Application of a targeted editing of rice OsPLATZ1 gene in improving rice grain shape and yield

Abstract

The present invention belongs to the field of genetic engineering breeding technology and specifically discloses the application of targeted editing of the rice OsPLATZ1 gene to improve rice grain shape and yield. Using CRISPR / Cas genome editing technology, site-specific mutations are performed on the promoter and 5' UTR regions of the rice OsPLATZ1 gene, creating a mutant line with altered expression levels of the OsPLATZ1 gene. This alters the relative expression of the OsPLATZ1 gene, which is associated with panicle development, in the mutant line. Compared to the wild-type indica rice variety Huaguang, this new rice line was quickly and efficiently obtained with altered grain length, aspect ratio, number of grains per panicle, and 1000-grain weight. This approach satisfies people's preference for rice grain shape while simultaneously overcoming the mutual constraints between grain shape and grain number, resulting in superior lines with significantly increased yield. This approach, applied in breeding, addresses the yield challenge and provides important germplasm resources for high-yield rice breeding.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering breeding, and in particular to the application of targeted editing of the rice OsPLATZ1 gene in improving rice grain shape and yield. Background Art

[0002] Rice is one of the world's most important food crops, serving as the staple food for over half of the world's population. Its production is crucial for food security. Grain shape, a quantitative trait regulated by multiple genes and determined by its length, width, and thickness, is a key factor in determining rice yield and appearance. Existing research indicates that the regulatory mechanisms of rice grain size are highly complex, with identified signaling pathways involving plant hormone signaling, the ubiquitin-proteasome pathway, G protein signaling, MAPK cascades, and transcriptional regulation.

[0003] GL6 / SG6 is a major gene that synergistically regulates grain number per panicle and grain shape, namely OsPLATZ1, described in this paper. OsPLATZ1 is a member of the PLATZ family that was earlier reported in rice. It acts as a transcription factor to positively regulate rice grain shape. A paper published on June 1, 2020, by Xu Can of South China Agricultural University, titled "Two PLATZ Family Genes Regulate Rice Panicle Development," revealed that the OsPLATZ1 gene is involved in regulating rice panicle and grain development.

[0004] However, OsPLATZ1 functional defects lead to an increase in grain number per panicle and shortened grain length, controlling both grain shape and grain number, a regulation that occurs at different growth stages. Furthermore, plants with OsPLATZ1 mutants grow thicker than wild-type plants. Modifying OsPLATZ1 to increase rice yield without affecting other agronomic traits is a challenging problem. Summary of the Invention

[0005] In order to solve the above technical problems, the present invention provides an application of targeted editing of the rice OsPLATZ1 gene in improving rice grain shape and yield.

[0006] To achieve the above object, the present invention is implemented according to the following technical solutions:

[0007] A targeted editing method for the rice OsPLATZ1 gene is disclosed for improving rice grain shape and yield. The method comprises: simultaneously editing four target sites (T1, T2, T3, and T4) upstream of the start codon of the rice OsPLATZ1 gene using CRISPR / Cas9 genome editing technology to obtain a genome editing vector, which is then transformed into conventional indica rice to obtain a rice mutant line with improved grain number and shape. The sequence of the upstream portion of the start codon of the rice OsPLATZ1 gene is shown in SEQ ID NO. 1, and the upstream portion of the start codon is a promoter regulatory region or a 5' UTR regulatory region. The sequences of the target sites T1 to T4 are shown in SEQ ID NO. 2 to SEQ ID NO. 5, respectively.

[0008] Furthermore, simultaneously editing the four target sites T1, T2, T3, and T4 includes: constructing an sgRNA expression cassette containing the four target sites T1, T2, T3, and T4.

[0009] Furthermore, the forward and reverse primer sequences for constructing the sgRNA expression cassette containing target T1 are shown in SEQ ID NO.6 and SEQ ID NO.7; the forward and reverse primer sequences for constructing the sgRNA expression cassette containing target T2 are shown in SEQ ID NO.8 and SEQ ID NO.9; the forward and reverse primer sequences for constructing the sgRNA expression cassette containing target T3 are shown in SEQ ID NO.10 and SEQ ID NO.11; the forward and reverse primer sequences for constructing the sgRNA expression cassette containing target T4 are shown in SEQ ID NO.12 and SEQ ID NO.13.

[0010] Compared to existing technologies, this invention utilizes CRISPR / Cas genome editing technology to perform site-specific mutations in the promoter and 5'UTR regions of the rice OsPLATZ1 gene, creating mutant lines with altered expression levels of the OsPLATZ1 gene. The relative expression of the OsPLATZ1 gene, which is associated with panicle development, was modified to varying degrees in these mutant lines. Compared to the wild-type indica rice variety Huaguang, this method quickly and efficiently generated new rice lines with varying degrees of alteration in grain length, aspect ratio, number of grains per panicle, and 1000-grain weight. This approach simultaneously addresses the public's preference for rice grain shape and overcomes the mutual constraints between grain shape and grain number, resulting in superior lines with significantly increased yield. This approach, applied in rice breeding, addresses the key yield challenge and provides important germplasm resources for high-yield rice breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1Schematic diagram of the promoter, regulatory region, and CRISPR / Cas9 target sites of the rice OsPLATZ1 gene: HG represents the conventional indica rice variety Huaguang, the four arrows represent the four editing targets, and the rice line CRR-1 formed after editing is shown.

[0012] Figure 2 The promoter regulatory region and 5'UTR regulatory region of the rice OsPLATZ1 gene and the target sequence variation of the editing mutant line CRR-1: HG represents the reference sequence of the wild-type transformation recipient indica rice (Huaguang), the gray background represents the 5'UTR region sequence, the yellow background represents the partial sequence of the first exon of the rice OsPLATZ1 gene, the underline represents the four target sites, the red "-" represents the base deletion, and the dark blue font represents the base insertion.

[0013] Figure 3 The phenotypic comparison diagram of the rice mutant line and the wild type HG: the first row is the phenotype of the overall rice plant type, the second row is the phenotype of the panicle, and the third row is the phenotype of the rice seed type.

[0014] Figure 4 Figure 3 shows the relative expression detection results of the OsPLATZ1 gene and the statistical results of agronomic traits of the rice mutant line and wild type HG: A shows the relative expression detection results of the rice OsPLATZ1 gene; B shows the measurement results of plant height; C shows the statistical results of the number of panicles per plant; D shows the statistical results of the number of grains per panicle; E shows the statistical results of the fruit set rate; F shows the statistical results of the measurement results of grain length; G shows the statistical results of grain width; H shows the statistical results of the length-to-width ratio; I shows the measurement results of 1000-grain weight; and J shows the statistical results of the yield per plant.

[0015] Figure 5 Technical principles for simplifying the construction of CRISPR / Cas9 transformation vectors. DETAILED DESCRIPTION

[0016] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments. The specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0017] The conventional indica rice variety used in the following examples is Huaguang (HG), developed by Hubei Seed Group Co., Ltd. and South China Agricultural University using "Huang Huazhan" as the recipient parent and "LG1" as the donor parent through hybridization, backcrossing, and marker-assisted selection. Huaguang is a high-quality new long-grain variety (length-to-width ratio = 4.0) with a moderate plant shape, strong tillering ability, vigorous growth, good quality, appearance, and excellent taste. Hereinafter, it is referred to as wild-type HG. All other reagents and materials used were commercially available unless otherwise noted.

[0018] 1. Design of editing targets

[0019] The CRISPR / Cas genome editing online tool package "CRISPR-GE" (http: / / skl.scau.edu.cn / ) was used to select four target sites T1, T2, T3, and T4 in the upstream portion of the start codon of the rice OsPLATZ1 gene using the subroutine targetDesign. The sequence of the upstream portion of the start codon of the rice OsPLATZ1 gene is:

[0020] aaatgattta tattctctca cgagtcgtga catgaatcgc aggtggcaat aacctcctcc

[0021] cttggcaaag cgaaacaacc cttcgcagaa agcaccccat aacgctgttattctaatcct

[0022] gcccgactgc acacaaagtt gtgagggaca aaaacggtca cgaaaatttc cgctcggcct

[0023] agcattgttt ccgtacaaac ggcactacaa aattccattt tctttattagt actttttaaa

[0024] ttagcaaaga atcaatttgc agagaccgat cattttccat gggagcaagg ataattcaga

[0025] aacacccctc aagttggttg gatattgtcg agaaggtccc cgacacttgg accgtgacgc

[0026] ccaattggtc ctttgaccgc cgaaccctat ggtgtccccttgacgccatt gccccacacc

[0027] acaccaagct cctcctcctt ctccttcacc ttctcccgct ctatatatac cctgccatgg

[0028] cttcctccattgctatccac cactaatccc tcccaattct cctctcctcg cctctccaaa

[0029] ctcgcatcgatctttaattt ctgttctcac ctgtacatac atacatacgc acgcacgtac

[0030] atacactcaa tcagagagag attgttggta gctaggtagc tgtggccaag aaagtgagag

[0031] aattgggagg aggattggag gaagacgaag gggttg (as shown in SEQ ID NO.1); sequence of target T1 (SEQ ID NO.2): gtggcaataacctcctcccttgg; sequence of target T2 (SEQ ID NO.3): cttggaccgtgacgcccaattgg; sequence of target T3 (SEQ ID NO.4): ccaaactcgcatcgatctttaat; sequence of target T4 (SEQ ID NO.5): aaagtgagagaattgggaggagg.

[0032] Schematic diagram of rice OsPLATZ1 gene structure, promoter and regulatory region sequence, and CRISPR / Cas9 target design is shown in the figure. Figure 1 shown.

[0033] 2. Construction of CRISPR / Cas9 genome editing vector

[0034] like Figure 5 As shown, the specific steps for constructing the genome editing vector of this embodiment are:

[0035] 1) Primer design for constructing sgRNA expression cassette

[0036] The CRISPR / Cas genome editing online tool software package "CRISPR-GE" (http: / / skl.scau.edu.cn / ) was used, and the primerDesign-V branch program in the subroutine primerDesign was used to construct primers OsU6aT1 / gRT1 to OsU6aT4 / gRT4 (sequences are shown in SEQ ID NO.6 to SEQ ID NO.13, respectively) for the sgRNA expression cassettes designed for the four selected targets T1, T2, T3, and T4, see Table 1.

[0037] Table 1 Primers and their sequences used to construct sgRNA expression cassettes

[0038]

[0039] 2) Overlapping PCR splicing of different sgRNA expression cassettes

[0040] Through two rounds of PCR, an sgRNA expression cassette with Bsa I restriction sites on both sides was obtained. The specific steps are as follows:

[0041] (1) Step 1: First-round PCR amplification. The primers OsU6aT1 / gRT1 to OsU6aT4 / gRT4 were used to construct the sgRNA expression cassette shown in Table 1. The target sequence was introduced downstream of the small RNA promoter OsU6a / OsU6b and upstream of the sgRNA sequence, respectively.

[0042] The primers for the first round of PCR were UF / gRNA-R. According to the following PCR system and PCR procedure, the UF primers shown in Table 2 (sequence shown in SEQ ID NO. 14) were paired with primers OsU6aT1 / gRT1 to OsU6aT4 / gRT4, respectively. The plant gene editing vector pYLsgRNA-OsU6a / U6b / U3 (published in Molecular Plant in August 2015, entitled "A convenient and efficient CRISPR / Cas9 multi-gene editing system for monocotyledons and dicotyledons") preserved in our laboratory was used as a template to PCR amplify the promoter sequences containing the target sites. The gRNA-R primers shown in Table 2 (sequence shown in SEQ ID NO. 15) were paired with primers gRT1 to gRT4, respectively, to PCR amplify the sgRNA sequences containing the target sites.

[0043] Table 2 Primers UF / gRNA-R and their sequences for the first round of PCR

[0044]

[0045] The reaction procedure was as follows: 95°C, 5 min; 95°C, 10 s, 58°C, 15 s, 68°C, 20 s; 25-28 cycles; 68°C, 2 min; the reaction system is shown in Table 3.

[0046] Table 3 First round PCR reaction system

[0047]

[0048]

[0049] (2) Second round of PCR: splicing the RNA promoter OsU6a / OsU6b driven by the small RNA promoter OsU6a / OsU6b, and introducing Bsa I restriction sites on both sides of the PCR product.

[0050] According to the following PCR system and PCR procedure, dilute the previous round of PCR products and mix equal amounts of the two PCR products (approximately 10 ng of each target DNA fragment) as the template for the second round of PCR. Using the specific primers PpS-R / PpS-2 (sequences shown in SEQ ID NO. 16 to SEQ ID NO. 17, respectively) and PpS-2R / PpS-L (sequences shown in SEQ ID NO. 18 to SEQ ID NO. 19, respectively) in Table 4, combined with the Overlapping PCR method, amplify the target gRNA expression cassettes in the first and second positions of the spliced ​​arrangement, respectively. This directly inserts the target sequence into the sgRNA expression cassette to obtain an expression cassette containing all four sgRNAs.

[0051] Table 4 Primers and sequences for the second round of PCR

[0052]

[0053] The reaction procedure was: 95°C, 5 min; 95°C, 10 s, 58°C, 15 s, 68°C, 20 s; 25 to 28 cycles; 68°C, 2 min; the reaction system was shown in Table 5.

[0054] Table 5 Second round PCR reaction system

[0055]

[0056]

[0057] After the reaction, 5 μL of PCR product was electrophoresed to check if the band size was as expected. Finally, the integrated sgRNA expression cassette fragments were recovered by gel excision, the concentration was determined, and the fragments were stored at -20°C.

[0058] 3) Recombination of expression cassette and binary vector

[0059] In the third step, leveraging the recognition element of the restriction endonuclease Bsa I-HF, the recombinant sgRNA expression cassette fragments were assembled into the binary vector pYLCRISPR / Cas9Pubi-H using the cut-and-ligation method. The reaction system is shown in Table 6. The cut-and-ligation reaction procedure was: 37°C for 5 minutes, 10°C for 5 minutes, 20°C for 5 minutes, 10-15 cycles, and 37°C for 5 minutes.

[0060] Table 6 Recombination assembly of sgRNA expression cassette and binary vector

[0061]

[0062] 3. Electroporation of E. coli and screening of positive clones

[0063] A portion of the cleavage-and-ligation product was dialyzed in 1 / 3 TE dialysate at 4°C for 20 minutes. An appropriate amount of the dialyzed product was electroporated into competent E. coli DH10B. After activation and incubation for 1 hour, approximately 100 μL of the bacterial solution was plated onto a Kan-resistant LB solid culture dish and incubated inverted at 37°C overnight. Colony PCR was then performed using primers SP-L1 / SP-R1 shown in Table 4 to screen for positive clones. Plasmids were then extracted and verified by sequencing to construct the correct OsPLATZ1 gene-editing plasmid.

[0064] 4. Preparation and transformation of Agrobacterium competent cells

[0065] A small amount of EHA10B Agrobacterium competent cell suspension stored at -80°C was streaked onto Chl-resistant SOB solid medium and incubated at 28°C for 2 days. A single colony was picked and inoculated into 2 mL SOB liquid medium and incubated (200 rpm, 28°C) for about 12 hours; then the colony was transferred to a 2 L triangular flask containing 400 mL SOB liquid medium and incubated until the OD 550 The concentration is approximately 0.7-0.8. Then, centrifuge at 2800g for 10 minutes at 4°C to collect the cells. Wash and resuspend the cells in 10% glycerol. Repeat this process two to three times. Finally, aliquot 20 μL of EHA10B competent cells into tubes and store at -80°C until ready for use.

[0066] The OsPLATZ1 gene-editing plasmid was introduced into EHA10B competent Agrobacterium cells using a 1:20 volume ratio and electroporation. The electroporation parameters were 1600V, 200Ω, 25μF, and a 1mm pore size in the click cup. After electroporation, the bacterial suspension was transferred to a 2mL centrifuge tube containing 1mL of SOB and incubated at 200rpm at 28°C for 2–3 hours. Then, 20μL of the bacterial suspension was plated onto Chl / Kan dual-antibody YM medium (containing 25mg / mL Kan and 34mg / mL Chl) and incubated inverted for 2–3 days. Positive clones were screened by colony PCR. Plasmids were extracted from a portion of the bacterial cells, and some were stored at -80°C for future use.

[0067] Take 1 μL of the extracted plasmid and transform it into E. coli DH10B by electroporation using a similar method as described above. After incubation at 200 rpm and 37°C for 1 hour, spread 20 μL of the bacterial solution onto a Kan-resistant solid LB culture dish and incubate inverted at 37°C overnight. Pick five single colonies and shake them to extract the plasmid.

[0068] Take 1 μg of the plasmid before and after Agrobacterium transformation, digest it with restriction endonuclease Asc I at 37℃ for 2h, and perform electrophoresis on 0.8% agarose gel to compare the changes in band size between the two. Confirm the stability of the target plasmid in the Agrobacterium transformant, and use the correct and stable Agrobacterium transformant for rice callus transformation. Store the strain at -80℃ for future use.

[0069] 5. Induction and subculture of rice callus

[0070] Select plump, pest-free, mature rice seeds, remove the shells, soak them in 75% ethanol for 1 min, rinse them three times with sterile ddH2O, soak them in 1.5% NaClO (shake and mix several times during the process) for 20 min, rinse them three times with sterile ddH2O, discard the supernatant, and place the sterilized seeds in a petri dish containing sterilized filter paper to dry.

[0071] Inoculate the sterilized, air-dried seeds onto callus induction medium NB and culture in the dark at 25°C for 10-14 days. Select well-growing calli for subculture every 2-3 weeks.

[0072] 6. Agrobacterium activation

[0073] A small amount of Agrobacterium transformant culture liquid was picked from -80℃, streaked on Kan-resistant YM solid medium, and cultured in the dark at 28℃ for 2 days. Then a single colony was picked and spread on a YM culture dish with the same resistance, and cultured in the dark at 28℃ for 2 days. An appropriate amount of Agrobacterium cells was suspended in the infection liquid medium containing 150μmol / L acetosyringone until the OD 600 The concentration is about 0.1, and then it can be used for callus infection after being cultured at 28℃ and 200rpm for 0.5h.

[0074] 7. Agrobacterium infection and co-cultivation of callus tissue

[0075] Select bright, light yellow, dense, and vigorously growing granular embryogenic callus for Agrobacterium transformation. First, place the selected callus on sterile filter paper and air dry until the surface is dry. Then, mix the dry callus with the activated cultured Agrobacterium solution (OD 600 Mix with a volume of approximately 0.1 mL of the culture medium until the callus tissue is submerged. Infect and incubate for 20 minutes, shaking several times. Remove the callus tissue, remove excess Agrobacterium culture medium with sterile filter paper, and air-dry on a clean bench until the surface is dry. Finally, inoculate the callus onto a co-culture medium with one or two sheets of sterile filter paper on the surface and incubate in the dark at 25°C for 2-3 days.

[0076] 8. Screening, pre-differentiation and differentiation of resistant callus

[0077] The callus tissue after co-cultivation was taken out and placed in a sterile culture dish containing 3 layers of sterile filter paper to dry for 1-2 days, then inoculated onto a screening medium containing 50 mg / mL hygromycin, cultured in the dark at 25°C for 2-3 weeks, and screened twice.

[0078] Select the resistant callus with good growth status and inoculate it onto the pre-differentiation medium, and culture it under light at 25℃ for 2 to 3 weeks; then inoculate the resistant callus with good growth status and containing green spots onto the differentiation medium to differentiate into seedlings.

[0079] 9. Rooting and strengthening of transformed seedlings and outdoor transplanting and cultivation

[0080] After the resistant callus tissue differentiates into seedlings, transfer them to rooting medium and continue to culture them at 25℃ light until the seedlings have a relatively sound root system and are 12 to 16 cm tall. Take out the seedlings, wash off the culture medium, and harden them outdoors in tap water for 2 to 3 days before transplanting them into outdoor soil.

[0081] 10. Transgenic Detection and Target Editing Analysis of Transformed Seedlings

[0082] Genomic DNA from transformed seedlings was extracted and PCR amplified to detect the exogenous gene fragments Cas9 and the hygromycin gene Hpt, both of which are not present in the rice genome. The total reaction volume was 15 μL, and the primers used were listed in Table 7. Confirmed transgenic plants were then sequenced using OsPLATZ1-specific primers (as shown in Table 7) to amplify fragments containing the target sequence to confirm target sequence editing. Sequence editing was decoded using DSDecode (http: / / skl.scau.edu.cn / ), a DNA sequencing peak decoding software developed in our laboratory.

[0083] Homozygous mutant plants in the T1 and T2 generation transformed rice plants were analyzed using the same method.

[0084] Table 7 Primers used for PCR amplification and sequencing analysis of gene editing targets

[0085]

[0086] The target sequence variations of the promoter regulatory region and 5'UTR regulatory region of rice OsPLATZ1 gene were as follows: Figure 3 As shown in the figure, it can be seen that in the T2 generation homozygous mutant plants of gene editing, editing of the four target sites (T1, T2, T3, and T4) in the promoter regulatory region and 5'UTR regulatory region of the OsPLATZ1 gene can effectively produce various types of deletion and insertion mutants, thereby obtaining the mutant line CRR-1. The mutant line CRR-1 has different types of mutations at the four target sites T1, T2, T3, and T4, as shown in the following figure. Figure 1 shown.

[0087] Depend on Figure 1 It can be seen that the front regulatory region of CRR-1 has a 2bp deletion at -491 to -492 (T1), a 4bp deletion at -189 to -192 (T2), a 1bp insertion at -10 (T3), and a 3bp deletion at +114 to +116 (T4).

[0088] Furthermore, to verify the expression level of the OsPLATZ1 gene in the young panicles of the rice mutant line, the expression level of the OsPLATZ1 endogenous gene in the seeds (10 days after pollination) of the homozygous rice mutant line (T2) and the wild-type transformed recipient indica rice (Huaguang) was detected by qRT-PCR. The specific steps were as follows:

[0089] Ten days after pollination, seeds of the homozygous rice mutant line (T2) and wild-type control were ground into powder under liquid nitrogen. Total RNA was then extracted using the Trizol method and reverse transcribed into cDNA using an MMV reverse transcription kit and oligoDT primers. UFM1-Conjugating Enzyme 1 (UFC1) / LOC_Os10g13800 was used as an internal reference gene. The expression of the OsPLATZ1 endogenous gene was detected using the primers F-PLATZ1-qRT / R-PLATZ1-qRT (sequences shown in SEQ ID NOs. 28 to 29, respectively) shown in Table 8, and the expression of the OsUFC1 gene was detected using the primers F-UFC1-qRT / R-UFC1-qRT (sequences shown in SEQ ID NOs. 30 to 31, respectively) shown in Table 8.

[0090] Table 8 Primers and their sequences used in qRT-PCR reaction

[0091]

[0092] Three technical replicates were set up for each sample. The relevant reactions used a dedicated PCR plate with a reaction volume of 20 μL. The relevant reaction systems are shown in Table 9.

[0093] Table 9 qRT-PCR reaction system

[0094]

[0095] Then, the cells were placed in a fluorescence quantitative PCR instrument and thermal cycled: 94°C for 30 seconds, followed by 94°C for 5 seconds and 60°C for 30 seconds, for a total of 40 cycles. Finally, a melting curve was set up: the temperature was increased from 60°C to 90°C, and the fluorescence signal was collected at every 0.5°C increase.

[0096] Analysis method: Using UFC1 as the internal reference gene, the relative expression of the target gene relative to UFC1 was analyzed. The data processing formula is: When the relative expression of the target gene in the mutant sample relative to the internal reference gene UFC1 is normalized, that is, relative to the wild-type control, the data processing formula is:

[0097] The results are as follows Figure 4 As shown in Figure 5A, the expression of the OsPLATZ1 gene was increased in the CRR-1 line compared with the wild-type HG.

[0098] In addition, this example also selects mutant plants with obvious editing effects from the obtained mutant plants and performs phenotypic statistics on the T3 generation plants, and selects wild-type HG of the same period as the control for statistical comparison of agronomic traits.

[0099] The results are as follows Figure 4 As shown in Figure 2, the plant type, ear type, and grain type of the CRR-1 strain were significantly changed compared to the wild type HG. Figure 4 B, for the whole plant, the plant height of the CRR-1 line decreased by 3.2% compared with the wild type HG; see Figure 4 C, the number of panicles per plant increased by 10.2% compared with the wild type HG; see Figure 4 D, the change of main spike grain number, compared with the wild type HG, CRR-1 line decreased by 9.7%; see Figure 4 E in Figure 1 shows that the seed setting rate of CRR-1 decreased by 5.9% compared with the wild type HG. Figure 4 In Figure 1, the thousand-grain weight of the CRR-1 strain increased by 9.8% compared to the wild type HG. Figure 4 In J, the single plant yield of the CRR-1 line was increased by 12.6% compared with the wild type HG.

[0100] See also Figure 4 In terms of grain type, the CRR-1 strain increased by 7.7% compared with the wild-type HG; see Figure 4 There is not much difference in the width of G in Figure 4 The H in the CRR-1 line showed a 4% increase in seed length-to-width ratio compared to the wild-type HG.

[0101] From the above, it can be seen that the grain length of the CRR-1 strain increased significantly, the grain width did not change, the grain weight increased significantly, the number of grains per ear decreased, and the fruit set rate did not change.

[0102] According to the Guangdong Silk Rice variety standard released in 2018: 1000-grain weight ≤ 21g, brown rice length-to-width ratio ≥ 3.5 (or 1000-grain weight ≤ 23g, brown rice length-to-width ratio ≥ 4), brown rice grain length ≥ 6.5mm, chalky grain rate ≤ 20%, chalkiness ≤ 3%, gel consistency ≥ 60mm, transparency ≤ level 2, amylose content 13%-19%, and aroma. Rice that meets these standards is designated "Guangdong Silk Rice." After editing OsPLATZ1, both the length-to-width ratio and 1000-grain weight meet the standards, with the CRR-1 strain exhibiting a significantly higher 1000-grain weight than the wild type. Breeding rice with different grain length-to-width ratios can meet diverse preferences for rice grain traits. Gene editing can alter both grain number and shape, allowing selection of plants that meet the Southern preference for Silk Rice. The present invention utilizes a variety of editing methods designed to enhance grain size while minimizing the effect on grain number, resulting in higher yields (longer seeds and increased grain number). The following two materials involving improvement of grain shape and appearance quality have breeding application value: one is that the number of grains does not change, but the change of grain shape meets the requirements; the other is that the number of grains increases and the seed size meets the requirements, which is the best.

[0103] The technical solution of the present invention is not limited to the above-mentioned specific embodiments. Any technical variations made according to the technical solution of the present invention fall within the protection scope of the present invention.

Claims

1. A targeted editing rice OsPLATZ1 The application of the gene in improving rice grain shape and yield is characterized in that: Using CRISPR / Cas9 genome editing technology to edit rice OsPLATZ1 The four target sites T1, T2, T3, and T4 upstream of the start codon of the gene were edited simultaneously to obtain a genome editing vector, which was then transformed into conventional indica rice to obtain a rice mutant line CRR-1 with improved grain number and grain shape. OsPLATZ1 The sequence of the upstream portion of the start codon of the gene is shown as SEQ ID NO.1, and the upstream portion of the start codon is a promoter regulatory region or a 5'UTR regulatory region; the sequences of the target sites T1 to T4 are shown as SEQ ID NO.2 to SEQ ID NO.5, respectively. The front regulatory region of the rice mutant line CRR-1 with improved grain number and grain shape has a 2 bp deletion at -491 to -492, i.e., T1; a 4 bp deletion at -189 to -192, i.e., T2; a base T is inserted at -10, i.e., T3; and a 3 bp deletion at +114 to +116, i.e., T4.

2. The targeted editing rice according to claim 1 OsPLATZ1 The application of the gene in improving rice grain shape and yield is characterized in that: The simultaneous editing of four target sites T1, T2, T3, and T4 includes: constructing an sgRNA expression cassette containing the four target sites T1, T2, T3, and T4.

3. The targeted editing rice according to claim 2 OsPLATZ1 The application of the gene in improving rice grain shape and yield is characterized in that: The forward and reverse primer sequences for constructing the sgRNA expression cassette containing target T1 are shown in SEQ ID NO.6 and SEQ ID NO.7; the forward and reverse primer sequences for constructing the sgRNA expression cassette containing target T2 are shown in SEQ ID NO.8 and SEQ ID NO.9; the forward and reverse primer sequences for constructing the sgRNA expression cassette containing target T3 are shown in SEQ ID NO.10 and SEQ ID NO.11; the forward and reverse primer sequences for constructing the sgRNA expression cassette containing target T4 are shown in SEQ ID NO.12 and SEQ ID NO.13.

Images