Apricot kernel size regulation gene PaPLT5 and its application

Abstract

The present invention discloses an apricot kernel size regulation gene PaPLT5 and its application. The CDS region sequence of this gene is shown in SEQ ID NO.1 or SEQ ID NO.2. When the expression level of the PaPLT5 gene in apricot plants increases, the size of apricot kernels increases. The PaPLT5 gene CDS sequence shown in SEQ ID NO.1 and the PaPLT5 gene CDS sequence shown in SEQ ID NO.2 are derived from Armeniaca sibirica and Armeniaca vulgaris Lam. plants, respectively. The present invention also discloses a primer set for quantitative PCR of the apricot kernel size regulation gene PaPLT5, a method for using the PaPLT5 gene to predict the size of mature apricot kernels, and a method for increasing the size of Arabidopsis thaliana seeds. Overexpression of the apricot kernel size regulation gene PaPLT5 provided by the present invention can significantly increase the weight, length, and width of the kernels.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering. Specifically, it is the apricot kernel size regulation gene PaPLT5 and its application. Background Art

[0002] Almonds are rich in nutrients. The content of crude fat can reach 522.2 g / kg, of which unsaturated fatty acids account for more than 90%, and the oleic acid content can reach more than 60%. It is known as "one of the four major nuts in the world". Armeniaca sibirica (L.) Lam. and Prunus armeniaca L. var. ansu Maxim. are two important group resources among apricots for kernel use. The kernels of Prunus armeniaca L. var. ansu Maxim. are flat and plump, rich in nutrients and of high quality. In contrast, Armeniaca sibirica (L.) Lam. is much smaller and rich in amygdalin. Therefore, taking the Armeniaca sibirica (L.) Lam. and Prunus armeniaca L. var. ansu Maxim. populations as research materials to mine the key genes for kernel size can provide valuable gene resources for the study of apricot kernel size. Summary of the Invention

[0003] Therefore, the technical problem to be solved by the present invention is to provide the apricot kernel size regulation gene PaPLT5 and its application. By overexpressing this gene, the weight, length and width of the kernel can be significantly increased to achieve positive regulation of the kernel size.

[0004] To solve the above technical problem, the present invention provides the following technical solution:

[0005] Application of the apricot kernel size regulation gene PaPLT5, the CDS sequence of the PaPLT5 gene is shown in SEQ ID NO.1 or SEQ ID NO.2; the PaPLT5 gene is used to regulate the apricot kernel size, and when the expression level of the PaPLT5 gene in the apricot plant increases, the size of the apricot kernel increases.

[0006] In the above application, when the expression level of the PaPLT5 gene in the apricot plant increases, the division rate of endosperm cells during the kernel growth period of the apricot increases, resulting in an increase in the weight, length and width of the mature apricot kernel.

[0007] In the above application, when artificially increasing the expression level of the PaPLT5 gene in the apricot plant, a recombinant overexpression vector containing the CDS sequence of the PaPLT5 gene shown in SEQ ID NO.1 or the CDS sequence of the PaPLT5 gene shown in SEQ ID NO.2 is transferred into the apricot plant; wherein, the sequences shown in SEQ ID NO.1 and SEQ ID NO.2 are respectively cloned from the cDNA of Armeniaca sibirica (L.) Lam. and Prunus armeniaca L. var. ansu Maxim.

[0008] In the above application, the original vector of the recombinant overexpression vector is the pHB plasmid, and the CDS sequence of the PaPLT5 gene is located between the BamHⅠ and PstⅠ restriction enzyme sites of the pHB plasmid. The pHB plasmid is a plant expression vector. When the CDS sequence of the PaPLT5 gene is constructed into a recombinant vector with the pHB plasmid and the recombinant vector is used to transform plants, the PaPLT5 gene will be highly expressed in the plants.

[0009] In the above application, when constructing the recombinant overexpression vector, primers with sequences shown in SEQ ID NO.3 and SEQ ID NO.4 are used to perform PCR on the CDS sequence of the PaPLT5 gene. The product obtained by PCR is the CDS sequence of the PaPLT5 gene with protective base sequences and restriction enzyme site sequences added at both ends. After the PCR product and the pHB plasmid are digested with restriction enzymes respectively, DNA ligase is then used to ligate the two to construct the recombinant overexpression vector.

[0010] A primer set for quantitative PCR of the above-mentioned apricot kernel size regulation gene PaPLT5, and this primer set contains primers with sequences shown in SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.9, and SEQ ID NO.10 respectively.

[0011] A method for using the above-mentioned apricot kernel size regulation gene PaPLT5 to predict the parameters of mature apricot kernels, where the parameters of mature apricot kernels are the weight, length, and width of mature apricot kernels, and the prediction method includes the following steps:

[0012] (1) During the growth period of the kernels, measure the expression levels of the PaPLT5 gene in the kernels of the apricot plants to be predicted and the reference apricot plants with known mature apricot kernel parameters respectively;

[0013] (2) Compare the expression level of the PaPLT5 gene in the kernels of the apricot plants to be predicted with the expression level of the PaPLT5 gene in the kernels of the reference apricot plants;

[0014] (3) According to the comparison result of the expression level of the PaPLT5 gene, combined with the parameters of the mature apricot kernels of the reference apricot plants, judge the size of the parameters of the mature apricot kernels of the apricot plants to be predicted;

[0015] Among them, the apricot plants to be predicted are Prunus sibirica and / or Prunus armeniaca var. ansu; if the expression level of the PaPLT5 gene in the kernels of the apricot plants to be predicted is greater than that in the kernels of the reference apricot plants, the prediction result is that the mature kernel parameters of the apricot plants to be predicted are greater than those of the reference apricot plants; if the expression level of the PaPLT5 gene in the kernels of the apricot plants to be predicted is less than that in the kernels of the reference apricot plants, the prediction result is that the mature kernel parameters of the apricot plants to be predicted are less than those of the reference apricot plants; if the expression level of the PaPLT5 gene in the kernels of the apricot plants to be predicted is equal to that in the kernels of the reference apricot plants, the prediction result is that the mature kernel parameters of the apricot plants to be predicted are equal to those of the reference apricot plants. The size of the mature kernel parameters represents the size of the mature apricot kernels. Through this method, it is possible to relatively accurately predict the size of the mature apricot kernels at an early stage of apricot kernel development, and use this to guide field management and production practice.

[0016] In the above method, in step (1), the quantitative PCR method is used to measure the expression level of the PaPLT5 gene in the kernels. In the primer set used for quantitative PCR, it contains primers with sequences shown in SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.9, and SEQ ID NO.10 respectively.

[0017] A method for using the above-mentioned apricot kernel size regulatory gene PaPLT5 to increase the seed size of Arabidopsis thaliana, in which a recombinant overexpression vector containing the sequence shown in SEQ ID NO.1 or the sequence shown in SEQ ID NO.2 is transformed into Arabidopsis thaliana. The 1000-seed weight, length, and width of the seeds of the Arabidopsis thaliana plants into which the PaPLT5 gene is transferred and the PaPLT5 gene is successfully expressed will all increase.

[0018] In the above method, the original vector of the recombinant overexpression vector is the pHB plasmid, and the CDS sequence of the PaPLT5 gene is located between the BamHⅠ and PstⅠ restriction enzyme sites of the pHB plasmid.

[0019] The technical solution of the present invention has achieved the following beneficial technical effects:

[0020] 1. The present invention provides the apricot kernel size regulatory gene PaPLT5, which affects the kernel weight, kernel longitudinal diameter, kernel transverse diameter, and kernel thickness during the growth period of apricot kernels by controlling endosperm cell division. Arabidopsis thaliana transgenic experiments have proved that whether it is Arabidopsis thaliana into which the PaPLT5 gene from Prunus armeniaca var. ansu is transferred or Arabidopsis thaliana into which the PaPLT5 gene from Prunus sibirica is transferred, the 1000-seed weight, kernel longitudinal diameter, and kernel transverse diameter of its seeds have all increased significantly, further verifying the role of the PaPLT5 gene in regulating kernel size.

[0021] 2. The primer set for quantitative PCR of the PaPLT5 gene provided by the present invention can be used for quantitatively detecting the expression level of the PaPLT5 gene in apricot plants. When cultivating overexpression lines, detecting the expression level of the PaPLT5 gene in transgenic lines helps technicians determine whether the overexpression lines are successfully constructed, which provides a reliable technical path for realizing the regulation of kernel size among different apricot varieties. In actual production, detecting the expression level of the PaPLT5 gene in kernels at the early stage of apricot kernel development helps technicians evaluate the yield potential and almond quality potential of apricot plants.

[0022] 3. In the present invention, a recombinant overexpression vector of the PaPLT5 gene is constructed, which can transform Arabidopsis plants and apricot plants and play a role in positively regulating the size of kernels (seeds) after successful transformation. Moreover, this recombinant overexpression vector can not only increase the yield and quality of apricot kernels, but also provide an efficient and controllable gene improvement method for the apricot planting industry, promoting the progress of apricot planting technology. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Analysis diagram of the variation in dry weight of kernels in the Prunus armeniaca var. ansu and Prunus sibirica populations in the present invention;

[0024] Figure 2 Analysis diagram of the variation in longitudinal diameter of kernels in the Prunus armeniaca var. ansu and Prunus sibirica populations in the present invention;

[0025] Figure 3 Analysis diagram of the variation in transverse diameter of kernels in the Prunus armeniaca var. ansu and Prunus sibirica populations in the present invention;

[0026] Figure 4 Analysis diagram of the variation in thickness of kernels in the Prunus armeniaca var. ansu and Prunus sibirica populations in the present invention;

[0027] Figure 5 Distribution diagram of the genome-wide Fst values in the Prunus armeniaca var. ansu and Prunus sibirica populations in the present invention;

[0028] Figure 6 Variation diagram of the longitudinal diameter of kernels during the kernel development of the Longwangmao variety and the PT6 variety in the present invention;

[0029] Figure 7 Variation diagram of the transverse diameter of kernels during the kernel development of the Longwangmao variety and the PT6 variety in the present invention;

[0030] Figure 8 Variation diagram of the thickness of kernels during the kernel development of the Longwangmao variety and the PT6 variety in the present invention;

[0031] Figure 9 Variation diagram of the kernel weight / dry weight during the kernel development of the Longwangmao variety and the PT6 variety in the present invention;

[0032] Figure 10a Cross-sectional views of the kernels of the Longwangmao variety and the PT6 variety in the present invention at 20 days of kernel development;

[0033] Figure 10b Cross-sectional views of the kernels of the Longwangmao variety and the PT6 variety in the present invention at 25 days of kernel development;

[0034] Figure 10c Cross-sectional views of the kernels of the Longwangmao variety and the PT6 variety in the present invention at 30 days of kernel development;

[0035] Figure 10d Cross-sectional views of the kernels of the Longwangmao variety and the PT6 variety in the present invention at 40 days of kernel development;

[0036] Figure 10e Cross-sectional views of the kernels of the Longwangmao variety and the PT6 variety in the present invention at 50 days of kernel development;

[0037] Figure 10f Cross-sectional views of the kernels of the Longwangmao variety and the PT6 variety in the present invention at 60 days of kernel development;

[0038] Figure 10g Cross-sectional views of the kernels of the Longwangmao variety and the PT6 variety in the present invention at 80 days of kernel development;

[0039] Figure 10h Cross-sectional views of the kernels of the Longwangmao variety and the PT6 variety in the present invention at 100 days of kernel development;

[0040] Figure 11 Graph of the change in the length of endosperm cells of the kernels of the Longwangmao variety and the PT6 variety during the growth period in the present invention;

[0041] Figure 12 Graph of the change in the width of endosperm cells of the kernels of the Longwangmao variety and the PT6 variety during the growth period in the present invention;

[0042] Figure 13 Graph of the change in the length of cotyledon cells of the kernels of the Longwangmao variety and the PT6 variety during the filling period in the present invention;

[0043] Figure 14 Graph of the change in the width of cotyledon cells of the kernels of the Longwangmao variety and the PT6 variety during the filling period in the present invention;

[0044] Figure 15 Transcriptome clustering map and module-trait relationship map of the kernels of the Longwangmao variety during the growth period in the present invention;

[0045] Figure 16 Transcriptome clustering map and module-trait relationship map of the kernels of the Longwangmao variety during the filling period in the present invention;

[0046] Figure 17Transcriptome clustering map and module-trait relationship map of the kernels of PT6 variety during the growth period in the present invention;

[0047] Figure 18 Transcriptome clustering map and module-trait relationship map of the kernels of PT6 variety during the filling period in the present invention;

[0048] Figure 19 Results of linkage disequilibrium analysis of PaPLT5 gene in Prunus armeniaca var. ansu population and Armeniaca sibirica population in the present invention;

[0049] Figure 20 Results of analysis of PaPLT5 gene expression pattern in Prunus armeniaca var. mandshurica cv. Longwangmao and Armeniaca sibirica PT6 variety in the present invention;

[0050] Figure 21a Photo of Arabidopsis thaliana seeds transfected with the recombinant vector containing PaPLT5 gene in the present invention;

[0051] Figure 21b Photo of screening for positive seedlings of Arabidopsis thaliana transfected with the recombinant vector containing PaPLT5 gene in the present invention;

[0052] Figure 21c Arabidopsis thaliana seedlings transfected with the recombinant vector containing PaPLT5 gene in the present invention;

[0053] Figure 21d Results of screening for transgenic positive lines of Arabidopsis thaliana transfected with PaPLT5 gene from Prunus armeniaca var. mandshurica cv. Longwangmao in the present invention;

[0054] Figure 21e Results of screening for transgenic positive lines of Arabidopsis thaliana transfected with PaPLT5 gene from PT6 in the present invention;

[0055] Figure 22 Results of determination of PaPLT5 gene expression level in transgenic positive lines of Arabidopsis thaliana transfected with PaPLT5 gene from Prunus armeniaca var. mandshurica cv. Longwangmao in the present invention;

[0056] Figure 23 Results of determination of PaPLT5 gene expression level in transgenic positive lines of Arabidopsis thaliana transfected with PaPLT5 gene from PT6 in the present invention;

[0057] Figure 24a Photo of seeds of wild-type Arabidopsis thaliana lines not transfected with PaPLT5 gene in the present invention;

[0058] Figure 24b Photo of seeds of transgenic positive line LWM-8 of Arabidopsis thaliana transfected with PaPLT5 gene in the present invention;

[0059] Figure 24c Photo of seeds of transgenic positive line LWM-15 of Arabidopsis thaliana transfected with PaPLT5 gene in the present invention;

[0060] Figure 24d Seed photo of Arabidopsis thaliana positive line PT6-12 into which the PaPLT5 gene was transferred in the present invention;

[0061] Figure 24e Seed photo of Arabidopsis thaliana positive line PT6-14 into which the PaPLT5 gene was transferred in the present invention;

[0062] Figure 25 Comparison of 1000-seed weight of some Arabidopsis thaliana positive lines into which the PaPLT5 gene was transferred in the present invention;

[0063] Figure 26 Comparison of longitudinal diameter of seeds of some Arabidopsis thaliana positive lines into which the PaPLT5 gene was transferred in the present invention;

[0064] Figure 27 Comparison of transverse diameter of seeds of some Arabidopsis thaliana positive lines into which the PaPLT5 gene was transferred in the present invention. Detailed implementation manners

[0065] Collect the phenotypic (Table 1) and re-sequencing data of 40 kernels of Armeniaca vulgaris and 53 kernels of Prunus sibirica populations. As Figures 1 to 4 , they respectively correspond to the statistical results of kernel dry weight (Weight in the figure), kernel longitudinal diameter (Length in the figure, that is, the length of the kernel), kernel transverse diameter (Width in the figure, that is, the width of the kernel), and kernel thickness (Thickness in the figure). LFA represents the Armeniaca vulgaris population, SA represents the Prunus sibirica population, and Wilcoxon represents the signed rank test. Through phenotypic data analysis, it is found that the ranges of kernel dry weight of Armeniaca vulgaris and Prunus sibirica are 0.59 - 1.12 g and 0.15 - 0.49 g respectively, the ranges of kernel longitudinal diameter are 16.90 - 24.43 mm and 8.76 - 15.10 mm respectively, the ranges of kernel transverse diameter are 11.00 - 18.00 mm and 7.65 - 12.27 mm respectively, and the ranges of kernel thickness are 4.78 mm - 9.77 mm and 5.13 - 8.27 mm respectively. Significance analysis shows that there are extremely significant differences in kernel dry weight, kernel longitudinal diameter, and kernel transverse diameter between the two populations (P < 0.001). The means of the Armeniaca vulgaris population (kernel dry weight 0.83 g, kernel longitudinal diameter 20.5 mm, kernel transverse diameter 14.4 mm) are all greater than those of the Prunus sibirica population (kernel dry weight 0.32 g, kernel longitudinal diameter 12.8 mm, kernel transverse diameter 10.5 mm), indicating that the kernels of Armeniaca vulgaris are significantly larger than those of Prunus sibirica.

[0066] Table 1 Phenotypic data of kernels of Armeniaca vulgaris and Prunus sibirica populations

[0067]

[0068]

[0069]

[0070] Genome-wide selection signal analysis was performed on the resequencing data of two populations. Filtering was carried out according to the criteria of the top 5% of Fst and the single-site Fst value > 0.8. Combining gene annotation information, a total of 57 candidate genes related to seed size were obtained. The genome-wide Fst value distribution map is as shown in Figure 5 . In the figure, FST refers to the genetic differentiation index between populations, Chromosome refers to the chromosome, LFA represents the Armeniaca vulgaris var. ansu population, and SA represents the Armeniaca sibirica population.

[0071] By analyzing the phenotypic and section data of the seed development of Armeniaca vulgaris var. ansu 'Longwangmao' (LWM) and Armeniaca sibirica 'PT6' (S1-S8 represent 20 days, 25 days, 30 days, 40 days, 50 days, 60 days, 80 days, and 100 days after flowering), as shown in Figures 10a to 10h , the cotyledons began to fill the seeds from the S5 stage. Therefore, taking the S5 stage as the time node, the entire development cycle of the seeds was divided into a 'growth period' and a 'filling period'. As shown in Figures 6 to 9 , during the growth period (S1-S4), the kernel weight, kernel longitudinal diameter, kernel transverse diameter, and kernel thickness of the seeds of 'Longwangmao' and 'PT6' showed an increasing trend, while they were in a stable state during the filling period (S5-S8) (the kernel weight in Figure 9 represents the fresh weight of the seeds, and the dry weight represents the weight of the seeds after removing water). The kernel weight, kernel longitudinal diameter, and kernel transverse diameter of 'Longwangmao' were significantly higher than those of 'PT6' during the growth period. There were no significant differences in the length and width of the endosperm cells between the 'Longwangmao' and 'PT6' varieties during the growth period ( Figure 11 and Figure 12 ), indicating that the difference in seed size during the growth period was affected by the number of endosperm cells. As the growth period approached the end, the cell division rate gradually decreased. There were no significant changes in the length and width of the cotyledon cells during the filling period ( Figure 13 and Figure 14 ), indicating that the filling period was mainly characterized by cotyledon cell division.

[0072] Weighted gene co-expression network analysis (WGCNA) was performed on the transcriptome data of the seed development of Armeniaca vulgaris var. ansu 'Longwangmao' and Armeniaca sibirica 'PT6' at the S1-S8 stages. Module localization was carried out for the above 57 candidate genes, and a total of 44 candidate genes were located. As shown in Figures 15 to 18 , Figure 15 is the transcriptome clustering map and module-trait relationship map of the seeds of the 'Longwangmao' variety during the growth period; Figure 16 is the transcriptome clustering map and module-trait relationship map of the seeds of the 'Longwangmao' variety during the filling period;Figure 17 The transcriptome clustering map and the module-trait relationship map of the seeds of PT6 variety during the growth period; Figure 18 The transcriptome clustering map and the module-trait relationship map of the seeds of PT6 variety during the filling period. As can be seen from the figure, the PaPLT5 gene is present in both the Turquoise(-) module and the Green(-) module that are negatively correlated with the growth period of "LWM" and "PT6". Combining Figures 10a to 12 it can be known that the number of endosperm cells in the "LWM" during the growth period is higher than that in "PT6", and the expression level of the PaPLT5 gene in "LWM" is also higher than that in "PT6" ( Figure 20 The analysis results of the PaPLT5 gene expression pattern in can be used as evidence), it is speculated that the PaPLT5 gene affects the seed size by controlling the division rate of endosperm cells during the growth period. In addition, the PaPLT5 gene is also present in the Blue(+) module and the Brown(+) module that are positively correlated with the filling period, indicating that this gene is associated with the entire development period of the seeds. Therefore, it is speculated that the PaPLT5 gene plays a key role in the process of seed development.

[0073] PaPLT5 belongs to one of the members of the PLT subfamily of the transcription factor AP2 family. PLT genes play a central role in processes such as embryonic development, stem cell niche (quiescent center, QC), meristem maintenance, and organ growth and development. By performing linkage disequilibrium analysis (LD block) on the PaPLT5 gene between two populations, it was found that the entire PaPLT5 gene and its adjacent upstream and downstream regions are located within a linkage region, and there are also multiple small linkage regions distributed upstream and downstream of the PaPLT5 gene (such as Figure 19 shown). Expression pattern analysis showed that during the growth period, the expression level of the PaPLT5 gene in the "LWM" variety was always higher than that in "PT6" (such as Figure 20 shown).

[0074] The above results indicate that the seeds of the "LWM" variety are larger than those of the "PT6" variety, and the reason is very likely related to the higher expression level of the PaPLT5 gene in "LWM". There are more linkage fragments distributed upstream and downstream of the PaPLT5 gene. Due to the limitations of the above various analysis methods themselves, it is difficult to completely and accurately determine the direct relationship between the expression level of the PaPLT5 gene and the size of apricot seeds only based on the analysis results. In order to further determine that the larger seeds of the "LWM" variety are directly related to the expression level of the PaPLT5 gene and exclude the influence of the fragments linked to the PaPLT5 gene on the seed size, further, a heterologous overexpression experiment of the PaPLT5 gene was carried out in Arabidopsis thaliana.

[0075] Retrieve the gene ID, location information, and CDS sequence corresponding to the PaPLT5 gene from the genomes of "Longwangmao" and "PT6" respectively. Based on this, design primers and use the designed primers to clone the CDS sequences of the PaPLT5 gene from the cDNA of Longwangmao and PT6 respectively. Insert the cloned CDS sequences into plant overexpression vectors and conduct Arabidopsis thaliana genetic transformation.

[0076] PaPLT5 is located at positions 6454298 - 6457579 on chromosome 1 of the "PT6" genome. The gene ID is PaF106G0100001002, and the CDS sequence (i.e., the coding sequence) information is as follows:

[0077] PaF106G0100001002 (SEQ ID NO.1)

[0078]

[0079] PaPLT5 is located at positions 6974530 - 6978142 on chromosome 1 of the "Longwangmao" genome, with the gene ID PaLWMG0100001066. The CDS sequence information is as follows:

[0080] PaLWMG0100001066 (SEQ ID NO.2)

[0081]

[0082] Primers were designed based on the CDS of the above two genotypes, and mRNA was extracted from the leaves of Longwangmao and PT6, reverse-transcribed into cDNA, and then used for cloning the target gene, followed by transgenic overexpression in Arabidopsis thaliana of the Columbia type. When constructing the recombinant overexpression vector, the digestion-ligation method was used for construction, and the Escherichia coli strain DH5α was used for blue-white screening. The original vector of the recombinant overexpression vector was the pHB plasmid, and Agrobacterium tumefaciens competent GV3101 was used for genetic transformation. Table 2 shows the information on the plasmids and primers used when constructing the recombinant overexpression vector.

[0083] Table 2 Plasmid and Primer Information

[0084]

[0085] In this example, when constructing the recombinant overexpression vector, the BamHⅠ and PstⅠ restriction enzyme site sequences were respectively added to the 5' ends of primers 1002F and 1002R, and a protection base sequence was added to both. After performing PCR on the CDS sequence of the PaPLT5 gene using 1002F and 1002R, the obtained PCR product contained the complete CDS sequence of the PaPLT5 gene, and the protection base sequence and the BamHⅠ restriction enzyme site, as well as the protection base sequence and the PstⅠ restriction enzyme site, were respectively added to both ends of the PaPLT5 gene CDS sequence in this PCR product. In some other examples, according to the different restriction enzyme sites on the selected original vector, the restriction enzyme sites added to both ends of the CDS sequence can be adjusted. Correspondingly, the sequences of the primer pairs used should also be adjusted, but the 3' end of one of the primer pairs should include ATGGATTCTTCTCCTCAGAACTGGC (SEQ ID NO.7), and the 3' end of the other should include TTATTCCATGCCAAAAATTGGTGTC (SEQ ID NO.8) so that the primer pair can completely clone the CDS sequence of the PaPLT5 gene. In addition, the primers with the sequences shown in SEQ ID NO.7 and SEQ ID NO.8 can also be used for cloning the PaPLT5 gene (i.e., using cDNA as a template to clone the CDS sequence of the PaPLT5 gene).

[0086] The inventors cloned the PaPLT5 gene from the cDNA of "LWM" and "PT6" respectively and constructed the PHB-PT6-PaPLT5 and PHB-LWM-PaPLT5 vectors, and performed overexpression analysis in Arabidopsis thaliana by the Agrobacterium-mediated transformation method. Leaves were collected from the obtained transgenic Arabidopsis thaliana plants for PCR detection to screen for transgenic positive seedlings. Figures 21a to 21cThe process of obtaining positive seedlings is shown in detail. Through PCR verification of the Arabidopsis thaliana plants obtained by genetic transformation, 16 transgenic positive lines of LWM-PaPLT5 (i.e., transgenic positive lines of Arabidopsis thaliana into which the PaPLT5 gene derived from Longwangmiao was introduced, as shown in Figure 21d ), and 13 transgenic positive lines of PT6-PaPLT5 (i.e., transgenic positive lines of Arabidopsis thaliana into which the PaPLT5 gene derived from PT6 was introduced, as shown in Figure 21e ) were successfully screened out.

[0087] Six lines were selected from each of the 16 transgenic positive lines of LWM-PaPLT5 and 13 transgenic positive lines of PT6-PaPLT5, and the rosette leaves of Arabidopsis thaliana of each line were collected for the determination of relative expression levels. The quantitative PCR primer sequences for the PaPLT5 gene were PT6 / LWMF: AGGCACAGGTGGACAGGAAG (SEQ ID NO.5), PT6 / LWMR: AGAGCTGCCAGATCGTAGGC (SEQ ID NO.6). The quantitative PCR primer sequences for the Actin gene as an internal reference were Actin2F (SEQ ID NO.9): TTCTTCTTACCGAGGCTCCTC, Actin2R (SEQ ID NO.10): GAATCCAGCACAATACCGGTTG. The results of PaPLT5 expression levels are shown in Figure 22 and Figure 23 . In the LWM positive lines (i.e., transgenic positive lines into which the PaPLT5 gene derived from LWM was introduced), the PaPLT5 expression levels in the LWM-8 and LWM-15 lines were significantly higher than those in the negative lines; in the PT6 lines (i.e., transgenic positive lines into which the PaPLT5 gene derived from PT6 was introduced), the PaPLT5 expression levels in the PT6-12 and PT6-14 lines were significantly higher than those in the negative lines. The 1000-seed weight, length, and width of the T2 generation seeds of these four positive lines and wild-type plants were respectively statistically analyzed. The seed photos are shown in Figures 24a to 24e . Among them, Figure 24a are the seeds of wild-type Arabidopsis thaliana, Figure 24b are the seeds of the LWM-8 line, Figure 24c are the seeds of the LWM-15 line, Figure 24d are the seeds of the PT6-12 line, Figure 24e are the seeds of the PT6-14 line. The statistical results of the 1000-seed weight, seed length, and seed width are respectively shown in Figure 25 , Figure 26 and Figure 27As shown, the 1000-seed weight of the transgenic positive lines increased by 22.5% - 65.1%, the seed length increased by 19.6% - 32.1%, and the seed width increased by 14.9% - 22.2%, indicating that the PaPLT5 gene has the function of positively regulating seed size, which is consistent with the expectation.

[0088] From the above results, it can be seen that when the PaPLT5 genes of PT6 and LWM are overexpressed in Arabidopsis plants, the size of the seeds can be increased.

[0089] The above-mentioned PHB-PT6-PaPLT5 and PHB-LWM-PaPLT5 recombinant overexpression vectors are both plant expression vectors, and either of them can be used for genetic transformation of apricots to increase the kernel size of the transformed plants.

[0090] Furthermore, by quantitatively or semi-quantitatively measuring the expression level of the PaPLT5 gene in apricot kernels during the growth period, the size of mature apricot kernels can also be predicted. The size of mature apricot kernels can be measured by mature kernel parameters, which refer to four indicators: the longitudinal diameter (length), transverse diameter (width), fresh weight, and dry weight of the almond. Among them, the fresh weight and dry weight can be represented by weight uniformly (for mature kernels, the greater the fresh weight, the greater the dry weight). The larger the mature kernel parameters, the larger the size of mature apricot kernels.

[0091] When predicting, the following steps can be carried out:

[0092] (1) During the growth period of the kernels, take the kernels of the reference apricot plants and the kernels of the apricot plants to be predicted respectively, and measure the expression level of the PaPLT5 gene in the kernels.

[0093] The reference apricot plants can be the "LWM" and / or "PT6" plants in this example, or other apricot plants with known mature kernel parameters. The apricot plants to be predicted can be other varieties of Prunus sibirica and / or Prunus armeniaca var. ansu plants. When measuring, multiple repetitions can be set and the average value can be taken. When measuring the expression level, use PT6 / LWMF: AGGCACAGGTGGACAGGAAG (SEQ ID NO.5), PT6 / LWMR: AGAGCTGCCAGATCGTAGGC (SEQ ID NO.6) to perform quantitative or semi-quantitative PCR on the PaPLT5 gene, and the internal reference gene is the Actin gene. The quantitative PCR primer sequences of the Actin gene are Actin2F (SEQ ID NO.9): TTCTTCTTACCGAGGCTCCTC, Actin2R (SEQ ID NO.10): GAATCCAGCACAATACCGGTTG.

[0094] (2) Compare the expression level of PaPLT5 in the kernels of the apricot plants to be predicted with the expression level of the PaPLT5 gene in the kernels of the reference apricot plants.

[0095] (3) Based on the comparison results of the PaPLT5 gene expression levels, combined with the sizes of the mature kernel parameters of the reference apricot plants, determine the size of the mature kernels of the apricot plants to be predicted.

[0096] If the expression level of PaPLT5 in the kernels of the apricot plants to be predicted is greater than the expression level of PaPLT5 in the kernels of the reference apricot plants, the prediction result is that the mature kernel parameters of the apricot plants to be predicted are greater than the mature kernel parameters of the reference apricot plants; if the expression level of PaPLT5 in the kernels of the apricot plants to be predicted is less than the expression level of PaPLT5 in the kernels of the reference apricot plants, the prediction result is that the mature kernel parameters of the apricot plants to be predicted are less than the mature kernel parameters of the reference apricot plants; if the expression level of PaPLT5 in the kernels of the apricot plants to be predicted is equal to the expression level of PaPLT5 in the kernels of the reference apricot plants, the prediction result is that the mature kernel parameters of the apricot plants to be predicted are equal to the mature kernel parameters of the reference apricot plants. The mature kernel parameters of the apricot plants to be predicted being greater than the mature kernel parameters of the reference apricot plants means that the length, width, and weight (including fresh weight and dry weight) of the mature kernels of the apricot plants to be predicted are all greater than those of the mature kernels of the reference apricot plants.

[0097] Using this method to predict the size of apricot kernels can accurately predict the longitudinal diameter (length), transverse diameter (width), and weight (including fresh weight and dry weight) of mature apricot kernels at an early stage of apricot fruit development, and then complete the estimation of almond yield. In the actual production of almonds, predicting these indicators as early as possible is beneficial to optimizing planting management measures. That is, for plants with greater yield potential and almond quality potential (generally, the larger the single almond, the better the almond quality), sufficient water and fertilizers should be provided to give full play to their potential. For plants with smaller yield potential and almond quality potential, excessive water and fertilizers should not be blindly given to avoid waste of water and fertilizers. In addition, estimating the yield as early as possible is also beneficial for producers to timely formulate more reasonable market plans and pricing strategies and obtain higher market benefits.

[0098] Obviously, the above embodiments are merely examples given for clear illustration and are not limitations on the implementation manners. For those of ordinary skill in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to enumerate all the implementation manners here. And the obvious changes or modifications derived therefrom are still within the protection scope of the claims of this patent application.

Claims

1. Application of apricot kernel size regulation gene PaPLT5, characterized in that, The CDS sequence of the PaPLT5 gene is shown in SEQ ID NO.1 or SEQ ID NO.2; the PaPLT5 gene is used to regulate the size of apricot kernels, and when the expression level of the PaPLT5 gene in apricot plants increases, the size of apricot kernels increases.

2. The application according to claim 1, characterized in that, When artificially increasing the expression level of the PaPLT5 gene in apricot plants, a recombinant overexpression vector containing the CDS sequence of the PaPLT5 gene shown in SEQ ID NO.1 or the CDS sequence of the PaPLT5 gene shown in SEQ ID NO.2 is transferred into apricot plants; among them, the sequences shown in SEQ ID NO.1 and SEQ ID NO.2 are cloned from the cDNA of Armeniaca sibirica and Armeniaca vulgaris Lam., respectively.

3. The application according to claim 2, wherein When constructing the recombinant overexpression vector, primers with sequences shown in SEQ ID NO.3 and SEQ ID NO.4 are used to perform PCR on the CDS sequence of the PaPLT5 gene.

4. A primer set for quantitative PCR of the apricot kernel size regulation gene PaPLT5 as described in claim 1, characterized in that, This primer set contains primers with sequences shown in SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.9, and SEQ ID NO.10, respectively.

5. A method for using the apricot kernel size regulatory gene PaPLT5 as described in claim 1 to increase the seed size of Arabidopsis thaliana, characterized in that, The recombinant overexpression vector containing the sequence shown in SEQ ID NO.1 or the sequence shown in SEQ ID NO.2 is transformed into Arabidopsis thaliana.

6. The method according to claim 5, characterized in that, The original vector of the recombinant overexpression vector is the pHB plasmid, and the CDS sequence of the PaPLT5 gene is located between the BamHⅠ and PstⅠ restriction enzyme sites of the pHB plasmid.

Images