgca atcactgtca -3´ Overlap extension primer 5 (reverse primer, SEQ ID NO: 15) 5´- gtattcaggt aggttatgaa cctgaacacc tgaagccaat ctatgtccgt caacgtaaag cacgccgctc aacaaggtca cagtaatgcc tgttggagct tgttgaatgg gttgatagta tgtctgtccc aacacggttg tgacagtgat tgcattaacc -3´
[0107] 8 is a schematic diagram showing the location of the target sequence (SEQ ID NO: 13, 135 nt) in the RNA genome of CoV-229E in this example and the hybridization position of the target sequence with the following primer set 3. In the following base sequence, the underlined sequence is the T7 promoter sequence. Target sequence in the RNA genome of CoV-229E (SEQ ID NO: 13, 135 nt) ttttccgacg tgctcgaact ttttgggcat ggaatcctga ggttaatgca atcactgtca caaccgtgtt gggacagaca tactatcaac ccattcaaca agctccaaca ggcattactg tgaccttgtt gagcg Primer set 3 Forward primer 5 (SEQ ID NO: 16) 5´-TTTTCCGACGGTGCTCGAACTTTTTG-3´ Reverse primer 6 (SEQ ID NO: 17) 5´- AATTCTAATACGACTCACTATAGGGAGA CGCTCAACAAGGTCACAGTAATGCC-3´
[0108] The isothermal gene amplification method of the present invention (Example 2) was carried out in the same manner as in (2) and (3) of Example 1, except that the RNA genome of CoV-229E was used instead of the RNA genome of SARS-CoV-2, the primer set 3 was used instead of the primer set 1, and a saliva sample was added at 5% by weight of the total weight of the reaction solution. The amount of genomic RNA was 20 pg (0.87 × 10 8 In addition, the amplification product in the step (2) was analyzed using a 1-inch 6% denatured polyacrylamide gel (ref) and SYBR Gold staining without being subjected to the amplification step (3) (the (B) DNA amplification step and (C) RNA amplification step in the amplification method of the present invention), and this was designated Comparative Example 2.
[0109] The results are shown in Figure 9. Figure 9 is a photograph showing a gel image of the amplification products after the reaction. In Figure 9, the leftmost lane is a DNA marker lane, the second to fourth lanes from the left are lanes showing the amplification results of Comparative Example 2, and the fifth to seventh lanes from the left are lanes showing the amplification results of Example 2. In the lanes showing Comparative Example 1 and Example 1, from left to right, a lane containing no genomic RNA (negative control), a lane containing no saliva sample (Comparative Example 2-1, Example 2-1), and a lane containing 5% saliva sample (Comparative Example 2-2, Example 2-2) are shown. 9, in the amplification results of the comparative example, in the presence of a saliva sample, neither the band at 135 nt indicating the RNA amplification product of the target sequence nor the bands at 163 and 129 nt indicating the DNA amplification product of the target sequence were observed, whereas in Example 2 using the amplification method of the present invention, both the band at 135 nt indicating the RNA amplification product of the target sequence and the bands at 163 and 129 nt indicating the DNA amplification product of the target sequence were observed even in the presence of a saliva sample. This demonstrates that the gene detection method using the isothermal gene amplification method of the present invention can detect target sequences regardless of the presence or absence of a saliva sample.
[0110] [Example 3] It was confirmed that the amplification products amplified by the isothermal gene amplification method of the present invention can be detected by lateral flow immunoassay.
[0111] The amplification product in Example 1 was subjected to a lateral flow immunoassay using a lateral flow dipstick (LFD). Details of the LFD are shown in Figure 10(A). As shown in Figure 10(A), the LFD was prepared by attaching a cover (manufactured by BioSeeds) having a sample application section and a detection section to a substrate (lateral flow strip (manufactured by Asahi Kasei Corporation)) including a conjugate pad containing gold colloid-labeled streptavidin and a membrane filter on which anti-digoxin antibodies were immobilized. Then, 20 pg (0.87 x 10) of the amplification product in Example 1 was added to 90 µL of NFW. 8 5 μl of the amplification product of the genomic RNA sample (10 μl) or 5 μl of a negative control (amplified product not containing the genomic RNA sample) was added, and the mixture was then applied to the sample pad on the LFD strip. The mixture was then left to stand for 5 to 10 minutes, and the success or failure of detection was determined based on the presence or absence of color development in the detection zone of the LFD. The results are shown in Figure 10.
[0112] As shown in Figure 10, 20 pg (0.87 × 10 8 A detection line indicated by an arrow appeared in the detection section of the LFD to which the amplified product of the genomic RNA sample (2) was applied, but no detection line appeared in the detection section of the LFD to which the amplified product of the negative control was applied. This demonstrates that the isothermal gene amplification method of the present invention can amplify minute amounts of genomic RNA contained in a sample and detect it using LF.
[0113] [Example 4] It was confirmed that the isothermal gene amplification method of the present invention can be carried out in one vessel (one-pot reaction), from RNA extraction from a sample.
[0114] (1) Primer design The sequence of E. coli 16s rRNA was identified from GenBank (accession number J01859.1), and a 204-nt single-stranded DNA fragment corresponding to the RNA sequence from bases 415 to 618 was synthesized in vitro using standard methods to prepare an RNA genome sample of E. coli 16s rRNA. The primer sequences shown in Figure 11 below were then designed using the RNA sequence from bases 415 to 618 of the 16s rRNA as the target sequence.
[0115] 11 is a schematic diagram showing the hybridization positions of the target sequence (SEQ ID NO: 18, 204 nt) in the RNA genome of the 16s rRNA in this example and each primer in the following primer set 4. In the following base sequence, the underlined sequence is the T7 promoter sequence. E. coli 16S rRNA target sequence (SEQ ID NO: 18) ggccttcgggttgtaaagtactttcagcggggaggaagggagtaaagttaatacctttgctcattgacgttacccgcagaagaagcaccggctaactccgt gccagagccgcggtaatacggagggtgcaagcgttaatcggaattactgggcgtaaagcgcacgcaggcggtttgttaagtcagatgtgaaatccccgggct Primer set 4 Forward primer 7 (SEQ ID NO: 19) 5´-AGCCCGGGGATTTCACATC-3´ Reverse primer 8 (SEQ ID NO: 20) 5´- AATTCTAATACGACTCACTATAGGGAGA GGCCTTCGGGTTGTAAAGTAC -3´
[0116] (2) RNA extraction A commercially available nonpathogenic E. coli test strain (NBRC 3301) was obtained from the NITE Biological Resource Center, Japan, and cultured in L broth at 37°C for 24 hours. The cell count (CFU per mL) in serially diluted bacterial cultures was determined using a JuLI-smart fluorescent cell analyzer (Digital Bio, NanoEnTek, USA) and a hemocytometer (Thermofisher). The E. coli cell count was 7.3 × 10 8 The cultures were serially diluted to a concentration of ~8.6 CFU / μL. Cells were then harvested from 1 mL of each culture by centrifugation at 15,000 × g for 5 minutes, disrupted by sonication, and RNA was extracted from the E. coli by treatment with NP40 reagent (Surfact-Amps NP-40, Thermo Scientific). The solution was then centrifuged at 15,000 × g for 5 minutes to sediment the cell debris. The supernatant was used directly as a template for isothermal amplification reactions and stored at -20°C until use.
[0117] (3) (A) DNA amplification step to increase the amplification reaction template 12(A), 5.0 μl of the substrate stock solution used in Example 1(2), 5 μl of the primer stock solution, and 0.625 μl of human saliva were added to the supernatant containing RNA extracted from E. coli, and the mixture was incubated at 65°C for 5 minutes, followed by another 5 minutes at 41°C to prepare a reaction mixture. The composition of the primer stock solution was the same as that of the previous example, except that forward primer 1 and reverse primer 2 were replaced with forward primer 7 and reverse primer 8. 2.5 μl of the enzyme stock solution was added to the reaction mixture to initiate the reaction, which was then allowed to proceed at 41°C for 10 minutes.
[0118] (4) (B) DNA amplification step and (C) RNA amplification step The reaction mixture (A) was mixed with 5 μL of primer mix (10 μM digoxin-modified sense / forward primer and 10 μM biotin-modified antisense / reverse primer) and 29.5 μL of primer-free supplement buffer. The resulting mixture (49.5 μL) was then mixed with the dried enzyme pellet included in the TwistAmp® Basic Kit, followed by 2.5 μL of 280 mM magnesium acetate to initiate the reaction. The mixture was then incubated at 41°C for 10 minutes. The amplified product was then analyzed using a 1-inch 6% denaturing polyacrylamide gel (ref) and SYBR Gold staining, as shown in Example 4. Digoxin-modified sense / forward primer (SEQ ID NO: 21) 5´-Digoxigenin-GGCCTTCGGGTTGTAAAGTACTTTCAGC-3´ Biotin-modified antisense / reverse primer (SEQ ID NO: 22) 5´-Biotin-AGCCCGGGGATTTCACATCTGACTTA-3´
[0119] In addition, the amplification product in step (3) was analyzed using a 1-inch 6% denatured polyacrylamide gel (ref) and SYBR Gold staining without undergoing the amplification step (4) (the (B) DNA amplification step and (C) RNA amplification step in the amplification method of the present invention), and this was designated Comparative Example 4.
[0120] The results are shown in Figure 12(B). Figure 12(B) is a photograph showing a gel image of the amplified product after the reaction. In Figure 12(B), the gel image on the left is a photograph showing the results of Comparative Example 4, and the gel image on the right is a gel image showing the results of Example 4. In the gel image showing the results of Comparative Example 4, from the left, there is a lane for the DNA marker, a lane for the number of Escherichia coli cells as the template, 7.3 x 10 8 CFU / µL lane, 9.9 x 10 6 CFU / µl lane, 13.7 x 10 4 CFU / µl lane, 9.5 x 10 2In the gel image showing the results of Example 4, from the left, there are a lane with a DNA marker, a lane without E. coli (negative control), and a lane with a template E. coli cell count of 9.9 × 10 6 CFU / µl lane, 13.7 x 10 4 CFU / µl lane, 9.5 x 10 2 The lanes show 8.6 CFU / μL and 8.6 CFU / μL. As shown in Figure 12(B), in the amplification results of the comparative example, in the presence of saliva, neither the band at 204 nt, which indicates the RNA amplification product of the target sequence, nor the band at 226 nt, which indicates the DNA amplification product of the target sequence, was observed. In contrast, in Example 4, which used the amplification method of the present invention, even with a very small amount of template E. coli cells (8.6 CFU / μL), both the band at 204 nt, which indicates the RNA amplification product of the target sequence, and the band at 226 nt, which indicates the DNA amplification product of the target sequence, were observed. This demonstrates that the isothermal gene amplification method of the present invention can be used to perform the steps from sample RNA extraction to detection in a one-pot reaction.
[0121] [Example 5] The conditions for the (C) RNA amplification step of the isothermal gene amplification method of the present invention were examined.
[0122] 5.0 μl of the substrate stock solution, 5 μl of the primer stock solution, and 2.5 μl of the antisense RNA genome sample (20 ng (0.87 × 10 11)) were mixed in a PCR tube and incubated at 65° C. for 5 minutes, followed by an additional 5 minutes at 41° C. to prepare a reaction mixture. The substrate stock solution consisted of 17.6 μl of nuclease-free water (NFW), 5.6 μl of 1 M MgCl2, 19.8 μl of 1.9 M Tris HCl (pH 8.6), 0.6 μl of 40 U / μl RNase Inhibitor, 3.3 μl of 100 mM DTT, 41.3 μl of 2.0 mM dNTPs, 17.1 μl of 58 mM NTPs, and 4.8 μl of 250 mM ITP. The primer stock solution consisted of 32.5 μl of NFW, 21.5 μl of 2 M KCl, 6.6 μl of 50 μM sense forward primer (Forward Primer 1 described below), 6.6 μl of 50 μM antisense reverse primer containing a T7 promoter in its 5'-terminal sequence (Reverse Primer 2 described below), and 42.9 μl of dimethyl sulfoxide. Hereinafter, the combination of Primers 1 and 2 is also referred to as Primer Set 1. A test system was also simultaneously conducted in which the sense genome sample was used instead of the antisense genome sample, and the primer stock solution contained a combination of Forward Primer 3 and Reverse Primer 4 described below (Primer Set 2) instead of Primer Set 1. In the nucleotide sequences of Primers 1 to 4 described below, the underlined sequence is the T7 promoter sequence. Primer set 1 Forward primer 1 (SEQ ID NO: 7) 5´-CACATTGGCA CCCGCAATC-3´ Reverse primer 2 (SEQ ID NO: 8) 5´- AATTCTAATACGACTCACTATAGGGAGA GAGGAACGAGAAGAGGCTTG-3´ Primer set 2 Forward primer 3 (SEQ ID NO: 9) 5´- AATTCTAATACGACTCACTATAGGGAGA CACATTGGCACCCGCAATC-3´ Reverse primer 4 (SEQ ID NO: 10) 5´-GAGGAACGAGAAGAGGCTTG-3´
[0123] The reaction was initiated by adding 2.5 μl of enzyme stock solution to the reaction mixture and allowed to proceed at 41°C for 10 to 30 minutes. The enzyme stock solution consisted of 4.0 μl of 10 mg / ml Bovine Serum Albumin, 4.4 μl of 20,000 unit / ml AMV Reverse Transcriptase (Life Sciences Inc, Petersburg, FL), 11.1 μl of 60% Sorbitol, and 35.5 μl of T7 RNA Polymerase Solution (Toyobo). The amplified products were analyzed on a 1-inch 6% denaturing polyacrylamide gel (ref) using SYBR Gold staining.
[0124] The results are shown in Figure 13. Figure 13 is a photograph showing a gel image of the amplification products after the reaction. In Figure 13, the leftmost lane is a DNA marker lane, the second to fourth lanes from the left are lanes showing the results of antisense RNA sample amplification using Primer Set 1, and the fifth to seventh lanes from the left are lanes showing the results of sense RNA sample amplification using Primer Set 2. In the lanes showing Primer Sets 1 and 2, from left to right, the presence or absence of post-reaction treatment is indicated, with DNase- and RNase-free lanes, DNase-treated lanes, and RNase-treated lanes. As shown in Figure 13, whether the target was antisense genomic RNA or sense genomic RNA, a clear band was observed at 134 nt, confirming amplification of the target sequence. Furthermore, in the amplification results of the antisense RNA sample, a clear band was observed at 134 nt, confirming significant amplification of the target sequence. On the other hand, in the amplification of the sense RNA sample, although amplification of the target sequence was confirmed, the reaction results were weaker than those of the antisense RNA sample. Therefore, it has been suggested that in the gene amplification method of the present invention, for example, it is preferable that the target RNA genome is a sense strand, the first primer is an antisense primer, and the second primer is a sense primer.
[0125] Next, the antisense RNA and primer set 1 were used to prepare 20 ng (0.87 × 10 11 ) to 20 fg (0.87 × 10 5 The limit of detection (LOD) using the antisense RNA and primer set 1 was confirmed in the same manner, except that the antisense RNA was serially diluted to 1000 kJ / ml.
[0126] The results are shown in Figure 14. Figure 14 is a photograph showing a gel image of the amplified products after the reaction. In Figure 14, the leftmost lane is a DNA marker lane, the second lane from the left is a lane containing no antisense RNA (0 ng), and the third lane from the left is a lane containing 20 fg (0.87 x 10 5 ), and the fourth lane from the left contains 20 pg (0.87 × 10) of antisense RNA. 8 ), and the fifth lane from the left contains 20 ng (0.87 × 10) of antisense RNA. 11 As shown in Figure 14, the amplification results of the antisense RNA sample by the RNA-specific amplification assay showed that the target antisense RNA was 20 fg (0.87 x 10 5 ) was found to be the detection limit.
[0127] Next, the antisense RNA and primer set 1 were used to prepare 20 ng (0.87 × 10 11 ) and the amplification results were confirmed in the same manner except that the reaction temperature was changed from 37°C to 43°C and the reaction time was changed from 10 minutes to 30 minutes.
[0128] The results are shown in Figure 15. Figures 15(A) and (B) are photographs showing gel images of the amplified products after the reaction. In Figure 15(A), the leftmost lane is the DNA marker lane, and the numbers above each lane indicate the combination of reaction temperature (Reaction Temp. (°C)) and reaction time (Reaction Time (min)). As shown in Figure 15(A), at all reaction temperatures, the band of the target sequence (134 nts) became thicker when the reaction time was increased from 10 to 20 minutes, indicating that the amplification efficiency improved as the reaction time increased. We also found that a reaction temperature of 41°C was suitable for amplifying the SARS-CoV-2 RNA genome.
[0129] Figure 15(B) is a gel image showing the difference in results between the presence and absence of a genome sample at a reaction temperature of 41°C for 10 or 30 minutes. The leftmost lane shows the DNA marker, the second and third lanes from the left show the results for the negative control (no RNA genome sample) with a reaction time of 10 or 30 minutes, and the third and fourth lanes show the results for the negative control (no RNA genome sample) with a reaction time of 10 or 30 minutes. As shown in Figure 15(B), when the reaction time exceeded 30 minutes, amplification of nonspecific sequences was observed in the negative control lane without the RNA genome sample.
[0130] Next, instead of the SARS-CoV-2 RNA genome, the genome RNA of another coronavirus (CoV-229E) was used as the antisense RNA, and 20 pg (0.87 × 10 7 ) to 20 fg (0.87 × 10 5 The amplification results were confirmed in the same manner except that the solution was serially diluted to 100 μl.
[0131] The results are shown in Figure 16. Figure 16 is a photograph showing a gel image of the amplified products after the reaction. In Figure 16, the leftmost lane is a DNA marker lane, the second lane from the left is a negative control lane, the third to sixth lanes from the left are lanes showing the results using the RNA genome of Cov-229E, and the seventh to tenth lanes from the left are lanes showing the results using the RNA genome of SARS-CoV-2. In addition, in the lanes showing the results of each RNA genome sample, from left to right, the amount of RNA genome sample is 20 fg (0.87 x 10 5 ), 200 fg (0.87 × 10 6 ), 2 pg (0.87 × 10 6 ), 2 pg (0.87 × 10 7 As shown in Figure 16, the primer set 1 did not detect a specific band (134 nt) indicating the target sequence in the Cov-229E genome, but detected only 20 fg (0.87 x 10 5 ), a specific band (134 nt) indicating the target sequence was also confirmed. This demonstrates that Primer Set 1 enables specific amplification of the RNA genome of SARS-CoV-2.
[0132] Next, the cross-reactivity of Primer Set 1 and Primer Set 3 with SARS-CoV-2 genomic RNA and CoV-229E genomic RNA was confirmed. RNA-specific amplification was performed in the same manner as above, except that Primer Set 1 or 3 was used as the primer set and SARS-CoV-2 genomic RNA or CoV-229E genomic RNA was used as the genomic RNA sample.
[0133] The results are shown in Figure 17. Figure 17 is a photograph showing a gel image of the amplified products after the reaction. In Figure 17, the leftmost lane is the DNA marker lane. In each lane other than the DNA marker lane, a "+" in the table at the top indicates that the primer set or genome sample was added, and a "-" indicates that the primer set or genome sample was not added. As shown in Figure 17, primer set 1 for amplifying the SARS-CoV-2 target sequence only amplified the SARS-CoV-2 RNA genome sample, and primer set 3 for amplifying the Cov-229E target sequence only amplified the Cov-229E RNA genome sample. These results demonstrate that primer sets 1 and 3 used in the examples are highly specific to SARS-CoV-2 or Cov-229E and do not cross-react with each other.
[0134] Next, the antisense RNA and primer set 1 were used to prepare 20 ng (0.87 × 10 11 ) and the amplification results were confirmed in the same manner except that saliva was added to the reaction vessel.
[0135] The results are shown in Figure 18. Figure 18 is a photograph showing a gel image of the amplification product after the reaction. In Figure 18, the leftmost lane is a lane for DNA markers, the second lane from the left is a lane without saliva sample, the third lane from the left is a lane showing the results when the saliva sample was added at 2.5% of the total weight of the reaction solution, the fourth lane from the left is a lane showing the results when the saliva sample was added at 5% of the total weight of the reaction solution, the fifth lane from the left is a lane showing the results when the saliva sample was added at 10% of the total weight of the reaction solution, and the sixth lane from the left is a lane showing the results when the saliva sample was added at 15% of the total weight of the reaction solution. As shown in Figure 18, it was suggested that the (C) RNA amplification step of the amplification method of the present invention enables amplification and detection of target RNA even when the saliva sample is mixed at 10% of the weight of the reaction solution.
[0136] [Example 6] It was confirmed that the isothermal gene amplification method of the present invention can detect heat-inactivated coronavirus SARS-CoV-2 (ATCC VR-1986HK) in saliva samples.
[0137] First, a saliva sample was collected from the subject. Specifically, the subject placed a saliva oral swab (SOS) in their mouth, placed the SOS under their tongue, and waited for one minute. Next, the SOS was collected from the subject and placed into the barrel of a syringe equipped with a 0.45 μm filter. The SOS in the barrel was squeezed using the plunger, and 50 μl of the saliva sample was transferred to Tube-1 containing 2.5 μl of Proteinase K. Tube-1 was left to stand at room temperature for 2 minutes while stirring, and then incubated at 95°C for 3 minutes. Next, 50 μl of RNA extraction reagent (0.1% Triton X-100, 2X Phosphate-Buffered Saline pH 7.4) was added to Tube-1, and the mixture was incubated at room temperature for 5 minutes while stirring to prepare the saliva sample.
[0138] The isothermal gene amplification method of the present invention was carried out in the same manner as in Examples 1(2) and (3), except that the SARS-CoV-2 RNA genome sample prepared in Example 1(1) was serially diluted to predetermined concentrations (8000, 4000, 1600, 800, 2100, 210, 21, and 2.1 copies / μl) and added to the 10% saliva sample, and the SARS-CoV-2 RNA genome sample contained in the saliva sample was detected. The control was a saliva sample without the addition of the RNA genome sample, which was the same as in Example 1(2). As a comparative example, the RNA genome sample was amplified in the same manner as in Example 1(2), except that 28000 copies / μl of the RNA genome sample was added to the 10% saliva sample.
[0139] The results are shown in Figures 19(A) to 19(C). Figures 19(A) to 19(C) are photographs showing gel images of the amplification products after the reaction. (A) shows the results of the isothermal gene amplification method of the present invention when the RNA genome sample concentrations were 8000, 4000, 1600, and 800 copies / μl. (B) shows the results of the isothermal gene amplification method of the present invention when the RNA genome sample concentrations were 2100, 210, 21, and 2.1 copies / μl. (C) shows the results of a comparative example. In Figures 19(A) and 19(B), the leftmost lane shows the DNA marker, and the numbers above each lane indicate the concentration of the RNA genome sample added to the saliva sample. In Figure 19(C), the leftmost lane shows the DNA marker, and the numbers above each lane indicate the reaction time. As shown in Figures 19(A) and 19(B), the isothermal gene amplification method of the present invention confirmed both the band at 134 nt, which indicates the RNA amplification product of the target sequence, and the band at 156 nt, which indicates the DNA amplification product of the target sequence, regardless of the concentration of the SARS-CoV-2 RNA genome sample contained in the saliva sample. This demonstrated that SARS-CoV-2 contained in the saliva sample could be detected in a short time of 10 minutes. Furthermore, since the SARS-CoV-2 RNA genome contained in the saliva sample could be detected even at an extremely low concentration of 2.1 copies / µL, the gene detection method using the isothermal gene amplification method of the present invention demonstrated a very low limit of detection (LOD) for genomic RNA and high sensitivity in detecting the target sequence. Furthermore, as shown in Figure 19(C), the comparative RNA-specific amplification method failed to detect the target sequence in a 10-minute reaction, even when the RNA genome sample contained in the saliva sample was at a high concentration of 28,000 copies / µL.
[0140] Although the present invention has been described above with reference to the embodiments and examples, the present invention is not limited to the above embodiments. Various modifications that can be understood by those skilled in the art can be made to the configuration and details of the present invention within the scope of the present invention. [Industrial Applicability]
[0141] According to the present invention, infectious disease pathogens such as viruses can be detected easily and quickly at low cost, and therefore the present invention is extremely useful in the fields of medicine, public health, etc.
Claims
1. 1. An isothermal gene amplification method for a target sequence in an RNA genome, comprising: (A) an amplification reaction template generation step; (B) a DNA amplification step for increasing the amplification reaction template; and (C) an RNA amplification step, wherein the steps (B) and (C) are carried out in parallel: (A) the amplification reaction template generation step, which includes the following steps (A1) to (A3): (A1) a reverse transcription step in which a first primer is hybridized to the 3'-side sequence of the target sequence in the RNA genome, the first primer comprising a promoter sequence for RNA polymerase at its 5'-side and a complementary sequence at its 3'-side that is complementary to the 3'-side sequence of the target sequence in the RNA genome, and the 3'-end of the first primer is extended by the reverse transcription activity of a reverse transcriptase to generate a complex double-stranded strand of the RNA genome and an extended DNA strand; (A2) a single-stranded DNA generating step of degrading the RNA genome of the complex double-stranded structure formed in (A1) by the RNA degradation activity of the reverse transcriptase to generate a single-stranded DNA containing the first primer sequence; (A3) a double-stranded DNA generating step of hybridizing a second primer having the same sequence as the 5'-side sequence of the target sequence to a sequence complementary to the target sequence of the single-stranded DNA generated in the step (A2), and extending the 3'-end of the second primer by the DNA synthesis activity of the reverse transcriptase to generate a single-stranded DNA containing the second primer sequence, thereby generating a double-stranded DNA that serves as the amplification reaction template; (B) A DNA amplification step for increasing the amplification reaction template, which includes the following steps (B1) and (B2): (B1) a primer hybridization step in which, in the presence of a single-stranded DNA binding protein, the second primer is hybridized to the 3' side of the single-stranded DNA containing the first primer and the first primer is hybridized to the 3' side of the single-stranded DNA containing the second primer sequence in the double-stranded DNA of the amplification reaction template of (A3) by a recombinase; (B2) a double-stranded DNA generating step of extending the 3′ end of the first primer and the 3′ end of the second primer by the strand-displacing DNA synthesis activity of the strand-displacing DNA polymerase in the presence of the single-stranded DNA-binding protein to generate a double-stranded DNA identical to the amplification reaction template of (A3); (C) an RNA amplification step including the following steps (C1) to (C4): (C1) a single-stranded RNA synthesis step in which single-stranded RNA is synthesized using, as a template sequence, the sequence 3' downstream of the promoter sequence for RNA polymerase in the double-stranded DNA serving as the amplification reaction template in (A3) above, by the RNA synthesis activity of RNA polymerase; (C2) a reverse transcription step in which the second primer is hybridized to the 5' end of the single-stranded RNA of (C1) and the 3' end of the second primer is extended by the reverse transcription activity of the reverse transcriptase to generate a complex double-stranded DNA of the single-stranded RNA; (C3) degrading the single-stranded RNA of the complex double-stranded DNA of (C2) by the RNA degradation activity of the reverse transcriptase to generate single-stranded DNA; (C4) A double-stranded DNA production step in which the first primer is hybridized to the 3' side of the single-stranded DNA of (C3), the 3' end of the first primer is extended by the DNA synthesis activity of the reverse transcriptase, and the 3' end of the single-stranded DNA of (C3) is extended using the promoter sequence of the RNA polymerase of the first primer as a template, thereby producing a double-stranded DNA identical to the amplification reaction template produced in (A3).
2. the promoter sequence of an RNA polymerase contained in the first primer is a T7 promoter sequence; The gene amplification method according to claim 1, wherein the RNA polymerase is T7 RNA polymerase.
3. the RNA genome is a sense strand, the first primer is an antisense primer, and the second primer is a sense primer; The gene amplification method according to claim 1 or 2.
4. A kit for use in the isothermal gene amplification method according to any one of claims 1 to 3, comprising the following (a1) to (a3), (b1) to (b3), and (c1): (a1) the reverse transcriptase; (a2) the first primer; (a3) the second primer; (b1) the recombinase; (b2) the single-stranded DNA binding protein; (b3) the strand-displacing DNA polymerase; (c1) the RNA polymerase.
5. A gene detection method for detecting a gene of the target sequence in the RNA genome, comprising: It includes a gene amplification step and an amplified gene detection step, The gene amplification step is carried out by the gene amplification method according to any one of claims 1 to 3. Gene detection methods.
6. In the gene amplification step, one of the first primer and the second primer has an antigen incorporated at its 5' end that can specifically bind to an immobilized antibody immobilized on a substrate, and the other of the first primer and the second primer has a first binder incorporated at its 5' end; In the amplified gene detection step, the antigen of one of the primers of the gene amplification product produced in the gene amplification step binds to the immobilized antibody, thereby immobilizing the gene amplification product on the substrate, and the first conjugate of the other primer binds to a label containing a second conjugate that specifically binds to the first conjugate via the second conjugate, thereby immobilizing the label on the substrate, and the label portion immobilized on the substrate is detected. The gene detection method according to claim 5.
7. the first binder is biotin, the second binder is streptavidin, and the label is a colored microparticle having the streptavidin immobilized on its surface; The gene detection method according to claim 6.
8. A kit for use in the gene detection method according to claim 6 or 7, comprising the following (a1) to (a3), (b1) to (b3), (c1), and (d1) to (d3): (a1) the reverse transcriptase; (a2) the first primer; (a3) the second primer; (b1) the recombinase; (b2) the single-stranded DNA binding protein; (b3) the strand-displacing DNA polymerase; (c1) the RNA polymerase; (d1) the immobilized antibody; (d2) substrate; (d3) Labeled substance.
9. the detection step is carried out by applying a voltage to a working electrode and a counter electrode in the presence of a redox substance that binds to the double-stranded portion of the amplification product of the target sequence amplified in the amplification step, and measuring the current between the two electrodes; The gene detection method according to claim 5.
10. In the detection step, if the current values of both electrodes are higher than a predetermined reference current value within a specific voltage range, a positive determination is made that the target sequence nucleic acid is present in the genome, and if the current values of both electrodes are lower than the reference current value, a negative determination is made that the target sequence nucleic acid is not present in the genome. The gene detection method according to claim 9.
11. the detection step comprises measuring a current between the electrodes in the presence of a probe nucleic acid capable of specifically and complementary binding to the amplification product; The probe nucleic acid has a gold-coated magnetic particle bound to one end thereof and the redox substance bound to the other end thereof. The gene detection method according to claim 9 or 10.
12. The redox substance is methylene blue. A method for detecting a target sequence nucleic acid according to any one of claims 9 to 11.
13. A kit for use in the gene detection method according to any one of claims 9 to 12, comprising the following (a1) to (a3), (b1) to (b3), (c1), (d1), and (d2): (a1) the reverse transcriptase; (a2) the first primer; (a3) the second primer; (b1) the recombinase; (b2) the single-stranded DNA binding protein; (b3) the strand-displacing DNA polymerase; (c1) the RNA polymerase; (d1) working electrode and counter electrode; (d2) a redox substance or a nucleic acid probe that binds to the double-stranded portion of the amplification product;
14. A method for detecting an RNA virus, comprising: The method for detecting an RNA virus is a method for detecting a sequence specific to the RNA virus in a viral genome as a target sequence, A method for detecting a virus, wherein the detection of the target sequence is carried out by the gene detection method described in claim 5, 6, 7, 9, 10, 11, or 12.
15. A detection kit for use in the virus detection method according to claim 14, comprising: A virus detection kit comprising the kit according to claim 8 or 13.
Citation Information
Patent Citations
Nucleic acid amplification technology and application thereof in detection of mosquito-borne viruses
CN106521032A
Nucleic acid detection method
JP2009222635A
Primer set for determining na subtype of avian influenza virus
JP2010252659A
Electrochemical detection method of nucleic acid molecule
JP2020051889A