Sequences of a group of oligonucleotide aptamers specifically recognizing radiation-sensitive protein CDKN1A and detection method

Abstract

The present invention provides a set of sequences of oligonucleotide aptamers that specifically recognize the radiation-sensitive protein CDKN1A and a detection method, belonging to the technical field of protein detection. In the present invention, two specific aptamers were first screened for the radiation-sensitive protein CDKN1A through the SELEX technique, and the nucleotide sequences of the corresponding oligonucleotide aptamers are shown as SEQ ID No.1 and SEQ ID No.2. Both of the two oligonucleotide aptamers of the present invention can specifically recognize the CDKN1A protein without binding to other irrelevant proteins. The present invention also established a new detection method for the CDKN1A protein by using the principle of the microplate detection method, which can be used for radiation dose assessment and cell senescence identification. The detection method of the present invention has the advantages of high sensitivity and short detection time, and there is also a need to develop more applicable detection methods.

Description

Technical Field

[0001] The present invention belongs to the technical field of protein detection, and specifically relates to a sequence of oligonucleotide aptamers that specifically recognize the radiation-sensitive protein CDKN1A and a detection method. Background Art

[0002] SELEX (Systematic Evolution of Ligands by Exponential Enrichment) has developed since the 1990s and has become an indispensable research tool. Its basic principle is based on the complementary pairing of single-stranded oligonucleotide bases to form a high-level spatial structure, and these structures are used to specifically bind to target molecules. Generally, when using an oligonucleotide library of 10 14 -10 15 it is almost sufficient to encompass all possible structures. After multiple rounds of screening combined with PCR amplification, high-affinity nucleic acid aptamers will finally be obtained. Aptamers have similar affinity and specificity to antibodies. However, aptamers have low cost, are stable, are convenient to synthesize, and can be chemically modified at will. Therefore, aptamers are regarded as ideal antibody-like diagnostic reagents and potential substitutes.

[0003] With the rapid development of nuclear technology, its potential threats to the environment and human health are also increasing. In the case of nuclear and radiation accidents, accurately estimating the radiation dose received by personnel is the key to effectively treating the wounded, which is not only the basis for clinical diagnosis and treatment plans but also an important reference for the evaluation of long-term effects. In the case of accidents, physical dosimeters are limited in use because they cannot be popularized for everyone or the radiation dose received exceeds the range. At this time, a biodosimeter that uses some biological changes generated by the irradiated person himself to estimate the radiation dose can more accurately reflect the individual's true dose and the differences in individual sensitivity. The CDKN1A protein is an expressed protein with a radiation dose-effect relationship. Currently, many literatures have reported that the CDKN1A protein is related to cell cycle regulation in the early stage of DNA damage. By detecting the expression of the CDKN1A protein in the body of irradiated personnel, the radiation dose received by the irradiated personnel can be evaluated, providing a reference basis for subsequent treatment. At the same time, the CDKN1A protein is related to cell senescence, and it can be used as a molecular marker of cell senescence to identify the activation of the cell senescence pathway. Currently, the only detection method for the CDKN1A protein as an index of radiation damage and cell senescence is the Western Blot detection method, which has a long detection time. Summary of the Invention

[0004] The present invention provides a sequence of oligonucleotide aptamers that specifically recognize the radiation-sensitive protein CDKN1A and a detection method, which shortens the detection time to 4 hours while ensuring the detection sensitivity.

[0005] The present invention provides a group of oligonucleotide aptamers that specifically recognize the radiation-sensitive protein CDKN1A, and the nucleotide sequences of the oligonucleotide aptamers are shown as SEQ ID No.1 and SEQ ID No.2.

[0006] Preferably, it further includes modifying the oligonucleotide aptamer.

[0007] The present invention also provides the application of the above-mentioned oligonucleotide aptamer in the preparation of a kit for detecting the radiation-sensitive protein CDKN1A.

[0008] Preferably, the kit includes an aptamer microplate detection kit, an IP (Immunoprecipitation) detection kit, an immunofluorescence detection kit, an aptamer-binding EIS impedance sensor detection kit, or an aptamer-binding nanogold colorimetric detection kit.

[0009] The present invention also provides an aptamer microplate detection kit, which includes the above-mentioned oligonucleotide aptamer, a microplate, a coating buffer, a buffer, a blocking solution, and a chromogenic reagent.

[0010] Preferably, the chromogenic reagent includes a streptavidin-conjugated HRP reagent and a TMB chromogenic solution.

[0011] The present invention also provides a method for detecting the radiation-sensitive protein CDKN1A using a microplate, which includes the following steps: (1) dissolving the above-mentioned oligonucleotide aptamer in a buffer and denaturing it to obtain a denatured nucleic acid sequence;

[0012] (2) adding the denatured nucleic acid sequence obtained in step (1) to a microplate coated with the target protein and incubating them together;

[0013] (3) after the co-incubation, discarding the liquid in the wells, adding the chromogenic reagent, and determining whether the target protein contains the radiation-sensitive protein CDKN1A according to the color change and OD 450 value.

[0014] Preferably, the oligonucleotide aptamer in step (1) also includes chemical modification.

[0015] Preferably, it includes dissolving the chemically modified oligonucleotide aptamer in an incubation buffer and denaturing it at 95-100°C for 5-10 min; the incubation buffer includes a PBS buffer containing 1-5 mM MgCl2.

[0016] Preferably, the temperature of the co-incubation in step (2) is from room temperature to 37°C, and the time is 30-60 min.

[0017] Beneficial effects: Through the SELEX technique, two specific aptamers were first screened for the radiation-sensitive protein CDKN1A, and the nucleotide sequences of the oligonucleotide aptamers are shown as SEQ ID No.1 or SEQ ID No.2. After identification, both of the two oligonucleotide aptamers of the present invention can specifically recognize the CDKN1A protein without binding to other irrelevant proteins. The present invention also established a new method for detecting the CDKN1A protein by using the principle of microplate detection, which can be used for radiation dose assessment and cell senescence identification.

[0018] The method for detecting the CDKN1A protein by the aptamer microplate method developed in the present invention has the same sensitivity as the conventional Western Blot detection method, and the detection time is shortened to 4 hours. Moreover, there is still potential for developing other detection methods for the aptamer of the present invention. By chemically modifying the aptamer sequence, different methods can be combined to improve the detection sensitivity and increase the applicability, such as carrying out IP detection, immunofluorescence detection and other detection methods, and the synthesis cost is low. For example, when high-sensitivity detection is required, the aptamer can be combined with an EIS impedance sensor; when visual detection without equipment is required, an aptamer-binding gold nanoparticle colorimetric detection method can be used. Description of the Drawings

[0019] Figure 1 It is a comparison result diagram of the binding forces of the CDKN1A aptamer sequence with the CDKN1A protein and other irrelevant proteins;

[0020] Figure 2 It is a binding result diagram of P2103 competing with P2102 for the CDKN1A protein;

[0021] Figure 3 It is a binding result diagram of P2102 competing with P2103 for the CDKN1A protein;

[0022] Figure 4 It is an affinity detection result diagram of the P2102H and P2103 sequences with CDKN1A. Detailed Embodiments

[0023] The present invention provides a group of oligonucleotide aptamers that specifically recognize the radiation-sensitive protein CDKN1A, and the nucleotide sequences of the oligonucleotide aptamers are shown as SEQ ID No.1 or SEQ ID No.2.

[0024] Preferably based on the SELEX technique, the present invention screened two specific oligonucleotide aptamers for the CDKN1A protein, and their sequences are as follows:

[0025] P2102 (SEQ ID No.1): GCAATGGTACGGTACTTCCGGTGTGCGGTGGGGGAAGGGCTGGGTGGGACAAAAGTGCACGCTACTTTGCTAA;

[0026] P2103 (SEQ ID No.2): GCAATGGTACGGTACTTCCGGGTGGGCGGGAGGTGGGAGGTGGTGGAATCAAAAGTGCACGCTACTTTGCTAA;

[0027] P2101 (SEQ ID No.3): GCAATGGTACGGTACTTCCTCGTGGGTTTGCTGGGGTGGGTGGTGGGTCCAAAAGTGCACGCTACTTTGCTAA.

[0028] The oligonucleotide aptamer of the present invention can be modified, such as chemical modification. In the examples, biotinylation modification is taken as an example for illustration, but it cannot be regarded as the entire scope of protection of the present invention.

[0029] The present invention also provides the application of the above oligonucleotide aptamer in the preparation of a kit for detecting radiation-sensitive protein CDKN1A.

[0030] The oligonucleotide aptamers of the present invention can specifically recognize CDKN1A protein and do not bind to other irrelevant proteins. Therefore, the oligonucleotide aptamers can be used to detect CDKN1A protein, such as IP (Immunoprecipitation) detection, immunofluorescence detection, detection method of aptamer-binding EIS impedance sensor, and aptamer-binding nanogold colorimetric detection method, etc., to achieve qualitative and / or quantitative detection of CDKN1A protein. Therefore, it can be used to construct kits corresponding to each detection method, including aptamer microplate detection kit, IP (Immunoprecipitation) detection kit, immunofluorescence detection kit, aptamer-binding EIS impedance sensor detection kit or aptamer-binding nanogold colorimetric detection kit.

[0031] The present invention also provides an aptamer microplate detection kit, which includes the above-mentioned oligonucleotide aptamer, microplate, coating buffer, buffer, blocking solution and chromogenic reagent.

[0032] The microplate detection kit of the present invention can be used for qualitatively detecting the presence of CDKN1A in a target protein. During detection, the target protein needs to be coated onto the microplate. Preferably, after mixing the target protein with a coating buffer, it is added to the microplate and incubated at 37°C for 2 hours. Then, each well is washed with a buffer, and after washing, a blocking solution is added. After blocking at room temperature for 30 min, the coating of the target protein is completed. The coating buffer of the present invention is preferably 0.05 M carbonate buffer with a pH value of 9.6. The buffer of the present invention is preferably PBS buffer containing 5 mM MgCl2; the blocking solution is preferably 1% BSA solution.

[0033] The present invention uses the incubation buffer in the kit to dissolve the oligonucleotide aptamer, wherein the incubation buffer is preferably PBS buffer containing 1 - 5 mM MgCl2; the chromogenic reagent preferably includes streptavidin-conjugated HRP reagent and TMB chromogenic solution.

[0034] The present invention also provides a method for detecting the radiation-sensitive protein CDKN1A on a microplate, comprising the following steps: (1) dissolving the above oligonucleotide aptamer in a buffer and denaturing it to obtain a denatured nucleic acid sequence;

[0035] (2) adding the denatured nucleic acid sequence obtained in step (1) to a microplate coated with the target protein and performing co-incubation;

[0036] (3) after co-incubation, discarding the liquid in the well, adding a chromogenic reagent, and determining whether the target protein contains the radiation-sensitive protein CDKN1A according to the color change and OD 450 value.

[0037] The present invention preferably dissolves the chemically modified oligonucleotide aptamer in a buffer and denatures it to obtain a denatured nucleic acid sequence. The chemical modification preferably includes biotin labeling. In the examples, the biotin-labeled oligonucleotide aptamer is dissolved in the incubation buffer and denatured at 95 - 100°C for 5 - 10 min; the incubation buffer includes PBS buffer containing 1 - 5 mM MgCl2. After the denaturation is completed, the present invention is immediately placed on ice and cooled sufficiently.

[0038] The present invention preferably co-incubates the above denatured nucleic acid sequence with a microplate coated with the target protein. The coating preferably includes mixing the protein to be detected in a coating buffer (0.05 M carbonate buffer, pH 9.6), adding it to the microplate at 100 μL / well, and incubating at 37°C for 2 hours; each well is washed with 200 μL of PBS-MgCl2 buffer, washed 5 times repeatedly, and 200 μL of a blocking solution (1% BSA) is added and blocked at room temperature for 30 min.

[0039] The present invention preferably adds the denatured sequence (600 ng) into a microplate, and co-incubates the nucleic acid sequence with the protein. The temperature of the co-incubation is preferably room temperature, and the time is preferably 30 min. The room temperature referred to in the present invention preferably means 26 °C.

[0040] After the co-incubation, the present invention performs color development. First, discard the liquid in the wells after co-incubation, wash each well with 200 μL of PBS-MgCl2 buffer, repeat the washing 5 times, and completely suck out the liquid in the wells after the last washing; add 100 μL of streptavidin-conjugated HRP reagent diluted 1:1000 to each well, incubate at room temperature to 37 °C for 30-60 min, discard the liquid in the wells, and wash the plate 5 times by the same method; add 100 μL of TMB chromogenic solution to each well, develop color at room temperature in the dark, when there is an obvious color change, add 100 μL of termination solution, read the OD450nm wavelength with an enzyme-linked immunosorbent assay instrument, and an increase in the OD450nm wavelength reading compared with the control protein group or the blank group indicates the detection of the target protein.

[0041] To further illustrate the present invention, the sequences and detection methods of a group of oligonucleotide aptamers specifically recognizing the radiation-sensitive protein CDKN1A provided by the present invention are described in detail below in conjunction with examples, but they should not be construed as limiting the protection scope of the present invention.

[0042] Example 1

[0043] Comparison of the binding affinity between CDKN1A aptamer and CDKN1A protein and other irrelevant proteins

[0044] (1) Synthesize biotin-labeled aptamer sequences (P2102, SEQ ID No.1; P2103, SEQ ID No.2) and control sequences (P2101, SEQ ID No.3).

[0045] (2) Mix 1 μg of the protein to be detected in the coating buffer (0.05 M carbonate buffer, pH 9.6), add it to the microplate at 100 μL / well, and incubate at 37 °C for 2 hours. The proteins to be detected are: CDKN1A, PIG3, AKT2, and EGFR, and the Ensembl genome browser IDs are: ENSG00000124762, ENSG00000115129, ENSG00000105221, ENSG00000146648, respectively.

[0046] (3) Wash each well with 200 μL of PBS-MgCl2 buffer, repeat the washing 5 times, add 200 μL of the blocking solution (1% BSA), and block at room temperature for 30 min.

[0047] (4) Dissolve the biotin-labeled P2101, P2102 or P2103 sequence in the incubation buffer (1×PBS - 5 mM MgCl2), denature at 100 °C for 5 min, and immediately place on ice for sufficient cooling.

[0048] (5) Add the denatured sequence (600 ng) to the microplate, and co-incubate the nucleic acid sequence and the protein at room temperature for 30 min.

[0049] (6) Discard the liquid in the wells, wash each well with 200 μL of PBS-MgCl2 buffer, repeat the washing 5 times, and completely aspirate the liquid in the wells after the last wash.

[0050] (7) Add 100 μL of streptavidin-conjugated HRP reagent diluted 1:1000 to each well, incubate at room temperature for 30 min, discard the liquid in the wells, and wash the plate 5 times using the same method as above.

[0051] (8) Add 100 μL of TMB chromogenic solution to each well, develop color at room temperature in the dark. When there is an obvious color change, add 100 μL of stop solution, and read the OD value at 450 nm wavelength using an ELISA reader.

[0052] The results are as Figure 1 shown. P2102 and P2103 have good binding affinity with the CDKN1A protein, and there is no binding between the control sequence and the CDKN1A protein, nor between the P2102 and P2103 sequences and other proteins.

[0053] Example 2

[0054] P2102 or P2103 Competitive Binding Experiment

[0055] (1) Synthesize biotin-labeled and unlabeled P2102 or P2103 aptamer sequences.

[0056] (2) Mix 1 μg of the protein to be detected in the coating buffer (0.05 M carbonate buffer, pH 9.6), add 100 μL / well to the microplate, and incubate at 37 °C for 2 hours.

[0057] (3) Wash each well with 200 μL of PBS-MgCl2 buffer, repeat the washing 5 times, add 200 μL of the blocking solution (1% BSA), and block at room temperature for 30 min.

[0058] (4) Dissolve the biotin-labeled P2102 or P2103 sequence in the incubation buffer (1×PBS - 5 mM MgCl2), denature at 100 °C for 5 min, and immediately place on ice for sufficient cooling.

[0059] (5) Add 600 ng of the denatured sequence 600 into the microplate, and incubate the nucleic acid sequence with the protein at room temperature for 30 min.

[0060] (6) Discard the liquid in the wells, wash each well with 200 μL of PBS-MgCl2 buffer, repeat the washing 5 times, and completely aspirate the liquid in the wells after the last washing.

[0061] (7) Add 1, 5, 10, and 50-fold non-labeled P2102 or P2103 sequences, and incubate the nucleic acid sequence with the corresponding sequence for competitive binding at room temperature for 30 min.

[0062] (8) Discard the liquid in the wells, wash each well with 200 μL of PBS-MgCl2 buffer, repeat the washing 5 times, and completely aspirate the liquid in the wells after the last washing.

[0063] (9) Add 100 μL of streptavidin-conjugated HRP reagent diluted 1:1000 to each well, incubate at room temperature for 30 min, discard the liquid in the wells, and wash the plate 5 times using the same method as above.

[0064] (10) Add 100 μL of TMB chromogenic solution to each well, develop color at room temperature in the dark. When there is an obvious color change, add 100 μL of stop solution, and read the OD450nm wavelength using an ELISA reader.

[0065] The results are as Figure 2 and Figure 3 shown. P2102 and P2103 have a weak competitive relationship with the binding site of CDKN1A protein, indicating that their binding sites are different, but their structures may be similar.

[0066] Example 3

[0067] Detection of the affinity between the oligonucleotide aptamer sequence and CDKN1A

[0068] The BLI device adds different concentration gradients of CDKN1A protein including 0, 2.6, 4, 5.9, 8.9, 13.3, 20 μg / mL and 1.13 μg / mL of P2102 or P1203 aptamer into the wells of the BLI device reaction plate. Through the reaction steps of equilibration for 600 s, baseline drawing for 120 s, protein immobilization for 300 s, baseline drawing for 120 s, binding for 400 s, and dissociation for 120 s, simultaneously detect the interference signal on the surface of the membrane layer and perform fitting curve calculation to obtain its dissociation constant. The results are as Figure 4 shown. The dissociation constant of P2102 and CDKN1A protein is 2.04E-011 M, and the dissociation constant of P2103 and CDKN1A protein is 2.04E-011 M, 2.21E-07 M.

[0069] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, rather than all of them. People can also obtain other embodiments based on this embodiment without creative efforts, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A group of oligonucleotide aptamers that specifically recognize the radiation-sensitive protein CDKN1A, characterized in that, The nucleotide sequences of the oligonucleotide aptamers are shown in SEQ ID No.1 and SEQ ID No.

2.

2. The aptamer oligonucleotide according to claim 1, characterized in that, It also includes the modification of the oligonucleotide aptamer.

3. Use of the oligonucleotide aptamer according to claim 1 or 2 in the preparation of a kit for detecting the radiation-sensitive protein CDKN1A.

4. The application according to claim 3, wherein The types of the kit include at least one of the following: aptamer microplate detection kit, Immunoprecipitation detection kit, immunofluorescence detection kit, aptamer-binding EIS impedance sensor detection kit, or aptamer-binding nanogold colorimetric detection kit.

5. An aptamer microplate detection kit, characterized in that, It includes the oligonucleotide aptamer according to claim 1 or 2, a microplate, a coating buffer, a buffer, a blocking solution, and a chromogenic reagent.

6. The aptamer microplate detection kit according to claim 5, wherein The chromogenic reagent includes streptavidin-conjugated HRP reagent and TMB chromogenic solution.

Images