Application of inhaled bergamot lactone nanoliposomes in the treatment of inflammatory lung injury
By preparing inhalable bergamot lactone nanoliposomes and using DPPC, cholesterol and mPEG2000-DSPE as carriers, lung-targeted drug delivery was achieved, inhibiting M1 macrophage polarization and promoting M2 macrophage polarization, solving the problem of insufficient efficacy in existing treatment methods and significantly improving the treatment effect of acute lung injury.
Patent Information
- Application Number
- CN202411160763.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-22
- Publication Date
- 2025-09-30
- Estimated Expiration
- 2044-08-22
AI Technical Summary
The efficacy of existing bergamot lactones in treating acute lung injury has not been significantly improved, and traditional drug delivery methods make it difficult to achieve lung targeting and effective anti-inflammatory effects.
Inhalable bergamot lactone nanoliposomes are prepared using DPPC, cholesterol and mPEG2000-DSPE as carriers. The nanoliposomes are lung-targeted, inhibit M1 macrophage polarization and promote M2 macrophage polarization, and are administered by aerosol inhalation.
It significantly reduces the expression of inflammatory factors IL-6, IL-1β and TNF-α in lung tissue, inhibits the polarization of M1 macrophages, promotes the polarization of M2 macrophages, and improves the effect of treating acute lung injury.
Smart Images

Figure CN118924708B_ABST
Abstract
Description
Technical Field
[0001] The invention relates to application of inhaled bergamot lactone nanoliposomes in treating inflammatory lung injury, and relates to the technical field of medicine. Background Art
[0002] Acute lung injury (ALI) refers to a disease characterized by pulmonary diffusion dysfunction caused by a variety of direct or indirect factors, including trauma, infection, inhalation of noxious gases, and shock. The mortality rate is as high as 30% to 50%. The pathogenesis of ALI is complex, and the pathological process primarily consists of three phases: the acute exudative phase, the lung tissue repair and remodeling phase, and the chronic phase. During the acute exudative phase, pulmonary vascular endothelial cells and type I pneumocytes are damaged, leading to the diffuse infiltration of numerous inflammatory cells within the lung tissue, excessive release of inflammatory factors, and alveolar edema. During the lung tissue repair and remodeling phase, pulmonary interstitial fibroblasts proliferate, abnormally repairing and remodeling the lung tissue. In the chronic phase, excessive lung tissue repair and remodeling can lead to pulmonary fibrosis. Currently, drugs used to treat ALI include glucocorticoids, anti-oxidative stress drugs, and nonsteroidal anti-inflammatory drugs. Different drugs can treat ALI patients through different mechanisms of action.
[0003] Bergamot lactone, also known as 5-methoxypsoralen, belongs to the coumarin class of compounds and is one of the active ingredients of plants such as bergamot, angelica, and angelica. Its molecular formula is C 12 H8O4. Recent research has confirmed the anti-inflammatory and anti-cancer effects of bergamot lactone. Chinese Patent CN116687915A discloses the use of bergamot lactone in the treatment of lung injury. When used to treat ALI, bergamot lactone exhibits efficacy comparable to that of the active-acting drug pirfenidone, demonstrating its promising application prospects in the treatment of ALI. However, the optimal efficacy of bergamot lactone in this prior art is only close to that of the active-acting drug, without significantly improving upon it. Summary of the Invention
[0004] According to one aspect of the present invention, an inhalable bergamot lactone nanoliposome is provided, comprising a raw drug and a carrier, wherein the raw drug is bergamot lactone, and the carrier is DPPC (dipalmitoylphosphatidylcholine), cholesterol, and mPEG2000-DSPE (polyethylene glycol monomethyl ether-2000-dioctadecylphosphatidylethanolamine, CAS147867-65-0), and the molar ratio of DPPC, cholesterol, and mPEG2000-DSPE in the carrier is (70-85): (15-25):3.
[0005] The DPPC in the inhalable bergamot lactone nanoliposomes provided by the present invention is a surfactant component in lung tissue, thus possessing lung-targeting properties, which can impart lung-targeting properties to the bergamot lactone nanoliposomes. The applicant surprisingly discovered that when bergamot lactone is formulated into a nanoliposome formulation and then administered, it can inhibit the polarization of M1 macrophages in lung tissue while promoting the polarization of M2 macrophages in lung tissue, demonstrating a more significant effect than free bergamot lactone monomer in the treatment of ALI. It should be noted that the molar ratio of the components in the liposome carrier affects the liposome's encapsulation efficiency and drug loading capacity. Excessive amounts of DPPC and cholesterol, or too low a level of mPEG2000-DSPE in the carrier, can easily lead to low drug concentrations within the liposomes, necessitating the addition of excessive liposomes to achieve a specific therapeutic effect during cell intervention. However, excessive amounts of liposomes can easily affect cell growth and lead to cell contamination. Furthermore, the resulting liposomes have no significant in vitro anti-inflammatory effects compared to monomeric bergamot lactone.
[0006] In some embodiments, the molar ratio of bergapten to DPPC in the inhalable bergapten nanoliposomes is 1:(1.5-4.5).
[0007] In some embodiments, the drug concentration of bergamot lactone in the inhalable bergamot lactone nanoliposomes is 0.5 to 1.5 mmol / L.
[0008] In some embodiments, the drug loading amount of bergamot lactone in the inhalable bergamot lactone nanoliposomes is 0.45% to 0.60%.
[0009] In some embodiments, the encapsulation efficiency of bergapten lactone in the inhalable bergapten lactone nanoliposomes is 5% to 8%.
[0010] In some embodiments, the zeta potential of the inhalable bergapten nanoliposomes is -6 to -8 mV.
[0011] A higher absolute value of the zeta potential indicates greater stability of the nanomaterial. The nanoliposomes in the present invention have an absolute value of 6 to 8, indicating good stability. Furthermore, the nanoliposomes have a negative zeta potential, suggesting that they may enhance diffusion efficiency in respiratory mucus by reducing interactions with negatively charged respiratory mucins.
[0012] In some embodiments, the inhalable bergamot lactone nanoliposomes are spherical with an average diameter of 105 to 120 nm.
[0013] According to another aspect of the present invention, a method for preparing inhalable bergamot lactone nanoliposomes is provided, comprising the following steps:
[0014] S1. DPPC, cholesterol, mPEG2000-DSPE, and bergamot lactone were dissolved in a solvent, and the solvent was removed to form a thin film;
[0015] S2. Add an aqueous medium to the film formed in step S1, and fully hydrate and remove the film at 50-70° C. to obtain inhalable bergamot lactone nanoliposomes.
[0016] The temperature at which the film is hydrated in step S2 has a significant impact on the preparation of liposomes in the present invention. Excessively high temperatures can affect monomer activity, while low temperatures can lead to incomplete hydration and also affect the zeta potential of the resulting liposomes. Hydration and shedding of the film at 50-70°C results in fully hydrated liposomes with an appropriate zeta potential, while maintaining excellent monomer activity within the liposomes.
[0017] In some embodiments, the solvent in step S1 is chloroform.
[0018] In some embodiments, in step S1, DPPC, cholesterol, and mPEG2000-DSPE are first dissolved in chloroform, and then bergapten lactone is dissolved in chloroform and then added to the reaction system.
[0019] In some embodiments, step S1 removes the solvent by rotary evaporation at 230 mbar.
[0020] In some embodiments, the aqueous medium in step S2 is PBS buffer.
[0021] In some embodiments, after the aqueous medium is added in step S2, the film is fully hydrated by magnetic stirring, and the speed of the magnetic stirrer is 300 rpm.
[0022] If the magnetic stirring speed is too high, foam will be easily generated, and the system will produce multiple phase interfaces, resulting in uneven properties and affecting the various properties of the liposomes; if the speed is too low, hydration will be insufficient.
[0023] In some embodiments, when fully hydrating the film in step S2, the reaction system can be manually rotated to allow the aqueous medium to fully contact the film, thereby assisting in hydration of the film.
[0024] In some embodiments, the time for fully hydrating the film in step S2 is 30 minutes.
[0025] In some embodiments, after the hydration in step S2 is completed, the steps of ultrasonic dispersion, filtration, ultrafiltration and constant volume are further included.
[0026] In some embodiments, the ultrasonic dispersion step is as follows: placing the suspension obtained by fully hydrating and shedding the thin film on ice for ultrasonication, with an ultrasonic power of 20%, and an ultrasonic method of pausing for 15 seconds after each 15 seconds of ultrasonication, and ending the ultrasonication after 30 minutes to obtain a suspension after ultrasonic dispersion.
[0027] In some embodiments, the filtration step is as follows: filtering and collecting the suspension after ultrasonic dispersion through a 0.22 μm filter, repeating the process three times to obtain a filtrate.
[0028] In some embodiments, the ultrafiltration step comprises subjecting the filtrate to centrifugal ultrafiltration at 3000 rpm for 1 hour to obtain purified bergapten-containing nanoliposomes. This step is intended to remove excess nanoliposomes and free bergapten-containing monomers.
[0029] In some embodiments, the step of adjusting the volume is: adjusting the volume of the purified bergamot lactone nanoliposomes to 3 mL using PBS buffer to obtain an inhalable bergamot lactone nanoliposome solution for later use.
[0030] According to another aspect of the present invention, there is provided a use of inhalable bergamot lactone nanoliposomes in a drug for treating acute lung injury.
[0031] In some embodiments, the drug for treating acute lung injury is administered by aerosol inhalation.
[0032] Administration by aerosol inhalation allows nanoliposomes to better target the lungs and reach the lesions directly. Compared with oral administration and other methods of administration, it has better lung targeting and better biological distribution.
[0033] According to another aspect of the present invention, there is provided a use of inhaled bergamot lactone nanoliposomes in a drug for inhibiting the expression of M1 macrophages.
[0034] According to another aspect of the present invention, there is provided a use of inhaled bergamot lactone nanoliposomes in a drug for promoting the expression of M2 macrophages.
[0035] Compared with the prior art, the present invention has the following beneficial effects:
[0036] The inhalable bergamot lactone nanoliposomes provided by the present invention have good biosafety and can target the lungs through aerosol inhalation, reducing the expression levels of inflammatory factors IL-6, IL-1β and TNF-α in lung tissue. At the same time, they can inhibit the polarization of M1 macrophages in lung tissue and promote the polarization of M2 macrophages in lung tissue. They have a more significant effect than free bergamot lactone monomers in the treatment of ALI. BRIEF DESCRIPTION OF THE DRAWINGS
[0037] Figure 1 Schematic diagram showing a comparison of the particle sizes of the inhalable bergamot lactone nanoliposomes in Example 1 of the present invention and the nanoliposomes in Comparative Example 1;
[0038] Figure 2 Transmission electron micrographs of the inhalable bergamot lactone nanoliposomes in Example 1 of the present invention and the nanoliposomes in Comparative Example 1;
[0039] Figure 3 Schematic diagram showing the comparison of the zeta potential of the inhalable bergamot lactone nanoliposomes in Example 1 of the present invention and the nanoliposomes in Comparative Example 1;
[0040] Figure 4 The effects of different groups of the present invention on the HUVEC cytoskeleton;
[0041] Figure 5 Effects of different concentrations of the inhalable bergamot lactone nanoliposomes in Example 1 of the present invention, the nanoliposomes in Comparative Example 1, and free bergamot lactone monomers on RAW264.7 cell viability;
[0042] Figure 6 Effects of different concentrations of the inhalable bergamot lactone nanoliposomes in Example 1 of the present invention, the nanoliposomes in Comparative Example 1, and free bergamot lactone monomers on HUVEC cell viability;
[0043] Figure 7 Schematic diagram of the compatibility of different concentrations of inhalable bergamot lactone nanoliposomes and free bergamot lactone monomers with blood in Example 1 of the present invention;
[0044] Figure 8 The effects of different groups of the present invention on the mRNA of pro-inflammatory factors IL-6, IL-1β and TNF-α in RAW264.7 cells treated with LPS;
[0045] Figure 9 The effect of different groups of the present invention on the fluorescence intensity and distribution of macrophage polarization indicators CD86 and CD163;
[0046] Figure 10 The effect of different groups of the present invention on the protein expression of macrophage polarization indicators CD86 and CD163;
[0047] Figure 11 This is a statistical diagram of the protein expression results of macrophage polarization indicators CD86 and CD163 in different groups of the present invention;
[0048] Figure 12 The effect of different groups of the present invention on the mRNA of macrophage polarization indicators CD86, iNOS and CD206;
[0049] Figure 13 The effects of different groups of the present invention on the lung index of ALI mice induced by LPS;
[0050] Figure 14 The effect of different groups of the present invention on the total cell number in the alveolar lavage fluid of LPS-induced ALI mice;
[0051] Figure 15 The effect of different groups of the present invention on the total protein concentration in the alveolar lavage fluid of LPS-induced ALI mice;
[0052] Figure 16 The effects of different groups of the present invention on the pathological damage of lung tissue in LPS-induced ALI mice;
[0053] Figure 17 The effects of different groups of the present invention on the mRNA expression of pro-inflammatory factors IL6, IL1-β and TNFα in the lung tissue of mice with ALI model induced by LPS;
[0054] Figure 18 The effects of different groups of the present invention on the fluorescence expression intensity and distribution of macrophage polarization indicators CD86, iNOS, CD163 and CD206 in the lung tissue of LPS-induced ALI model mice;
[0055] Figure 19 The effects of different groups of the present invention on the protein expression of macrophage polarization indicators CD86, CD163 and CD206 in the lung tissue of LPS-induced ALI model mice;
[0056] Figure 20 This is a statistical diagram of the protein expression results of macrophage polarization indicators CD86, iNOS, CD163 and CD206 in the lung tissue of LPS-induced ALI model mice in different groups of the present invention.
[0057] Figure 21 This is the effect of different groups of the present invention on the mRNA expression of macrophage polarization indicators CD86, iNOS, CD163 and CD206 in the lung tissue of ALI model mice induced by LPS. DETAILED DESCRIPTION
[0058] The present invention will be described in further detail below with reference to the examples and accompanying drawings, but the present invention is not limited thereto. The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples were purchased from the market unless otherwise specified.
[0059] Example 1
[0060] An inhalable bergamot lactone nanoliposome, denoted as Ber-lipo, comprises a raw drug and a carrier, wherein the raw drug is bergamot lactone, the carrier is DPPC, cholesterol and mPEG2000-DSPE, the molar ratio of DPPC, cholesterol and mPEG2000-DSPE in the carrier is 77:20:3, and the molar ratio of bergamot lactone to DPPC in the inhalable bergamot lactone nanoliposome is 1:3.13;
[0061] The drug loading amount of bergamot lactone in the inhaled bergamot lactone nanoliposomes is 0.52%, the drug concentration is 1 mmol / L, the encapsulation efficiency is 6.5%, the nanoliposomes are uniform spherical, the average diameter is 111.2 nm, and the Zeta potential is -7 mV.
[0062] The preparation method of inhalable bergamot lactone nanoliposomes in this embodiment comprises the following steps:
[0063] S1. 106.2 mg of DPPC, 14.5 mg of cholesterol, and 4.8 mg of mPEG2000-DSPE were dissolved in 5 mL of chloroform. 10 mg of bergamot lactone was then dissolved in chloroform and added to the reaction system. The solvent was removed by rotary evaporation at 230 mbar to form a thin film.
[0064] S2. PBS buffer was added to the film formed in step S1, and magnetic stirring was performed at 60°C for 30 minutes at a speed of 300 rpm to fully hydrate the film; during this period, the aqueous medium was fully contacted with the film by manually rotating the reaction system to assist in hydration of the film; after the film was fully hydrated and fell off to obtain a suspension, it was placed on ice for ultrasonication at an ultrasonic power of 20%, and the ultrasonic method was to pause for 15 seconds after each 15 seconds of ultrasonication, and the ultrasonication was terminated after 30 minutes. The suspension after ultrasonic dispersion was collected by filtration using a 0.22 μm filter, and the filtrate obtained by filtration was repeated three times to obtain a filtrate. The filtrate obtained by filtration was subjected to centrifugal ultrafiltration at a speed of 3000 rpm for 1 hour. After the centrifugation, purified bergamot lactone nanoliposomes were obtained, and the purified bergamot lactone nanoliposomes were fixed to 3 mL using PBS buffer to obtain an inhalable bergamot lactone nanoliposome solution for standby use.
[0065] Comparative Example 1
[0066] One type of nanoliposome, designated as Lipo, includes only a carrier, wherein the carrier is DPPC, cholesterol, and mPEG2000-DSPE, and the molar ratio of DPPC, cholesterol, and mPEG2000-DSPE in the carrier is 77:20:3;
[0067] The nanoliposomes were uniform spherical with an average diameter of 116.1 nm and a zeta potential of -9 mV.
[0068] The preparation method of nanoliposomes in this comparative example is carried out according to Example 1, wherein the only difference from Example 1 is:
[0069] In step S1, bergamot lactone is not added.
[0070] The materials obtained in Example 1 and Comparative Example 1 were characterized, and the experimental results are as follows: Figures 1 to 3 As shown, the size of the nanoliposomes obtained in Comparative Example 1 is in the range of 30-470 nm, and the size of the inhalable bergamot lactone nanoliposomes obtained in Example 1 is in the range of 40-340 nm. The average sizes of the liposomes obtained in Comparative Example 1 and Example 1 are approximately 116.1 nm and 111.2 nm, respectively. Zeta potential shows that the nanoliposomes Lipo obtained in Comparative Example 1 and the inhalable bergamot lactone nanoliposomes Ber-lipo obtained in Example 1 both have a negative charge, with average potentials of -9 mV and -7 mV, respectively. Transmission electron microscopy observations show that the nanoliposomes Lipo obtained in Comparative Example 1 and the inhalable bergamot lactone nanoliposomes Ber-lipo obtained in Example 1 both have a uniform spherical morphology with a diameter of approximately 115 nm, consistent with the results measured by DLS.
[0071] Comparative Example 2
[0072] A bergamot lactone nanoliposome, designated Ber-lipo-2, comprises a raw drug and a carrier, wherein the raw drug is bergamot lactone, the carrier is DPPC, cholesterol, and mPEG2000-DSPE, the molar ratio of DPPC, cholesterol, and mPEG2000-DSPE in the carrier is 29:14:1, and the molar ratio of bergamot lactone to DPPC in the bergamot lactone nanoliposome is 1:1.2;
[0073] The drug concentration of bergamot lactone in bergamot lactone nanoliposomes is 0.2mmol / L.
[0074] The preparation method of nanoliposomes in this comparative example is carried out according to Example 1, wherein the difference from Example 1 is:
[0075] Step S1: Add 39.7 mg of DPPC, 10.1 mg of cholesterol, 1.6 mg of mPEG2000-DSPE, and 10 mg of bergapten.
[0076] In this comparative example, the drug concentration of bergamot lactone in the liposomes was too low, and a large amount of liposomes had to be added when intervening in cells, which affected cell growth.
[0077] Experimental study on the pharmacological effects of inhaled bergamot lactone nanoliposomes
[0078] Next, cell and animal experiments were conducted using the inhalable bergapten nanoliposomes Ber-lipo prepared in Example 1, the nanoliposomes Lipo in Comparative Example 1, and the free bergapten monomer Bergapten to explore their pharmacological effects.
[0079] 1. Cell experiments and related index determination
[0080] 1. Effect of Ber-lipo on the cytoskeleton of HUVECs
[0081] Cytoskeleton staining was performed according to the instructions of the FITC Phalloidin staining kit. HUVECs were seeded in 0.17mm glass-bottom culture dishes. When the cells grew to a density of 60%-70% in a 37°C incubator, DMEM complete medium containing 40μmol / L Bergapten, 40μmol / L Ber-lipo and Lipo (equal volume to Ber-lipo) was added, and PBS equal in volume to Ber-lipo was added to the culture medium of the Control group. After intervention with drug-containing culture medium for 12h and 24h, the drug-containing culture medium was removed and fixed with 4% paraformaldehyde for 10min; then 0.5% Triton X-100 and BSA were added in sequence to permeabilize and block the cells. Finally, the cytoskeleton and cell nucleus were stained for 30min respectively, and the images were collected using a laser scanning confocal microscope after washing three times with PBS. Figure 4 .
[0082] Figure 4 The results showed that compared with the Control group, the cell morphology of the Lipo, Bergapten and Ber-lipo groups was normal, which indicates that the Ber-lipo of the present invention has no effect on cell morphology and has good biosafety.
[0083] 2. Effect of Ber-lipo on RAW264.7 cell viability
[0084] The toxicity of drugs to RAW264.7 cells was determined using Cell Counting Kit-8 (CCK-8). RAW264.7 cells were plated at 1×10 4Cells were seeded at a density of 100 μL / well in a 96-well culture plate and cultured for 24 hours. DMEM complete medium (Gibico, C11995500BT; 10% ExCell serum and 1% Solebroxan double-stranded antibody were added before use) was used as the solvent to prepare a concentration gradient of 2.5 μM, 5 μM, 10 μM, 20 μM, and 40 μM of Bergapten, Ber-lipo, and Lipo (Lipo and Ber-lipo were equal in volume). A control group was treated with an equal volume of PBS as Ber-lipo. After 24 hours of treatment, the supernatant was discarded, and 10 μL of CCK-8 solution and 100 μL of complete medium were added to each well. The cells were incubated at 37°C in the dark for 1-2 hours, and the absorbance of each well was measured at 450 nm.
[0085] Figure 5 The results showed that within the concentration range of 2.5-40 μM, the Ber-lipo of the present invention had almost no effect on cell viability, and at 40 μM, the cell viability was better than that of the free monomer group.
[0086] 3. Effects of different concentrations of Ber-lipo on HUVEC cell viability
[0087] CCK-8 was used to determine the toxicity of drugs to HUVEC cells. HUVEC cells were cultured at 5×10 3 Cells were seeded at a density of 100 μg / well in a 96-well culture plate and cultured for 24 hours. Bergapten, Ber-lipo, and Lipo were prepared in complete culture medium at concentrations of 2.5 μM, 5 μM, 10 μM, 20 μM, 40 μM, and 80 μM. For the control group, PBS was used instead, equal to the volume of Ber-lipo, and the cells were treated with the prepared culture medium. After 24 hours of treatment, the supernatant was discarded, and 10 μL of CCK-8 solution and 100 μL of complete culture medium were added to each well. The cells were incubated at 37°C in the dark for 1-2 hours, and the absorbance of each well was measured at 450 nm.
[0088] Figure 6 The results showed that within the concentration range of 2.5-40 μM, Ber-lipo of the present invention had little effect on cell viability. When the concentration increased to 80 μM, Ber-lipo showed certain toxicity. Figure 5 and Figure 6 Taking into account the results, Ber-lipo was subsequently used at a concentration of 40 μM to intervene in cells and animals.
[0089] 4. Schematic diagram of the compatibility of different concentrations of Ber-lipo with blood
[0090] Take 2mL of normal mouse whole blood, add 1000U / mL heparin sodium solution and centrifuge (5000rpm, 5min, room temperature), discard the upper plasma, dilute and resuspend the precipitate with an appropriate amount of normal saline, and wash 3 times until the supernatant is bloodless. Take an appropriate amount of red blood cells from the lower layer into a centrifuge tube, add normal saline to prepare a 2% red blood cell solution, and then add 10μM, 20μM, 40μM, 80μM, and 160μM of Lipo, Bergapten, and Ber-lipo respectively. Pure water and PBS are used as positive and negative controls, respectively. After standing at room temperature for 3h, centrifuge at 1000rpm for 5min and take pictures and record. Then aspirate the supernatant and detect it on a microplate reader at 540nm to calculate the hemolysis rate. Hemolysis rate = (Aa-A0) / (Ab-A0)×100%. (Aa, A0, and Ab are the absorbance of the experimental group, negative control group, and positive control group, respectively)
[0091] Figure 7 The results showed that the Ber-lipo of the present invention is incompatible with blood and has good biocompatibility.
[0092] 5. Effect of Ber-lipo on LPS-induced expression of proinflammatory cytokines IL-6, IL-1β, and TNF-α mRNA in RAW264.7 cells
[0093] RAW264.7 cells were seeded in 12-well plates. When the cell density reached 60%-70%, the medium was replaced with serum-free medium. Bergapten, Ber-lipo, and an equal volume of Lipo were added to a 40 μM concentration in the medium. PBS (equal volume to Ber-lipo) was added to the control and model groups. After 12 hours, the serum-free medium was replaced again. The model and drug groups were stimulated with medium containing 100 ng / mL LPS for 4 hours. The control group was given medium containing the same concentration of PBS buffer. Fresh serum-free medium was then replaced, and the drug was added in the same manner for 6 hours (PBS buffer was used instead of drug in both the control and model groups). After the experimental intervention, cells were harvested for RNA extraction. Total RNA from RAW264.7 cells was extracted using an RNA extraction kit (Tiangen Biotech, China). The extracted RNA content was measured using Nanodrop, and the mRNA was reverse transcribed into cDNA using the PrimeScript RT kit (Takara Bio, China). Using the cDNA of each sample as a template, qRT-PCR amplification was performed to detect and analyze the mRNA expression of each target gene (IL-6, IL-1β, TNF-α and Tubulin). -ΔΔCTMethods The relative expression levels of each gene were calculated. The primer sequences used are as follows:
[0094] TNF-α-F:TTGTCTACTCCCAGGTTCTCT;
[0095] TNF-α-R:GAGGTTGACTTTCTCCTGGTATG;
[0096] IL-1β-F:GGTGTGGTGACGTTCCCATTA;
[0097] IL-1β-R:ATTGAGGTGGAGAGCTTTCAG;
[0098] IL-6-F:CTTCCATCCAGTTGCCTTCT;
[0099] IL-6-R:CTCCGACTTGTGAAGTGGTATAG;
[0100] Tubulin-F:AGCAGCTACTTTGTGGAGTG;
[0101] Tubulin-R:TCGGAGATGCGCTTGAATAG.
[0102] Figure 8 The results showed that Ber-lipo of the present invention could significantly reduce the increase in mRNA levels of pro-inflammatory factors IL-6, IL-1β and TNF-α caused by LPS stimulation, and inhibit the inflammation of RAW264.7 cells.
[0103] 6. Effect of Ber-lipo on the fluorescence intensity and distribution of macrophage polarization indicators CD86 and CD163
[0104] RAW264.7 cells were seeded in 0.17 mm glass-bottomed culture dishes. When the cells reached a density of 60%-70%, they were treated with 100 ng / mL of LPS. The control group received an equal volume of PBS. In the drug-treated groups, Bergapten, Ber-lipo, and Lipo were added to the culture dish to a concentration of 40 μM. In the model and control groups, an equal volume of PBS buffer was used instead of the drug. After 24 hours of treatment, cells were harvested and subjected to immunofluorescence staining. Cells were fixed with 4% paraformaldehyde for 10 minutes, permeabilized with 0.5% Triton X-100 (diluted in PBS) for 10 minutes, and blocked with 5% BSA (diluted in PBS) for 1 hour. The cells were then incubated with primary antibodies against CD86 (Proteintech, 13395-1-AP, 1:500) and CD163 (Proteintech, 16646-1-AP, 1:500) at 4°C overnight. The next day, cells were incubated with the corresponding Cy3 fluorescent secondary antibody (Biolegend, 406402, 1:200) at room temperature in the dark for 1 h; cell nuclei were counterstained with DAPI for 20 min; and images were taken using a Zeiss laser confocal microscope with a 63× oil immersion lens.
[0105] Figure 9 The results showed that compared to the control group, the fluorescence intensity of CD86 in the model group was significantly increased, while the fluorescence intensity of CD163 was significantly decreased. In contrast, the fluorescence intensity of CD86 in the Bergapten and Ber-lipo groups was significantly decreased, while the fluorescence intensity of CD163 was increased. CD86 is a marker for M1 macrophage polarization, and CD163 is a marker for M2 macrophage polarization. This suggests that Ber-lipo can inhibit the polarization of M1 macrophages and promote the polarization of M2 macrophages.
[0106] 7. Effect of Ber-lipo on the expression of macrophage polarization markers CD86 and CD163 proteins
[0107] RAW264.7 cells were seeded in 6-well plates. When the cells reached a density of 60%-70%, 100 ng / mL LPS was added to stimulate the cells. The control group received PBS instead. In the treatment group, Bergapten, Ber-lipo, and Lipo were added to the culture dish to a concentration of 40 μM. In the control and model groups, an equal volume of PBS was added to the Ber-lipo volume. Cells were harvested 24 hours after treatment. RIPA, PMSF, and a phosphatase inhibitor were added to the cells at a 100:1:1 volume ratio. The cells were shaken on ice for 30 minutes, centrifuged at 12,000 rpm for 10 minutes at 4°C, and the supernatant was collected for protein concentration measurement using a BCA kit. The cell protein sample with the measured concentration was added to SDS-PAGE protein loading buffer, boiled at 95°C for 10 minutes, and loaded onto a pre-prepared gel for SDS-PAGE separation at 80V for 30 minutes and 120V for 1.5 hours. After electrophoresis, the membrane was transferred to the membrane at 250 mA for 2 hours. After transfer, the membrane was transferred to a culture dish containing 5% skim milk powder and blocked on a shaker for 2 hours. The membrane was then incubated with primary antibodies against CD86 (Proteintech, 13395-1-AP, 1:2000) and CD163 (Proteintech, 16646-1-AP, 1:1000) overnight at 4°C. The following day, after washing with TBST, the membrane was incubated with the corresponding secondary antibodies for an additional 1 hour at room temperature. Finally, the protein bands on the membrane were imaged using a chemiluminescence imaging system.
[0108] Figure 11 The results showed that the protein bands of RAW264.7 cells stimulated by LPS increased the expression of CD86 and decreased the expression of CD163 compared with the control group. After Bergapten and Ber-lipo treatment, the intensity of CD86 protein bands weakened, while the intensity of CD163 protein bands increased. Figure 10 The grayscale values of the protein bands showed that the Ber-lipo group had a more pronounced decrease in CD86 and a more pronounced increase in CD163 than the Bergapten group, with both differences being statistically significant. This indicates, at the protein level, that Bergapten and Ber-lipo can inhibit the polarization of M1 macrophages and promote the polarization of M2 macrophages, with Ber-lipo having a greater effect than Bergapten.
[0109] 8. Effect of Ber-lipo on the mRNA expression of macrophage polarization markers CD86, iNOS, and CD206
[0110] RAW264.7 cells were seeded in 12-well plates. When the density reached 60%-70%, 100 ng / mL of LPS was added to stimulate the cells. The control group was given PBS buffer instead of drugs. In the drug-treated group, Bergapten, Ber-lipo and Lipo were added to the culture dish to a concentration of 40 μM. The control group and the model group were added with an equal volume of PBS as Ber-lipo. The cells were collected after 24 hours of intervention. Total RNA was extracted according to the instructions of the RNA extraction kit (Tiangen Biotech, China), the extracted RNA content was determined by Nanodrop, and the mRNA was reverse transcribed into cDNA using the PrimeScript RT kit (Takara Bio, China). Using the cDNA of each sample as a template, the target genes (CD86, CD206, iNOS and Tubulin) were amplified by qRT-PCR to analyze the mRNA expression of each target gene. After the reaction, Tubulin was used as the internal reference gene and 2 -ΔΔCT Methods The relative expression levels of each gene were calculated. The primer sequences used are as follows:
[0111] CD86-F:CGCAAGCTTATTTCAATGGGA;
[0112] CD86-R:CCTGCCAAAATACTACCAG;
[0113] iNOS-F:GGAATCTTGGAGCGAGTTGT;
[0114] iNOS-R:CCTCTTGTCTTTGACCCAGTAG;
[0115] CD206-F:TTCCGTCACCCTGTATGCC;
[0116] CD206-R:TAACTCTGTGCCCTTGATTCCA;
[0117] Tubulin-F:AGCAGCTACTTTGTGGAGTG;
[0118] Tubulin-R:TCGGAGATGCGCTTGAATAG;
[0119] Figure 12The results showed that compared with the Control group, the mRNA levels of CD86 and iNOS in the Model group were significantly increased, and the mRNA level of CD206 was significantly decreased. Compared with the Model group, the Bergapten and Ber-lipo groups showed the opposite trend, and there was a significant difference between the Ber-lipo group and the Bergapten group. The mRNA level demonstrated that the Ber-lipo of the present invention can inhibit the polarization of M1 macrophages and promote the polarization of M2 macrophages.
[0120] 2. Animal Experiments and Determination of Related Indicators
[0121] 1. Animal grouping and modeling
[0122] After anesthesia, mice were injected intratracheally with 5 mg / kg of LPS to induce an ALI model (no fasting required). The control group received an equal volume of PBS to the LPS, marking day 0. Subsequently, mice inhaled 6 mL of 40 μM Bergapten, Ber-lipo, and Lipo (equal volume to Ber-lipo) twice daily. Both the model and control groups inhaled an equal volume of PBS to the Ber-lipo for 20 minutes each time. Mice were sacrificed 72 hours after infection (day 3), and samples were collected for assays.
[0123] 2. Determination of relevant indicators
[0124] 1) Effects of Ber-lipo on lung index in LPS-induced ALI mice
[0125] At the time of sacrifice, the whole fresh lung tissue of each mouse was collected and weighed (W1). The weight of the mouse was recorded at the time of sacrifice (W2). The lung coefficient was calculated according to the formula W1 / W2×100%.
[0126] Figure 13 The results showed that Ber-lipo of the present invention significantly reduced the increase in the lung index of ALI mice caused by LPS and alleviated lung edema.
[0127] 2) Effects of Ber-lipo on total cell count and total protein in bronchoalveolar lavage fluid of LPS-induced ALI mice
[0128] Mice were anesthetized with 3% chloral hydrate, their limbs immobilized, and a catheter was inserted into the trachea through a small neck incision and secured. The trachea was then lavaged with pre-chilled sterile saline or PBS, 0.7 mL each time, repeated three times. The collected lavage fluid was centrifuged at 3000 rpm for 10 minutes at 4°C for determination of total protein concentration and total cell count.
[0129] Figure 14 and Figure 15The results showed that compared with the LPS-induced Model group, the Ber-lipo of the present invention significantly reduced the total cell count and total protein concentration in the alveolar lavage fluid of ALI model mice and enhanced the permeability of the lungs.
[0130] 3) Effects of Ber-lipo on lung tissue pathological damage in LPS-induced ALI mice
[0131] Fresh lung tissue was fixed in 4% paraformaldehyde for 24 hours, then embedded in paraffin and sectioned at 4 μm thickness. The sections were removed using glass slides, dried, and stained with hematoxylin and eosin according to the protocol. The stained slides were dried, mounted, and photographed under a light microscope.
[0132] Figure 16 The results showed that compared with the model group, the lung tissue had obvious inflammatory cell infiltration (black arrow), alveolar wall thickening (red arrow), inflammatory exudation (green arrow), and obvious alveolar structure destruction. The Ber-lipo treatment group significantly improved the above damage.
[0133] 4) Effect of Ber-lipo on the mRNA expression of proinflammatory cytokines IL-6, IL-1β, and TNF-α in lung tissue of LPS-induced ALI model mice
[0134] Total RNA was extracted from lung tissue according to the instructions of the RNA extraction kit (Tiangen Bio, DP419). The extracted RNA content was determined by Nanodrop, and the mRNA was reverse transcribed into cDNA using the PrimeScript RT kit (Takara, RR047B). The target genes (IL-6, IL-1β, TNF-α, and Tubulin) were amplified and analyzed by qRT-PCR using the cDNA of each sample as a template. Tubulin was used as an internal reference gene after the reaction. -ΔΔCT Methods The relative expression levels of each gene were calculated. The primer sequences used are as follows:
[0135] TNF-α-F:TTGTCTACTCCCAGGTTCTCT;
[0136] TNF-α-R:GAGGTTGACTTTCTCCTGGTATG;
[0137] IL-1β-F:GGTGTGGTGACGTTCCCATTA;
[0138] IL-1β-R:ATTGAGGTGGAGAGCTTTCAG;
[0139] IL-6-F:CTTCCATCCAGTTGCCTTCT;
[0140] IL-6-R:CTCCGACTTGTGAAGTGGTATAG;
[0141] Tubulin-F:AGCAGCTACTTTGTGGAGTG;
[0142] Tubulin-R:TCGGAGATGCGCTTGAATAG.
[0143] Figure 17 The results showed that Ber-lipo of the present invention can significantly reduce the mRNA levels of proinflammatory factors IL-6, IL-1β and TNF-α in the lung tissue of ALI mice induced by LPS, and its anti-inflammatory effect is better than that of monomeric Bergapten.
[0144] 5) Effects of Ber-lipo on the fluorescence expression and distribution of macrophage polarization indicators CD86, iNOS, CD163, and CD206 in the lung tissue of LPS-induced ALI model mice
[0145] First, antigen retrieval was performed on paraffin sections of lung tissue, followed by immunofluorescence staining according to the cell immunofluorescence staining protocol. Primary antibodies used included CD86 (Proteintech, 13395-1-AP, 1:200), CD163 (Proteintech, 16646-1-AP, 1:200), CD206 (Proteintech, 60143-1-Ig, 1:200), and iNOS (Santa Cruz, sc-7271, 1:100). Secondary antibodies used included donkey anti-rabbit Cy3 (Biolegend, 406402, 1:200) and goat anti-mouse Cy3 (Biolegend, 405309, 1:200). Finally, sections were sealed and photographed under a 40× oil-immersion confocal microscope.
[0146] Figure 18 The results showed that Ber-lipo of the present invention can significantly inhibit the fluorescence intensity of M1 macrophage polarization CD86 and iNOS, and significantly increase the fluorescence intensity of M2 macrophage polarization indicators CD163 and CD206, that is, inhibit M1 polarization and promote M2 polarization.
[0147] 6) Effect of Ber-lipo on the protein expression of macrophage polarization markers CD86, CD163, and CD206 in the lung tissue of LPS-induced ALI model mice
[0148] 50 mg of lung tissue was placed in a centrifuge tube. RIPA, PMSF, and a phosphatase inhibitor were added in a 100:1:1 ratio. Magnetic beads were then added to homogenize the tissue. Centrifuge at 12,000 rpm for 10 minutes at 4°C. The supernatant was collected and protein concentration was measured using a BCA kit. The lung tissue protein sample with the measured concentration was added with 5× SDS-PAGE protein loading buffer and boiled at 95°C for 10 minutes. The sample was then loaded onto a pre-prepared gel and separated by SDS-PAGE electrophoresis at 80V for 30 minutes and 120V for 1.5 hours. After electrophoresis, the membrane was transferred at 250mA for 2 hours. After transfer, the membrane was transferred to a culture dish containing 5% skim milk powder and blocked on a shaker for 2 hours. The membrane was then incubated overnight at 4°C with primary antibodies targeting CD86 (Proteintech, 13395-1-AP, 1:2000), CD163 (Proteintech, 16646-1-AP, 1:1000), and CD206 (Proteintech, 60143-1-Ig, 1:10000). The following day, the membrane was washed with TBST and incubated with the corresponding secondary antibodies for 1 hour at room temperature. Finally, the protein bands on the membrane were imaged using a chemiluminescence imaging system.
[0149] Figure 19 and Figure 20 The results showed that compared with the model group, CD86 in the Bergapten and Ber-lipo groups was significantly decreased, while CD163 and CD206 were significantly increased. The difference between Bergapten and Ber-lipo was significant and statistically significant, which indicates that Ber-lipo of the present invention can significantly inhibit the polarization of M1 macrophages in lung tissue and promote the polarization of M2 macrophages, and the effect is better than free Bergapten.
[0150] 7) Effect of Ber-lipo on the mRNA expression of macrophage polarization markers CD86, iNOS, CD163, and CD206 in the lung tissue of LPS-induced ALI model mice
[0151] Total RNA was extracted from lung tissue according to the instructions of the RNA extraction kit (Tiangen Biotechnology, DP419). The extracted RNA content was determined by Nanodrop, and the mRNA was reverse transcribed into cDNA using the PrimeScript RT kit (Takara, RR047B). qRT-PCR was performed to amplify the target genes (CD86, iNOS, CD163, and CD206) using the cDNA of each sample as a template to analyze the mRNA expression of each target gene. Tubulin was used as an internal reference gene after the reaction. -ΔΔCT Methods The relative expression levels of each gene were calculated. The primer sequences used are as follows:
[0152] CD86-F:CGCAAGCTTATTTCAATGGGA;
[0153] CD86-R:CCTGCCAAAATACTACCAG;
[0154] iNOS-F:GGAATCTTGGAGCGAGTTGT;
[0155] iNOS-R:CCTCTTGTCTTTGACCCAGTAG;
[0156] CD206-F:TTCCGTCACCCTGTATGCC;
[0157] CD206-R:TAACTCTGTGCCCTTGATTCCA;
[0158] Tubulin-F:AGCAGCTACTTTGTGGAGTG;
[0159] Tubulin-R:TCGGAGATGCGCTTGAATAG;
[0160] CD163-F:AATCCCAGACACTATTGCCAT;
[0161] CD163-R:CTCCACCTACCAAGCGAAG.
[0162] Figure 21 The results showed that Ber-lipo of the present invention significantly reduced CD86 and iNOS mRNA, inhibited the polarization of M1 macrophages in lung tissue, significantly increased CD163 and CD206 mRNA, promoted the polarization of M2 macrophages, and the effect of Ber-lipo was better than that of monomeric Bergapten.
[0163] The above are only some embodiments of the present invention. For those skilled in the art, several modifications and improvements can be made without departing from the inventive concept of the present invention, which all fall within the scope of protection of the present invention.
Claims
1. An inhalable bergamot lactone nanoliposome, comprising a raw drug and a carrier, characterized in that: The original drug is bergamot lactone, and the carrier is DPPC, cholesterol and mPEG2000-DSPE. The molar ratio of DPPC, cholesterol and mPEG2000-DSPE in the carrier is (70-85): (15-25):
3. The molar ratio of bergamot lactone and DPPC in the inhalable bergamot lactone nanoliposomes is 1: (1.5-4.5).
2. The inhalable bergamot lactone nanoliposome according to claim 1, characterized in that The drug loading amount of bergamot lactone in the bergamot lactone nanoliposome is 0.45% to 0.60%.
3. The inhalable bergamot lactone nanoliposome according to claim 1, characterized in that The encapsulation efficiency of the bergamot lactone nanoliposomes for bergamot lactone is 5% to 8%.
4. The inhalable bergamot lactone nanoliposome according to claim 1, characterized in that The zeta potential of the bergamot lactone nanoliposome is -6 to -8 mV.
5. The method for preparing the inhalable bergamot lactone nanoliposome according to any one of claims 1 to 4, characterized in that: The steps include: S1. DPPC, cholesterol, mPEG2000-DSPE, and bergamot lactone were dissolved in a solvent, and the solvent was removed to form a thin film; S2. Add an aqueous medium to the film formed in step S1, and fully hydrate and remove the film at 50-70° C. to obtain inhalable bergamot lactone nanoliposomes.
6. Use of the inhalable bergamot lactone nanoliposomes according to any one of claims 1 to 4 in the preparation of a medicament for treating acute lung injury.
7. The use according to claim 6, characterized in that The administration method of the medicine for treating acute lung injury is aerosol inhalation administration.
Citation Information
Patent Citations
Application of bergamolactone in preparation of medicine for treating lung injury and protecting chronic kidney disease
CN116687915A
Targeted magnetic nanometer nano-liposome and preparation method thereof
CN107441505A
Bergamolactone liposome and preparation method thereof, encapsulation rate determination method, bergamolactone liposome gel and preparation method thereof
CN116617164A