A method for improving the traits of Arabidopsis thaliana using Phoebe bournei β-caryophyllene synthase gene
By expressing the β-caryophyllene synthase gene in Arabidopsis, the problems of low germination rate, slow growth and weak stress resistance in Minnan seeds were solved, and the growth and development characteristics of Arabidopsis were significantly improved, providing a theoretical basis and technical reference for accurate breeding of Minnan.
Patent Information
- Application Number
- CN202411327607.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-23
- Publication Date
- 2025-06-20
- Estimated Expiration
- 2044-09-23
AI Technical Summary
The germination rate of Minnan seeds is low, slow growth and weak stress resistance, resulting in a narrowing of its natural resources distribution range and facing the risk of depletion.
Genetic engineering methods are used to enhance the growth and development characteristics of Arabidopsis by expressing the Minnan β-caryophyllene synthase gene (PbTPSa21) in Arabidopsis.
It significantly improves the seed germination, root growth, biomass accumulation, anti-osmosis stress ability and hormone levels of Arabidopsis, providing a theoretical basis and technical reference for precise breeding of Minnan.
Smart Images

Figure CN118895304B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of plant genetic engineering, and relates to a method for improving the traits of Arabidopsis thaliana using the β-caryophyllene synthase gene of Phoebe bournei. Background Art
[0002] Phoebe bournei is an evergreen arbor of the genus Phoebe in the Lauraceae family, mainly distributed in the subtropical hilly areas with abundant rainfall in Fujian, Jiangxi, Hunan, Guangxi, Guizhou, and southern Zhejiang in China. Phoebe bournei has a straight trunk, dense texture, and a unique aromatic smell. It is a unique furniture wood and landscape tree species in China, with good economic and artistic values. However, due to a large amount of disorderly logging, damage to the production environment, and weak natural regeneration ability, the distribution range of the natural population of Phoebe bournei has gradually shrunk, and the natural resources are facing the danger of exhaustion. It has been listed as a national second-class endangered plant. Therefore, the protection of Phoebe bournei genetic resources and the utilization of germplasm resources are urgent tasks to be promoted.
[0003] Terpenoids are the most abundant substances in plant secondary metabolites, which first appeared in the process of plant evolution from algae to bryophytes, including many types such as monoterpenes, sesquiterpenes, and diterpenes. The volatile secondary metabolites of Phoebe bournei are mainly sesquiterpenes. Terpenoids have been proven to play a wide and universal regulatory role in the process of plant growth and development, including regulating the circadian rhythm, resisting biotic and abiotic stresses, and producing allelopathic effects. Caryophyllene is a volatile sesquiterpene widely present in plants and fungi. After being received by plants, caryophyllene will play a role in different signal transduction pathways. However, the mechanism of action of caryophyllene in regulating plant growth and development and stress response is not clear.
[0004] Terpene synthase (TPS) is the key catalytic enzyme for terpene synthesis. Caryophyllene in Phoebe bournei is the direct catalytic product of Phoebe bournei β-caryophyllene synthase. Identifying the β-caryophyllene synthase gene of Phoebe bournei and using it for genetic engineering operations to improve plant caryophyllene synthesis and the growth and stress resistance characteristics of plants can provide important gene resources and theoretical support for the creation of excellent new varieties, but no corresponding reports have been seen yet. Summary of the Invention
[0005] In order to solve the problems existing in the prior art, by highly expressing the β-caryophyllene synthase gene of Phoebe bournei (Phoebe bournei TPSa21 gene, PbTPSa21) in Arabidopsis thaliana, the present invention found that the TPSa21 gene can affect the growth and development phenotypes such as seed germination and root elongation, providing a theoretical basis and technical reference for the precise breeding of Phoebe bournei.
[0006] In view of the problems of low germination rate, slow growth, and weak stress resistance of Phoebe bournei seeds, gene engineering operations were carried out on the key genes regulating the growth and development of Phoebe bournei, and it was found that the growth and development of Arabidopsis thaliana with high expression of the target gene were significantly improved, which provided a solid theoretical basis for cultivating new excellent varieties of Phoebe bournei through molecular breeding.
[0007] In the first aspect of the present invention, a method for improving the traits of Arabidopsis thaliana is provided, and the method is: by means of genetic engineering, making the β-caryophyllene synthase gene of Phoebe bournei highly expressed in Arabidopsis thaliana;
[0008] The improvement of the traits of Arabidopsis thaliana includes:
[0009] Enhancing the growth potential of Arabidopsis thaliana;
[0010] Promoting the germination of Arabidopsis thaliana seeds;
[0011] Promoting the root growth of Arabidopsis thaliana;
[0012] Increasing the biomass of Arabidopsis thaliana;
[0013] Increasing the contents of GA3, SA, and IAA in Arabidopsis thaliana;
[0014] Increasing the expression levels of the EDA39 gene and the PRR5 gene in Arabidopsis thaliana;
[0015] Reducing the expression levels of the ERF109 gene and the WRKY40 gene in Arabidopsis thaliana;
[0016] Reducing the damage of reactive oxygen species to Arabidopsis thaliana;
[0017] Improving the osmotic stress resistance of Arabidopsis thaliana.
[0018] In some embodiments, the method includes the following steps:
[0019] S1: Transferring the coding sequence of the β-caryophyllene synthase gene of Phoebe bournei into an expression vector to obtain a recombinant vector containing the β-caryophyllene synthase gene of Phoebe bournei;
[0020] S2: Transforming Agrobacterium tumefaciens with the recombinant vector containing the β-caryophyllene synthase gene of Phoebe bournei to obtain recombinant Agrobacterium tumefaciens containing the β-caryophyllene synthase gene of Phoebe bournei;
[0021] S3: Infecting the inflorescence of Arabidopsis thaliana with the recombinant Agrobacterium tumefaciens containing the β-caryophyllene synthase gene of Phoebe bournei to obtain infected T0 generation Arabidopsis thaliana seeds.
[0022] In some embodiments, the method further includes the following steps:
[0023] S4: Subculturing the T0 generation Arabidopsis thaliana seeds and screening to obtain homozygous transgenic Arabidopsis thaliana seeds.
[0024] In some embodiments, the method is selected from any one or a combination of the following cases C1, C2, C3, C4, and C5;
[0025] C1: In S1, the backbone of the expression vector is the pCambia1301 vector;
[0026] C2: In S2, the Agrobacterium is Agrobacterium tumefaciens GV3101;
[0027] C3: In S3, the resuspension of the Agrobacterium is an aqueous solution containing 4 - 6 g / L sodium chloride, 8 - 12 g / L peptone, 4 - 6 g / L yeast powder, 30 - 60 g / L sucrose, and 1.5 - 5 ml / L SILWET L - 77;
[0028] C4: The amino acid sequence of the protein encoded by the Phoebe bournei β - caryophyllene synthase gene is as shown in SEQ ID NO.2;
[0029] C5: The variety of Arabidopsis thaliana is Columbia - 0.
[0030] In some embodiments, in S4, the T0 - generation Arabidopsis thaliana seeds are screened and cultured one by one, the seeds of all the Phoebe bournei β - caryophyllene synthase gene - positive T1 - generation plants are harvested separately, and the T1 and T2 - generation seeds are screened until the seeds of the plants that do not show the segregation phenotype of the Phoebe bournei β - caryophyllene synthase gene are obtained, and they are identified as the transgenic homozygotes of the Phoebe bournei β - caryophyllene synthase gene. The second aspect of the present invention provides the use of a biological material in the preparation of a preparation for Arabidopsis thaliana breeding for improving the traits of Arabidopsis thaliana;
[0031] The improvement of the traits of Arabidopsis thaliana includes:
[0032] Enhancing the growth vigor of Arabidopsis thaliana;
[0033] Promoting the germination of Arabidopsis thaliana seeds;
[0034] Promoting the root growth of Arabidopsis thaliana;
[0035] Increasing the biomass of Arabidopsis thaliana;
[0036] Increasing the contents of GA3, SA, and IAA in Arabidopsis thaliana;
[0037] Increasing the expression levels of the Arabidopsis thaliana EDA39 gene and PRR5 gene;
[0038] Reducing the expression levels of the Arabidopsis thaliana ERF109 gene and WRKY40 gene;
[0039] Reducing the damage of reactive oxygen species to Arabidopsis thaliana;
[0040] Improve the osmotic stress resistance of Arabidopsis thaliana;
[0041] The biological material is selected from any one of the following P1, P2, P3, P4, P5, P6, P7, and P8:
[0042] P1: Protein
[0043] The protein is Phoebe bournei β-caryophyllene synthase protein;
[0044] P2: Fusion protein
[0045] The amino acid sequence of the fusion protein contains the amino acid sequence of the Phoebe bournei β-caryophyllene synthase protein described in P1 and the amino acid sequence of a functional protein fragment or an inert protein fragment;
[0046] P3: RNA
[0047] The RNA can be translated to obtain the Phoebe bournei β-caryophyllene synthase protein described in P1 or the fusion protein described in P2;
[0048] P4: Gene
[0049] The coding sequence of the gene can encode the Phoebe bournei β-caryophyllene synthase protein described in P1 or the fusion protein described in P2;
[0050] P5: Gene expression cassette
[0051] The gene expression product in the gene expression cassette is the RNA described in P3;
[0052] P6: Gene engineering vector
[0053] The gene engineering vector contains the gene expression cassette described in P5;
[0054] P7: Cell
[0055] The cell contains the gene engineering vector described in P6;
[0056] The coding protein in the gene expression cassette of the gene engineering vector is constitutively expressed, tissue-specifically expressed, or artificially induced to express; and
[0057] P8: Composition
[0058] The composition contains the RNA described in P3, the gene engineering vector described in P6, or the cell described in P7.
[0059] In some embodiments, the amino acid sequence of the Phoebe bournei β-caryophyllene synthase protein is as shown in SEQ ID NO.2.
[0060] In some embodiments, the variety of Arabidopsis thaliana is Columbia-0.
[0061] In some embodiments, the backbone of the genetic engineering vector is the pCambia1301 vector, and / or the cell is Agrobacterium tumefaciens GV3101 cell. BRIEF DESCRIPTION OF THE DRAWINGS
[0062] Figure 1 Shows the germination of PbTPSa21 transgenic and wild-type Arabidopsis thaliana.
[0063] Figure 2 Shows the germination rate of PbTPSa21 transgenic and wild-type Arabidopsis thaliana.
[0064] Figure 3 Shows the statistics of the primary root length of PbTPSa21 transgenic and wild-type Arabidopsis thaliana.
[0065] Figure 4 Shows the statistics of the number of lateral roots of PbTPSa21 transgenic and wild-type Arabidopsis thaliana.
[0066] Figure 5 Shows the root growth of PbTPSa21 transgenic and wild-type Arabidopsis thaliana.
[0067] Figure 6 Shows the biomass statistics of PbTPSa21 transgenic and wild-type Arabidopsis thaliana.
[0068] Figure 7 Shows the GA3 content of PbTPSa21 transgenic and wild-type Arabidopsis thaliana.
[0069] Figure 8 Shows the SA content of PbTPSa21 transgenic and wild-type Arabidopsis thaliana.
[0070] Figure 9 Shows the IAA content of PbTPSa21 transgenic and wild-type Arabidopsis thaliana.
[0071] Figure 10 Shows the phenotypes of PbTPSa21 transgenic and wild-type Arabidopsis thaliana in response to mannitol.
[0072] Figure 11 Shows the phenotypes of PbTPSa21 transgenic and wild-type Arabidopsis thaliana in response to Tiron, ZnCl2 and Mv.
[0073] Figure 12 Shows the NBT staining and PI staining results of the root tips of PbTPSa21 transgenic and wild-type Arabidopsis thaliana. DETAILED DESCRIPTION OF THE EMBODIMENTS
[0074] To make the objectives, technical solutions, and advantages of the present invention clearer, the embodiments of the present invention will be further described in detail below with reference to the accompanying drawings.
[0075] The materials and instruments not described in the present invention are conventional materials and instruments in the art, and the operation details not described in the present invention are conventional operations in the art. Unless otherwise specified, the nucleic acid sequences shown in the present invention are written from left to right in the 5' to 3' direction.
[0076] Example 1: Preparation of PbTPSa21 transgenic Arabidopsis plants
[0077] 1. Plant species
[0078] The Arabidopsis thaliana used in the present invention is of the Columbia type, with the variety Columbia-0, abbreviated as Col-0, and the scientific name Arabidopsis thaliana.
[0079] 2. Gene information
[0080] According to the genome sequencing naming rules, the Phoebe bournei β-caryophyllene synthase gene was cloned from the genome of a wild Phoebe bournei ancient tree collected from Zhenghe County, Fujian Province, and named the PbTPSa21 gene (where Pb represents that the gene comes from Phoebe bournei, and TPSa21 is the gene name).
[0081] The coding sequence of the PbTPSa21 gene is as follows (SEQ ID NO.1):
[0082]
[0083] The amino acid sequence of PbTPSa21 protein is as follows (SEQ ID NO.2):
[0084] MPAMLIPHPQLALRYTISSHCFFFILFFQGLTIMSVVLTSSLSDAPNKHHLEGNKTSEVVRRSVNYVPEIWGDRFVALSPENLKPDAQTQQRANELKEEVRRMLRNVDDHLQELNLIDAVQRLGVAYHFEEEIAQALLRMYKSGRDYSDDLHAVALQFRLLRQEGYNVSPDVFIKFKDEEGRFKRTLAGDPRSLLSLYEAAHMGTHGENILDEAIAFTREHLNSALPCLKPPFSTLVELALELPLRKRIERLQTSYYISIYQEDKDRSDILLEFAKRDFNLLQLLHQQELREVSIWWKSWDFAAKLPFIRDRIVECYFWILAVYFEPQYSRARKMMTKIIALTSIMDDIYDVHGTLEELEPYTDAIQRWDRSIIDQFPDYMKLHFSALLDTVEKFEEELALEGKSYRIPYFKQVFKEVSKGYLIEAQWSNSGHVPTSEEYMTNALMSSGYPMLCVTSYVGMGDVATREAFDWAVSMPKLIEVAAAISRLKNDVTSNQLEQERVHVATTIQIYMNENGSTYEEACEKCRRMAADAWKDVNEECLKSPPAPMPLLMRIVNLTRAVEVFYHHRDAYTNPAYETKERVMSVLVNPIPV
[0085] 3. Preparation of PbTPSa21 overexpression vector
[0086] The pCambia1301 vector (purchased from Abcam, catalog number ab275753) was double digested with Bgl II and Nco I restriction endonucleases (purchased from NEB, catalog numbers R0144V and R0193 respectively). The target bands were detected by agarose gel electrophoresis, and the linearized vector fragment was obtained by gel extraction. The coding sequence of the PbTPSa21 gene shown in SEQ ID NO.1 was synthesized by Hangzhou Youkang Biotechnology Co., Ltd. Using the target gene recombination primers PbTPSa21-pCambia1301-F1 and PbTPSa21-pCambia1301-R1 (the underlined sequences are the homologous arms for homologous recombination), with the synthesized PbTPSa21 gene coding sequence as the template, PCR amplification products were obtained. The above-mentioned PCR amplification products were ligated with the linearized vector fragment using the homologous recombinase Exnase II (purchased from Nanjing Vazyme), cultured at 37 °C for 30 min, and placed on ice for 5 min. Escherichia coli DH5α competent cells were transformed, and positive monoclonal colonies were screened using LB solid medium containing 50 mg / L kanamycin. The recombinant primers PbTPSa21-pCambia1301-F1 and PbTPSa21-pCambia1301-R1 were used as primers for bacterial inspection. The target band was 1822 bp, and the amplification products were sequenced and verified, and the results were as expected. The recombinant vector was named pCambia1301-PbTPSa21. The recombinant vector was transformed into Agrobacterium tumefaciens GV3101 competent cells. Monoclonal detection PCR was performed using the primers PbTPSa21-pCambia1301-F1 and PbTPSa21-pCambia1301-R1, and the successfully transformed monoclonal colonies were determined by electrophoresis. The positive monoclonal colonies were cultured on a large scale to obtain a recombinant Agrobacterium liquid containing the PbTPSa21 gene, which was stored at -80 °C for later use.
[0087] PbTPSa21-pCambia1301-F1 (SEQ ID NO:3): AACACGGGGGACTCT TGACC ATGCCAGCCATGTTAATCCC
[0088] PbTPSa21-pCambia1301-R1 (SEQ ID NO:4): TAGAAATTTACCCTCA GATC AACTGGAATAGGATTAACAA
[0089] 4. Preparation of PbTPSa21-overexpressing Arabidopsis thaliana
[0090] (1) Prepare several pots of 6-7-week-old flowering Arabidopsis thaliana plants growing vigorously, and cut off the pods before the experiment.
[0091] (2) Add the Agrobacterium containing the overexpression vector pCambia1301-PbTPSa21 of the PbTPSa21 gene to the LB2 medium (150 ml) with 100 mg / L kanamycin and 50 mg / L rifamycin, and culture at 28 °C and 220 rpm until OD 600 = 1.2 - 1.8, centrifuge at 4 °C and 3000 rpm for 10 min, and resuspend the cells with a sterile resuspension solution to an OD 600 of approximately 1.0 to obtain the infection bacterial solution for use. Preparation method of LB2 medium: Weigh 0.5 g of sodium chloride, 1 g of peptone, and 0.5 g of yeast extract, dissolve them in 100 ml of RO water, and sterilize by high-temperature steam.
[0092] (3) Add 4.5 g of sucrose and 180 μl of SILWET L-77 to the infection bacterial solution, stir until the bacterial solution forms dense foam, and then immerse the Arabidopsis inflorescence into the foamy bacterial solution for 1 min.
[0093] (4) Gently blot the residual bacterial solution from the infected Arabidopsis inflorescence with absorbent paper, take it out after 24 h in the dark, water it, and enclose it with a transparent plastic sheet. Repeat the infection in step (3) once after one week, and obtain T0 generation transgenic Arabidopsis seeds after three weeks.
[0094] (5) Sow the T0 generation transgenic seeds into the 1 / 2 MS medium containing 20 mg / L hygromycin resistance, and vernalize at 4 °C for 24 - 48 h. Take them out and place them in an incubator (temperature 25 °C, humidity 50%, illuminance 12000 Lux) for 8 - 10 days. Observe and select the positive plants with better growth, longer roots, and greener cotyledons, and transplant them into the nutrient soil with the formula of peat: coconut coir: perlite: sheep manure = 10:5:5:1 (volume ratio) to culture into T1 generation plants, and number different plant lines in sequence as L1 - Ln (n is a natural number).
[0095] (6) Take the rosette leaves of the T1 generation plants for positive plant identification. After extracting DNA using the M5Hiper Ultra-Fast Mix kit (Polymerase Master, MF848-10), amplify with the specific primers PbTPSa21-F-51 and PbTPSa21-R-309 of the target gene, select the plants with positive bands, and harvest the T1 generation seeds. The sequences of the specific primers of the target are as follows:
[0096] PbTPSa21-F-51 (SEQ ID NO.5): TTCTTCCCATTGTTTCTTCTTTATCT
[0097] PbTPSa21-R-309 (SEQ ID NO.6): CATTCTCCTCACTTCTTCTTTCAACT
[0098] (7) Propagate and screen the seeds of all positive strains. When all the seeds obtained from one individual of one strain grow into positive plants after sowing, this individual is regarded as homozygous, and the seeds of this individual are used as the experimental objects of this strain for subsequent experiments.
[0099] (8) Detect the expression level of the target gene by fluorescence quantitative PCR. Extract the total RNA of the whole plant of 10-day-old homozygous transgenic Arabidopsis thaliana seedlings using the FastPure Universal Plant Total RNA Isolation Kit (Vazyme, product number RC411-01). Reverse transcribe to obtain cDNA using the HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) (Vazyme, product number Q311), and dilute it to 300 pg / μl for subsequent quantitative analysis. Perform fluorescence quantitative PCR using specific primers and ChamQ SYBR qPCR Master Mix (Vazyme, product number R333), and calculate the 2 -ΔΔcq value. The quantitative primers for the target gene are PbTPSa21-F-51 and PbTPSa21-R-309. The quantitative primers for the internal reference gene Actin are At-Actin-F and At-Actin-R.
[0100] At-Actin-F (SEQ ID NO.7): AAGCTGGGGTTTTATGAATGG
[0101] At-Actin-R (SEQ ID NO.8): AGAGAGTTTGTCACACACAAG
[0102] Example 2. Characterization of transgenic Arabidopsis thaliana plant traits
[0103] For the homozygous plants PbTPSa21-L6 and PbTPSa21-L9 of PbTPSa21 transgenic Arabidopsis thaliana and the parental wild-type Arabidopsis thaliana Col-0 (WT) screened in Example 1, the following parallel test experiments were carried out respectively.
[0104] (1) Effect of the PbTPSa21 gene on Arabidopsis thaliana seed germination
[0105] Dot the Arabidopsis thaliana seeds onto a 1 / 2MS culture dish with toothpicks, 3 seeds per small square of each culture dish, simulate vernalization in the dark at 4°C for 24 hours, take out and culture under normal conditions. The day of taking out is recorded as day 0. Start counting the germination rate at about 18:00 on the afternoon of the 2nd day. When the cotyledons are observed to unfold, it is recorded as germination, and the counting continues until the 4th day. Set up 3 groups of experimental replicates in parallel, with 96 seeds in each group. Count the number of germinated seeds, calculate the germination rate, and perform significance analysis. The germination phenotype results are asFigure 1 As shown, the germination rate statistics are as follows Figure 2 As shown, it can be seen that the high expression of the PbTPSa21 gene increases the germination rate of Arabidopsis thaliana seeds.
[0106] (2) Effects of the PbTPSa21 gene on the root length and lateral root number of Arabidopsis thaliana
[0107] The culture conditions were the same as those for seed germination determination. The root length of Arabidopsis thaliana seedlings was observed and statistically analyzed on the 6th day, and the lateral root number was observed and statistically analyzed on the 12th day. There were 48 Arabidopsis thaliana plants in total for biological replicates. One-way ANOVA was used to calculate the significance of the data, p < 0.05. The results are as shown in Figure 3 and 4 and 5. It can be seen that the high expression of the PbTPSa21 gene makes the main root of Arabidopsis thaliana longer and the lateral root number more. Therefore, transgenic plants are beneficial to root growth, promote material exchange, and are more conducive to the accumulation of plant growth.
[0108] (3) Effects of the PbTPSa21 gene on the biomass of Arabidopsis thaliana
[0109] The culture conditions were the same as those for seed germination determination. On the 8th day, Arabidopsis thaliana seedlings were taken out, divided into 4 biological replicates, and 50 seedlings in each biological replicate were weighed. Finally, the weighing results were divided by the number of seedlings to obtain the biomass. The results are as shown in Figure 6 As shown. It can be seen that the high expression of the PbTPSa21 gene increases the biomass accumulation of Arabidopsis thaliana plants.
[0110] (4) Effects of the PbTPSa21 gene on the hormone levels of Arabidopsis thaliana
[0111] For the wild type and each transgenic line, three biological replicates were taken, and 300 mg of sample tissue (the whole plant of 36-hour-old seedlings) was taken for each replicate. A liquid chromatography-mass spectrometry (AB SCIEX 5500 Qtrap-MS) was used for concentration determination. The chromatographic column model was Acquity UPLC HSS T3 (1.8 μm, 2.1 mm × 100 mm). First, a mixed standard was injected to obtain a standard curve, and then the chromatographic peak area obtained by injecting the sample was converted with the standard curve to obtain the absolute value of the hormone concentration. The mean and standard deviation were calculated and plotted, with the unit of ng / g. One-way ANOVA was used for significant difference analysis, p < 0.05. The results are as shown in Figure 7 and 8 and 9. It can be seen that the high expression of the PbTPSa21 gene increases the hormone content of Arabidopsis thaliana seedlings.
[0112] The increase in GA3 was approximately 30%. The increase in GA3 concentration was beneficial for the seeds to break dormancy and initiate germination. The increase in SA was approximately 30%. The increase in SA concentration was beneficial for the seedlings to cope with the stress environment. The increase in IAA was approximately 100%. The increase in IAA concentration was beneficial for the occurrence of roots.
[0113] Example 3: Transcriptome analysis of transgenic Arabidopsis thaliana
[0114] Transcriptome analysis was performed on the homozygous plants PbTPSa21-L6 and PbTPSa21-L9 of the PbTPSa21 transgenic Arabidopsis thaliana screened in Example 1 and the parental wild-type Arabidopsis thaliana Col-0 (WT), respectively.
[0115] (1) The transcriptomes of whole-plant seedlings of Arabidopsis thaliana parents and transgenic lines PbTPSa21-L6 and PbTPSa21-L9 at 36 hours of germination were determined by paired-end 150bp sequencing using the Illumina high-throughput sequencing platform HiSeq X Ten.
[0116] (2) It was found that the EDA39 gene and the PRR5 gene were significantly up-regulated in the above two transgenic lines compared with the parent. The ERF109 gene and the WRKY40 gene were significantly down-regulated.
[0117] (3) According to existing common knowledge, EDA39 (AT4G33050) is involved in directly regulating the hydrogen peroxide content in response to drought stress by CAT2, improving plant stress resistance. PRR5 (AT5G24470) can interact with ABI5, initiate important physiological processes such as downstream photomorphogenesis, and regulate the red light sensitivity of plant seedlings, regulate hypocotyl elongation, and contribute to the germination of Arabidopsis thaliana seedlings. The ERF109 (AT4G34410) transcription factor can participate in the regulation of programmed cell death in plant cells under salt stress by positively regulating ROS accumulation. The down-regulation of ERF109 is beneficial for the growth of the main root of plants and the improvement of the survival ability of plants under osmotic stress. At the same time, the ERF109 transcription factor can regulate the expression of the downstream WRKY40 gene, affecting plant growth and resistance. WRKY40 is an important transcription factor for plants to respond to pathogens. The down-regulation of the WRKY40 gene makes plant growth insensitive to Pseudomonas syringae and Botrytis cinerea, which is beneficial for enhancing the antibacterial property of plants.
[0118] Example 4: Phenotype of transgenic Arabidopsis thaliana in response to osmotic stress
[0119] The homozygous plants of PbTPSa21 transgenic Arabidopsis thaliana, PbTPSa21-L6 and PbTPSa21-L9, screened in Example 1 and the parental wild-type Arabidopsis thaliana Col-0 (WT) were respectively subjected to osmotic stress treatment. Mannitol at 200 mM was added to the treatment medium, and the remaining culture conditions were the same as those for seed germination assay. The growth phenotypes of the seedlings were observed on the 10th day of germination. The results are as Figure 10 shown. It can be seen that the high expression of the PbTPSa21 gene can improve the resistance of Arabidopsis thaliana to osmotic stress, and healthy cotyledons and roots can still grow under 200 mM mannitol osmotic stress.
[0120] Example 5: Phenotypes of Transgenic Arabidopsis thaliana Responding to Reactive Oxygen Species
[0121] The homozygous plants of PbTPSa21 transgenic Arabidopsis thaliana, PbTPSa21-L6 and PbTPSa21-L9, screened in Example 1 and the parental wild-type Arabidopsis thaliana Col-0 (WT) were respectively subjected to reactive oxygen species treatment. Research has shown that reactive oxygen species (ROS) are involved in the process of plant osmotic stress response. Therefore, the transgenic Arabidopsis thaliana was treated with the ROS scavenger Tiron (catechol-3,5-disulfonic acid sodium salt), the ROS inhibitor ZnCl2, and the ROS generator Mv (methyl viologen) to observe the effect of ROS signals on transgenic Arabidopsis thaliana. A total of 9 treatment groups were set up (Table 1), and the corresponding treatment reagents were added to the 1 / 2MS medium, and no treatment was used as the blank control. After vernalization was simulated at 4 °C in the dark for 40 h and cultured normally for 36 h, the germination phenotypes were observed, and NBT (nitroblue tetrazolium) staining was used to observe the distribution of reactive oxygen species.
[0122] Table 1. Grouping of Reactive Oxygen Species Treatment of Transgenic Arabidopsis thaliana Seeds
[0123]
[0124] The results are as Figure 11 shown in A. In the medium containing the ROS inducer Mv, the germination of wild-type Arabidopsis thaliana was advanced. While in the medium containing the ROS scavenger Trion or the ROS inhibitor ZnCl2, the germination of wild-type Arabidopsis thaliana was delayed, and the early germination phenotype of the transgenic lines was inhibited. Therefore, it is indicated that PbTPSa21 transgenic Arabidopsis thaliana may regulate seed germination by affecting the ROS signaling pathway.
[0125] The NBT staining results of the germinated seeds of transgenic Arabidopsis thaliana showed that after treatment with Mv, the phenotypic change of the superoxide anion staining area in the transgenic lines disappeared ( Figure 11 B, NBT staining results of wild-type and overexpressing Arabidopsis thaliana seeds at 40 h of germination). It shows that there is an association between the germination phenotype of transgenic plants and the generation and distribution of superoxide anion signals.
[0126] Example 6: Changes in Reactive Oxygen Species Signals at the Root Tips of Transgenic Arabidopsis thaliana Radicles
[0127] (1) NBT staining. Dissolve 1 g of NBT powder (Coolaber, CN7731) in 3 ml of 100 mM Tris-HCl buffer, pH = 7.3, and dispense it into NBT dye stock solution (3×), then store it at -20°C. When in use, dilute the dye stock solution with Tris-HCl buffer to 1× NBT dye working solution for standby. Take out the wild-type and transgenic Arabidopsis thaliana germinated for 36 h from the culture medium and place them in an ELISA plate, stain them with 1× NBT dye in the dark for 10 min until the staining is clear, and discard the staining solution. Subsequently, wash them twice with double-distilled water, add paraformaldehyde fixative (Beyotime, P0099) to fix for 30 min, and discard the fixative. Then wash them three times with 1× PBS buffer (0.01 M), blot the water with filter paper, place them on a glass slide, add 100 μl of Hoyer’s fixative (Phygene, PH1873), and slowly cover with a coverslip. Let it stand overnight and observe.
[0128] (2) Propidium iodide (PI) staining. Dissolve 10 mg of PI powder (Sigma, P4170) in 10 ml of 1× PBS buffer to prepare a 1 mg / ml dye stock solution and store it at -20°C. Take out the wild-type and transgenic Arabidopsis thaliana germinated for 36 h from the culture medium and place them in an ELISA plate, add paraformaldehyde fixative to fix for 30 min, and wash them twice with 1× PBS buffer (0.01 M) and twice with double-distilled water. Add fresh 1% periodic acid solution (Sigma, P0430) to the ELISA plate, incubate at room temperature for 40 min, and then wash twice with double-distilled water. Weigh 0.1 g of NaHSO3 and dissolve it in 4.9 ml of deionized water, and add 62.5 μl of dilute hydrochloric acid (pH = 2.0). Pipette 100 μl of PI dye stock solution into the above solution to prepare 1× PI dye working solution. Add the PI staining working solution to the ELISA plate, incubate in the dark for 2 h, and wash twice with double-distilled water in the dark. Blot the water with filter paper, place it on a glass slide, add 100 μl of Hoyer’s fixative, and slowly cover with a coverslip. Let it stand overnight and observe.
[0129] (3) The results are shown in Figure 12 . According to the principle of NBT staining, the more blue the material is stained, the more superoxide anions there are in that part. Using PI dye to assist in indicating cell types to observe the staining results (PI dye plays a role in indicating cell types here. It can stain the cell walls of living plant cells and the nuclei of dead cells), it can be found that the superoxide anion signal intensity at the root tips of vernalized Arabidopsis thaliana is significantly enhanced, and the transgenic lines can still maintain a relatively strong and widespread superoxide anion signal ( Figure 12A, Results of NBT and PI staining of the radicles of seedlings at 40 h of germination). However, in the staining results of the high-expression line PbTPSa21-L6, the initial cell signal was weakened. Magnifying the staining position in the root tip region, it can be found that there were differences in the reactive oxygen species signals in the root tip meristem of the radicles of overexpressing plants compared with the wild type ( Figure 12 B, Local magnification of the staining results at 40 h, showing the meristematic zone), and the high-expression PbTPSa21-L6 showed a loss of superoxide anion signals in the columella stem cells. The known research results show that the reactive oxygen species components in non-meristematic tissues may damage plant cells and lead to programmed cell death; while the reactive oxygen species components in meristematic tissues are very necessary for the maintenance of meristem identity and differentiation behavior. Thus, the transgenic plants can reduce the damage related to reactive oxygen species, promote plant growth, and improve the stress resistance of plants.
[0130] As is known by technical common sense, the present invention can be implemented by other embodiments that do not depart from its spirit or essential characteristics. Therefore, the above-disclosed embodiments are illustrative in all aspects and not exclusive. All changes within the scope of the present invention or equivalent to the present invention are encompassed by the present invention.
Claims
1. A method for improving the traits of Arabidopsis thaliana, the method comprising: using genetic engineering means to highly express the Phoebe bournei β-caryophyllene synthase gene in Arabidopsis thaliana; The amino acid sequence of the protein encoded by the Phoebe bournei β-caryophyllene synthase gene is shown in SEQ ID NO.2; The improved Arabidopsis traits include: Enhance the growth of Arabidopsis thaliana; Increase the content of GA3, SA and IAA in Arabidopsis; Reducing the damage of reactive oxygen species to Arabidopsis thaliana; and / or Improve Arabidopsis thaliana's ability to resist osmotic stress.
2. The method according to claim 1, characterized in that The enhancing the growth potential of Arabidopsis thaliana comprises: Promote Arabidopsis seed germination; Promoting root growth in Arabidopsis thaliana; and / or Increase Arabidopsis biomass.
3. The method according to claim 1, characterized in that The method comprises the following steps: S1: transferring the coding sequence of the Phoebe bournei β-caryophyllene synthase gene into an expression vector to obtain a recombinant vector containing the Phoebe bournei β-caryophyllene synthase gene; S2: transforming Agrobacterium with a recombinant vector containing the Prunus bournei β-caryophyllene synthase gene to obtain a recombinant Agrobacterium containing the Prunus bournei β-caryophyllene synthase gene; S3: Infecting Arabidopsis thaliana inflorescence with the recombinant Agrobacterium containing the Prunus bournei β-caryophyllene synthase gene to obtain infected T0 generation Arabidopsis thaliana seeds.
4. The method according to claim 3, characterized in that The method further comprises the steps of: S4: subculture the T0 generation Arabidopsis seeds to screen and obtain homozygous transgenic Arabidopsis seeds.
5. The method according to claim 3 or 4, characterized in that The method is selected from any one of the following cases C1, C2, C3 and C4 or a combination thereof; C1: In S1, the backbone of the expression vector is pCambia1301 vector; C2: In S2, the Agrobacterium is Agrobacterium GV3101; C3: In S3, the resuspension solution of the Agrobacterium is an aqueous solution containing 4-6 g / L sodium chloride, 8-12 g / L peptone, 4-6 g / L yeast powder, 30-60 g / L sucrose and 1.5-5 ml / L SILWET L-77; C4: The variety of Arabidopsis thaliana is Columbia-0.
6. The method according to claim 4, characterized in that In S4, the T0 generation Arabidopsis seeds are screened and cultured one by one, the seeds of all T1 generation plants that are positive for the Phoebe oxyphylla β-caryophyllene synthase gene are harvested separately, and the T1 and T2 generation seeds are screened until plant seeds that do not show the separation phenotype of the Phoebe oxyphylla β-caryophyllene synthase gene are obtained, and they are identified as transgenic homozygotes of the Phoebe oxyphylla β-caryophyllene synthase gene.
7. Use of a biological material in preparing a formulation for Arabidopsis breeding for improving Arabidopsis traits; The improved Arabidopsis traits include: Enhance the growth of Arabidopsis thaliana; Increase the content of GA3, SA and IAA in Arabidopsis; Reducing the damage of reactive oxygen species to Arabidopsis thaliana; and / or Improve the ability of Arabidopsis to resist osmotic stress; The biological material is selected from any one of the following P1, P2, P3, P4, P5, P6 and P7: P1: Protein The protein is Phoebe bournei β-caryophyllene synthase protein; the amino acid sequence of the Phoebe bournei β-caryophyllene synthase protein is shown in SEQ ID NO.2; P2: RNA The RNA can be translated to obtain the Phoebe fujianensis β-caryophyllene synthase protein described in P1; P3: Gene The coding sequence of the gene can encode the Phoebe fujianensis β-caryophyllene synthase protein described in P1; P4: Gene expression cassette The gene expression product in the gene expression cassette is the RNA described in P2; P5: Genetic Engineering Vector The genetic engineering vector contains the gene expression cassette described in P4; P6: Cells The cell contains the genetic engineering vector described in P5; The encoded protein in the gene expression cassette of the genetic engineering vector is expressed constitutively, tissue-specifically, or artificially induced; and P7: Composition The composition contains the RNA described in P2, the genetic engineering vector described in P5 or the cell described in P6.
8. The use according to claim 7, characterized in that The enhancing the growth potential of Arabidopsis thaliana comprises: Promote Arabidopsis seed germination; Promoting root growth in Arabidopsis thaliana; and / or Increase Arabidopsis biomass.
9. The use according to claim 7, characterized in that The variety of Arabidopsis thaliana is Columbia-0.
10. The use according to any one of claims 7 to 9, characterized in that The skeleton of the genetic engineering vector is a pCambia1301 vector, and / or the cell is an Agrobacterium GV3101 cell.
Citation Information
Patent Citations
Phoebe bournei PbGRF1 gene and application thereof in promoting growth of plant leaves
CN119220553A