A human-derived genetically engineered antibody with the structure and insecticidal function of Bt Cry1C toxin and its mutant

The humanized genetically engineered antibody 3A7 anti-I-GEAb and its mutants obtained through in vitro screening simulate the structure and function of Bt Cry1C toxin, solving the safety risks and detection complexity of Bt Cry toxin in pest control, and achieving efficient and safe pest detection and control.

CN118930646BActive Publication Date: 2025-10-10JIANGSU ACAD OF AGRI SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411182418.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-08-27
Publication Date
2025-10-10
Estimated Expiration
2044-08-27

Smart Images

  • Figure CN118930646B_ABST
    Figure CN118930646B_ABST
Patent Text Reader

Abstract

The application provides a human-derived genetically engineered antibody with targeted simulation of Bt Cry1C toxin structure and insecticidal function and a high-activity mutant of the human-derived genetically engineered antibody, nucleotide sequences and amino acid sequences of the human-derived genetically engineered antibody are respectively shown as SEQ IN NO. 1 and SEQ IN NO. 2, nucleotide sequences and amino acid sequences of the mutant are respectively shown as SEQ IN NO. 3 and SEQ IN NO. 4; after the antibody and the mutant are expressed in prokaryotes, the LD50 of corresponding proteins to Plutella xylostella larvae is respectively 38.9% and 46.8% of the original Bt Cry1C toxin, the LD50 of corresponding proteins to cotton bollworm larvae is respectively 32.9% and 37.4% of the original Bt Cry1C toxin; the two can be respectively used as coating antigens in an IC-ELISA detection method to detect Bt Cry1C toxin with high sensitivity; the antibody and the mutant can be used as antigen analogue materials to replace the structure of Bt Cry1C toxin, not only can be used as new protein insect-resistant materials to have potential application value in green control of agricultural pests, but also can be used for detection of Bt Cry1C toxin residues in the environment and food samples, and have wide application value.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of novel biosafety pesticides and pesticide immunological detection technology, in particular to a human-derived genetically engineered antibody with Bt Cry1C toxin structure simulation and insecticidal function, and a mutant and application thereof. BACKGROUND

[0002] Bt Cry toxin is a biological macromolecular protein with high specificity and target insecticidal function, which is metabolized by Bacillus thuringiensis (Bt). Its insecticidal spectrum covers Lepidoptera, Coleoptera, Diptera, Hemiptera, Hymenoptera, and various common agricultural and forestry pests and health vectors such as nematodes and snails (Palma et al., “Bacillus thuringiensis toxins: an overview of their biocidal activity”, Toxins, 2014, No. 6). Although there are many types of Bt Cry toxin and a wide insecticidal spectrum, the mechanism of action of most of its subtypes on target pests is basically locked as a series of cascade interactions with specific membrane protein receptors such as cadherin, aminopeptidase, alkaline phosphatase, ABC transporter, GTP-coupled regulatory protein, etc. on the brush border membrane vesicles (BBMV) of the corresponding insect midgut, leading to dysfunction of the insect gut, ultimately causing growth and development inhibition and even death of the insect (Xu Zhenxin et al., “Rational design and innovative application strategies of insecticidal proteins based on Bt toxins”, Chinese Journal of Agricultural Sciences, 2024, No. 1). Currently, Bt Cry toxin is widely used in green pest control in the form of microbial expression preparations and transgenic insect-resistant crops, and its commercialized transgenic crops involve important crop types such as rice, corn, soybean, potato, cotton, and tobacco, with a global planting area of nearly 200 million hectares per year, generating huge economic value and social and ecological benefits. However, since the commercialization of Bt toxin preparations and transgenic insect-resistant crops in the 1930s and 1990s, Bt Cry toxin products have been continuously promoted and applied worldwide for nearly a century. The potential risks of target pest resistance induced by long-term accumulation and cross-toxicity to non-target organisms have become increasingly prominent, especially in recent years, the safety of food from transgenic crops has attracted much attention (Koch et al., “The food and environmental safety of Bt crops”, Frontiers in Plant Science, 2015, No. 6).

[0003] In 1974, Danish immunologist Niels K. Jerne first proposed and elaborated the "immune network theory" of antibodies ("Towards a network theory of the immune system", Ann Immunol, 1974, No. 125). He believed that the entire process in which antigens (Antigen, Ag) enter the animal body and stimulate the immune system to produce antibodies (Antibody, Ab) to induce a series of immune effects until the end is a reversible cascade immune reaction, in which the idiotypic antigen receptor site on the primary antibody (Ab1) molecule that responds to the antigen can reversely stimulate the immune system to produce a secondary anti-antibody (Ab2) that specifically responds to the idiotypic site of the antibody, namely, anti-idiotypic antibody (Anti-Id). Anti-idiotypic antibodies are further classified into four major subtypes: Ab2α, Ab2β, Ab2γ, and Ab2ε, based on the region and function of their binding to the idiotypic antigen receptor (IDAR) of the target antibody. These subtypes correspond to the immune system-induced anti-idiotypic antibodies produced by reverse stimulation of the idiotypic antigen receptor (IDAR) framework, complementarity-determining region (CDR), proximal to the CDR, and distal to the CDR on the antibody molecule. Ab2β-type anti-idiotypic antibodies are induced by direct stimulation of the immune system by the CDR (i.e., the core region critical for binding of the antibody idiotope to the antigen) on the antibody molecule. They exhibit an "internal image" effect of the antigen, and their three-dimensional conformation resembles that of the antigen (Ameri et al., "Idiotypes and anti-idiotypic antibodies: a review," Comparative Clinical Pathology, 2006, Vol. 4). Therefore, Ab2β-type anti-idiotypic antibodies have the ability to mimic and replace all or part of the key structure and even biological activity of the antigen.Based on the technical path for preparing anti-idiotypic antibodies in the "immune network theory" of antibodies, Hanoux et al. ("Polyclonal anti-idiotypic antibodies which mimic an epitope of the human prion protein", Molecular immunology, 2009, Issue 6) used animal immunization to create Ab2β anti-idiotypic antibodies that mimic the key receptor structure of human prion protein and can replace it for the treatment of corresponding diseases; Shi et al. ("Preparation monoclonalβ-type anti-idiotype antibody of zearalenone and development of green ELISA quantitative detecting technique", Preparative Biochemistry & Biotechnology, 2020, Issue 4) used immunized animals to obtain Ab2β anti-idiotypic monoclonal antibodies that mimic the key characteristic structure of zearalenone, which can replace the original toxin standard for establishing an immunological detection method for screening and analysis of the toxin.

[0004] However, these traditional technologies all use in vivo animal immunization combined with in vitro identification and screening to obtain anti-unique antibodies. The technical process is complex and it is difficult to obtain the target material, which is not conducive to the subsequent expression preparation and further functional modification. At the same time, the currently common single-chain antibodies (genetically engineered antibodies containing heavy and light chain structures) have the problem of structural instability. Summary of the Invention

[0005] To address the above issues, this application uses an in vitro enrichment and screening strategy for an antibody library to screen and obtain a humanized Bt Cry1C toxin anti-idiotypic genetically engineered antibody (and simultaneously obtain the corresponding antibody gene). This antibody, which only has a heavy chain structure, possesses the advantages of a stable nano-antibody structure, strong shuttling ability, and ease of expression. This application also obtains mutants based on this antibody to mimic the structure and insecticidal function of the Bt Cry1C toxin, replacing existing biological insect-resistant materials. Specifically, the present invention is achieved as follows:

[0006] First, the present application provides a humanized genetically engineered antibody that mimics the structure and insecticidal function of Bt Cry1C toxin, whose nucleotide sequence and amino acid sequence are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively. The applicant named the antibody 3A7 anti-I-GEAb.

[0007] Secondly, the present application provides a mutant of the above-mentioned antibody 3A7 anti-I-GEAb, whose nucleotide sequence and amino acid sequence are shown in SEQ IN NO. 3 and SEQ IN NO. 4, respectively. The applicant named this mutant 3A7 anti-I-GEAb mutant 8.

[0008] Third, the present application also provides the use of humanized genetically engineered antibodies and mutants thereof having amino acid sequences as shown in SEQ ID NO.2 and SEQ ID NO.4 for controlling target pests Plutella xylostella larvae and Helicoverpa armigera larvae.

[0009] Fourth, the present application also provides human genetically engineered antibodies and mutants thereof with amino acid sequences as shown in SEQ ID NO.2 and SEQ ID NO.3 to replace Bt Cry1C toxin as coating antigens, and 7C9-mAb F(ab)2 as detection antibodies, and cooperates with Bt Cry1C toxin antibodies to establish an IC-ELISA detection (indirect competitive enzyme-linked immunosorbent assay) method for specific and highly sensitive detection of Bt Cry1C toxin.

[0010] Fifth, the present application provides a recombinant expression vector, a transgenic cell line or a recombinant engineered bacterium containing the nucleotide sequences of SEQ ID NO.1 and SEQ ID NO.2.

[0011] The present application draws on the theory of the "immune network theory" of antibodies ("Towards a network theory of the immune system", Ann Immunol, 1974, Vol. 125), in which the Ab2β type anti-idiotypic antibodies have an "internal image" effect of the antigen (Ameri et al., "Idiotypes and anti-idiotypic antibodies: a review", Comparative Clinical Pathology, 2006, Vol. 4), thereby having the functional properties of mimicking and replacing all or part of the key structure and even the biological activity of the antigen. For the first time, by specifically designing a Bt Cry1C toxin idiotypic monoclonal antibody antigen-binding fragment (7C9-mAb F(ab)2) as the coating target antigen, a humanized genetically engineered Ab2β anti-idiotypic antibody (3A7 anti-I-GEAb) with Bt Cry1C toxin structure and insecticidal function was screened from a public human gene library. Then, through targeted CDR3 region saturation mutagenesis and further screening, a mutant with higher activity (3A7) was obtained. This humanized genetically engineered antibody and its mutants were expressed in a prokaryotic system, and the corresponding antibody proteins were lethal to the target pests, Plutella xylostella and Helicoverpa armigera larvae. Furthermore, these antibodies can be used as coating antigens to replace Bt Cry1C toxin standards and, in combination with Bt Cry1C toxin antibodies, establish an IC-ELISA assay for the specific and highly sensitive detection of Bt Cry1C toxin.

[0012] The present invention discloses an Ab2β anti-idiotypic humanized genetically engineered antibody (3A7 anti-I-GEAb) and a mutant thereof (3A7 anti-I-GEAbmutant 8) obtained by in vitro targeted screening, which has the structure and insecticidal function of mimicking Bt Cry1C toxin. The antibody has a short preparation cycle, a small amino acid sequence, and is suitable for large-scale in vitro production. At the same time, as a brand-new insect-resistant gene resource, the present invention has important scientific and practical significance for exploring and expanding new insect-resistant gene resources with insecticidal activity that mimics Bt toxin, reducing various safety risks associated with the widespread use of existing Bt toxins, and even potentially replacing Bt toxins for biological control of agricultural pests in the future. In addition, the present invention can also serve as a structural substitute for Bt Cry1C toxin standards and cooperate with corresponding antibodies to establish an immunoassay method for monitoring Bt Cry1C toxin residues. This can reduce potential secondary risks brought about by the production and use of Bt Cry1C toxin standards, achieve the goal of green detection of Bt Cry1C toxin, and has important significance for environmental and food safety and broad application prospects.

[0013] Compared with the prior art, this application has the following beneficial effects:

[0014] 1. The humanized genetically engineered antibodies (3A7anti-I-GEAb) and their mutants (3A7anti-I-GEAb mutant 8) created in this application, which mimic the structure and insecticidal function of the Bt Cry1C toxin, have insecticidal activity against the target pests, the larvae of Plutella xylostella and the larvae of the cotton bollworm. Furthermore, due to the humanized nature of these anti-insect genetically engineered antibodies, they theoretically will not cause significant allologous rejection reactions in the human immune system. Therefore, compared with the original Bt Cry toxin, they have greater safety advantages and are of great scientific research significance and potential for exploration and application.

[0015] 2. The humanized genetically engineered antibody (3A7anti-I-GEAb) and its mutant (3A7 anti-I-GEAb mutant 8) of the present application, which have the structure and insecticidal function of simulating Bt Cry1C toxin, can be used as coating antigens to replace Bt Cry1C toxin standards, and cooperate with Bt Cry1C toxin antibodies to establish an IC-ELISA detection method to achieve specific, highly sensitive green detection of Bt Cry1C toxin.

[0016] 3. The amino acid sequences and encoding genes of the humanized genetically engineered antibodies (3A7anti-I-GEAb) and their mutants (3A7anti-I-GEAb mutant 8) of the present application, which have the structure and insecticidal function of simulating Bt Cry1C toxin, have been determined. Therefore, these genetically engineered antibody materials can be prepared by soluble expression through a variety of expression systems; in addition, based on the amino acid and gene information of these genetically engineered antibodies, these materials can also be further functionally modified (such as antigen binding activity and stability) with the help of existing antibody affinity maturation technology. Therefore, these genetically engineered materials have great advantages in further preparation or improved application in the later stage. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is a diagram showing the protein extraction results of Px-BBMV and Ha-BBMV analyzed by SDS-PAGE in Example 1;

[0018] Among them, (a) is the effect diagram of Px-BBMV after SDS-PAGE electrophoresis, lane M is the protein standard, and lanes 1-3 are the collected Px-BBMV protein solutions; (b) is the effect diagram of Ha-BBMV after SDS-PAGE electrophoresis, lane M is the protein standard, and lanes 1-2 are the collected Ha-BBMV protein solutions.

[0019] Figure 2The preparation and identification results of the Bt Cry1C toxin idiotypic monoclonal antibody and its antigen-binding fragment in Example 2;

[0020] Among them, (a) is a diagram of the immune effect of Bt Cry toxin; (b) is the IC-ELISAs standard curve of the inhibition of the binding of the culture supernatant of the fusion cell line named 7C9-mAb to the coated Bt Cry toxin using Bt Cry 1C toxin, Px-BBMV and Ha-BBMV as competitive inhibitors; (C) is the electrophoresis diagram of the antibody protein and its antigen-binding fragment (7C9-mAb F(ab)2) obtained after ascites preparation using the 7C9-mAb fusion cell line; (d) is the ELISA binding activity test result of 7C9-mAb and its antigen-binding fragment with Bt Cry1C toxin.

[0021] Figure 3 These are the results of screening and identification of the anti-idiotypic genetically engineered antibody against Bt Cry1C toxin Ab2β in Example 3.

[0022] Figure 4 These are the construction and analysis results of the 3A7 anti-I-GEAb mutation library in Example 4.

[0023] Figure 5 These are the results of screening and identification of highly active mutants of 3A7 anti-I-GEAb in Example 4.

[0024] Figure 6 These are the prokaryotic expression and purification results of 3A7 anti-I-GEAb and its mutant 3A7 anti-I-GEAb mutant 8 in Example 5.

[0025] Figure 7 These are the anti-insect activity test results of the antibody 3A7 anti-I-GEAb and its mutant 3A7 anti-I-GEAb mutant 8 in Example 6.

[0026] Figure 8 This is the standard curve of IC-ELISAs for Bt Cry1C toxin detection established in Example 7. DETAILED DESCRIPTION

[0027] The reagent formula involved in the embodiment:

[0028] (1) PBS solution

[0029] Weigh 8 g of NaCl, 0.2 g of KCl, 2.9 g of Na2HPO4·12H2O, and 0.2 g of KH2PO4, add them respectively into distilled water, dissolve them fully, and adjust the volume to 1 L.

[0030] (2) PBST solution

[0031] Tween-20 was added to the PBS solution at a volume ratio of 0.05%.

[0032] (3) MET buffer

[0033] Weigh 300 mM mannitol, 5 mM EGTA, and 17 mM Tris, add them to distilled water respectively, adjust the pH to 7.5 after fully dissolving, and then adjust the volume to 1 L.

[0034] (4) Tetramethylbenzidine (TMB) solution:

[0035] Weigh 10 mg of tetramethylbenzidine and dissolve it in 1 ml of dimethyl sulfoxide. Protect from light and store at 4°C until use.

[0036] (5) Substrate color development solution:

[0037] 10ml formula ingredients: 9.875mL CPBS, 100μL TMB solution, 25μL 20% H2O2 by volume.

[0038] (6) 2×TY liquid culture medium:

[0039] Add 16 g of tryptone, 10 g of yeast extract, and 5 g of NaCl to 900 mL of double-distilled water, stir to mix, and dilute to 1 L with double-distilled water. Sterilize in an autoclave at 121°C for 20 min. After cooling, store at 4°C until use.

[0040] (7) 2×TY-AG liquid culture medium:

[0041] Ampicillin with a final concentration of 100 μg / ml and glucose with a mass ratio of 1% were added to the 2×TY culture medium.

[0042] (8) 2×TY-AK liquid culture medium:

[0043] Ampicillin and kanamycin were added to the 2×TY culture medium at a final concentration of 100 μg / ml and 50 μg / ml.

[0044] (9) 2×TY-AKG liquid culture medium:

[0045] Ampicillin at a final concentration of 100 μg / ml, kanamycin at a mass ratio of 50 μg / ml and glucose at a mass ratio of 1% were added to the 2×TY culture medium.

[0046] (10) TYE solid medium:

[0047] Add 15.0 g agarose, 8 g NaCl, 10 g tryptone, and 5 g yeast extract to 900 ml of double-distilled water, dilute to 1 L with double-distilled water, place in an autoclave, sterilize at 121°C for 20 min, cool, and store at 4°C until ready for use. (11) TYE-AG solid medium:

[0048] Ampicillin with a final concentration of 100 μg / ml and glucose with a mass ratio of 1% were added to TYE solid culture medium.

[0049] (12) PEG / NaCl solution:

[0050] Weigh 20 g of PEG 8000 and 14.61 g of NaCl, add 80 ml of deionized water, and adjust the volume to 100 ml. Place in an autoclave and sterilize at 121°C for 20 min. After cooling, store at 4°C until use.

[0051] Sources of materials involved in the examples:

[0052] Bt Cry1C toxin standard was purchased from Meiyan (Beijing) Agricultural Technology Co., Ltd.;

[0053] The Balb / c model mice were provided by the Center for Comparative Medicine of Yangzhou University.

[0054] Goat anti-mouse IgG-HRP, anti-M13 mAb-HRP, and anti-His mAb-HRP were purchased from Beijing Qingke Biotechnology Co., Ltd.

[0055] Freund's complete adjuvant, Freund's incomplete adjuvant, hypoxanthine thymidine (HT), hypoxanthine aminopterin thymidine (HAT), and polyethylene glycol (PEG) were all purchased from Sigma.

[0056] DMEM high-glucose culture medium was purchased from Nanjing Youqing Biotechnology Co., Ltd.

[0057] Fetal bovine serum (Fetal Bovine Serum) was purchased from Nanjing Novozymes Biotechnology Co., Ltd.

[0058] TMB substrate colorimetric solution was purchased from Beijing Pulilai Gene Technology Co., Ltd.

[0059] Cell culture plates (9-, 24-, and 96-well), cell culture flasks, and ELISA plates were purchased from Corning;

[0060] Non-Ab2β human genetically engineered antibodies, second-instar larvae of diamondback moth, and second-instar larvae of cotton bollworm were provided by the Key Laboratory of Agricultural Product Quality Safety Control Technology and Standards of the Ministry of Agriculture, Jiangsu Academy of Agricultural Sciences;

[0061] Phage display human genetic engineering antibody library (human heavy chain single domain antibody library), E. coli TG1 bacteria and helper phage KM13 were purchased from Source BioScience, UK.

[0062] pET26b plasmid vector, E. coli BL21, 2×PCR Mix-buffer, Not I / Nco I endonuclease, DNA maker, and protein maker were purchased from New England Biolabs.

[0063] The rest of the reagents used were of analytical grade.

[0064] The nucleotide sequences and amino acid sequences involved in the examples are:

[0065] SEQ ID NO.1:

[0066] ATGGCCCAGGTGCAGCTGTTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGCGTCTCCTGTGCAGCCT

[0067] CCGGA GATATGATTAGCGATAAGGCTATGGCC TGGGTCCGCCAGGCTCCAGGGAAGGGTCTAGAGTGGGTATCA GCGAT

[0068] TAAGACACCAGGAGGTAGCACA TACTACGCAGACTCCGTGAAGGGCCGGTTCACCATCTCCCGTGACAATTCCAAGAAC

[0069] ACGCTGTATCTGCAAATGAACAGCCTGCGTGCCGAGGACACCGCGGTATATTATTGCGCG AGTTCGTA TGCGATTAGGTCGGAGTCTGTTAAGGACGCGGACTTGGCGTTT TGGGGTCAGGGAACCCTGGTCACCGTCTCGAGCGCGGCCGCA;

[0070] SEQ ID NO.2:

[0071] MAQVQLLESGGGLVQPGGSLRLSCAASG DMISDKAMAWVRQAPGKGLEWVS AIKTPGGST YYADSVKGRFTISRDNSKN TLYLQMNSLRAEDTAVYYCASS YAIRSESVKDADLAF WGQGTLVTVSSAAA;

[0072] SEQ ID NO. 3:

[0073] ATGGCCCAGGTGCAGCTGTTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGCGTCTCTCCTGTGCAGCCT

[0074] CCGGA GATATGATTAGCGATAAGGCTATGGCC TGGGTCCGCCAGGCTCCAGGGAAGGGTCTAGAGTGGGTATCA GCGAT

[0075] TAAGACACCAGGAGGTAGCACA TACTACGCAGACTCCGTGAAGGGCCGGTTCACCATCTCCCGTGACAATTCCAAGAAC

[0076] ACGCTGTATCTGCAAATGAACAGCCTGCGTGCCGAGGACACCGCGGTATATTATTGCGCGAGTTCG TA TGCGATTAGGTCGGAGTCTCCGAAGTTCGCGCCTTTGGCGTTT TGGGGTCAGGGAACCCTGGTCACCGTCTCGAGCGCGGCCGCA;

[0077] SEQ ID NO. 4:

[0078] MAQVQLLESGGGLVQPGGSLRLSCAASG DMISDKAMA WVRQAPGKGLEWVS AIKTPGGST YYADSVKGRFTISRDNSKN TLYLQMNSLRAEDTAVYYCASS YAIRSESPKFAPLAF WGQGTLVTVSSAAA;

[0079] SEQ IN NO. 5: CAGGAAACAGCTATG;

[0080] SEQ IN NO. 6: CTATGCGGCCCCATT;

[0081] SEQ IN NO. 7: ATGGCCCAGGTGCAGCTGTTGGAGTCT;

[0082] SEQ IN NO.8: TGCGGCCGCGCTCGAGACGGTGAC;

[0083] SEQ IN NO.9:

[0084] CGCGGCCGCTGCGGCCGCGCTCGAGACGGTGACCAGGGTTCCCTGACCCCANNKNNKNNKNNKNNKNNKNNKNNKNNKN NKNNKNNKNNKNNKCGAACTCGC;

[0085] SEQ IN NO.10: CCATGGGTCATGGCCCAGGTGCAGCTGTTGGAGTCT;

[0086] SEQ IN NO.11: CGCGGCCGCTGCGGCCGCGCTCGAGACGGTGAC;

[0087] SEQ IN NO.12: TAATACGACTCACTATAGGGG;

[0088] SEQ IN NO.13: GCTAGTTATTGCTCAGCG.

[0089] Example 1 Preparation of Plutella xylostella BBMV (Px-BBMV) and Helicoverpa armigera BBMV (Ha-BBMV) Proteins

[0090] According to the method reported by Xie et al. ("Docking-based generation of antibodies mimicking Cry1A / 1B protein binding sites as potential insecticidal agents against diamondbackmoth (Plutella xylostella)", Pest Management Science, 2021, Issue 10), 1000 4th-instar larvae of diamondback moth and 80 cotton bollworm larvae were taken, and the midguts were extracted respectively. The midguts were washed in a pre-cooled 0.15M sodium chloride solution, removed and drained; then placed in 10ml of Homogenize in a glass homogenizer containing MET buffer for 1 minute, then ice-bathe for 1 minute, and repeat 10 times; aspirate the corresponding homogenate and place it in a 50ml centrifuge tube, add an equal volume of 24mM MgCl2 solution, vortex mix, and ice-bathe for 15 minutes; then centrifuge at 3000g for 15 minutes, take the supernatant, and then centrifuge at 15000g for 50 minutes, discard the supernatant, and resuspend the precipitate (i.e., Px-BBMV and Ha-BBMV proteins, respectively) in HEPES solution with a mass concentration of 1mM for storage.

[0091] The electrophoretic patterns of Px-BBMV and Ha-BBMV protein extraction obtained in this example are shown in Figure 2. Figure 1 (a) and Figure 1 As shown in (b), the total protein concentration in the Px-BBMV solution was 5.76 mg / ml, and the total protein concentration in the Ha-BBMV solution was 2.19 mg / ml.

[0092] Example 2 Preparation and Identification of Antigen-Binding Fragments of Monoclonal Antibodies to the Idiotypic Bt Cry1C Toxin

[0093] Preparation process of Bt Cry1C toxin monoclonal antibody: 800 μg of Bt Cry1C toxin standard was dissolved in 100 μL PBS solution and fully mixed and emulsified with 100 μL complete Freund's adjuvant, and then injected into the abdominal cavity of 6-week-old healthy female Balb / c mice by intraperitoneal injection; two weeks later, 100 μg of Bt Cry1C toxin standard was dissolved in 100 μL PBS solution and fully mixed and emulsified with 100 μL incomplete Freund's adjuvant, and also injected into the abdominal cavity of the test mice; two weeks later, 100 μg of Bt Cry1C toxin standard was dissolved in 100 μL PBS solution and fully mixed and emulsified with 100 μL incomplete Freund's adjuvant, and also injected into the abdominal cavity of the test mice; one week later, 125 μg of Bt The Cry1C toxin standard was dissolved in 100 μL PBS solution and injected directly into the abdominal cavity of the test mice; after another week, the spleen B cells of the test mice were collected for the preparation of monoclonal antibody fusion cell lines. Before each round of immunization, a small amount of blood was collected by tail cutting to extract serum for indirect noncompetitor ELISA (INC-ELISA) determination and analysis of the corresponding immune effect; the specific steps were carried out according to the method reported by Jin et al. ("Rational design and application of broad-spectrumantibodies for Bt Cry toxins determination", Analytical Biochemistry, 2024, No. 693). After four rounds of immunization, the immune effect of Bt Cry toxin was as follows: Figure 2 As shown in (a), it can be seen that OD 450 The standard is >1.0, and the calibration of the test mouse serum reaches 1:100000, indicating a good immune effect.

[0094] Cell fusion procedure: After ensuring that the immune response reached acceptable levels, mice were dislocated by cervical dislocation and then immersed in 75% alcohol for 10 minutes. The mice were then removed and drained. Under sterile conditions, the spleens were removed and triturated in incomplete culture medium (HAT medium). After filtering, the triturated solution was collected and aliquoted into 20 mL tubes. Spleen cells were counted under a microscope. Splenocytes and SP2 / 0 myeloma cells were mixed in an equal volume at a 5:1 ratio and centrifuged at 1000 rpm for 10 minutes at 37°C. The supernatant was discarded, and the pelleted cells were resuspended in 1 mL of PEG at 40°C and allowed to stand for 1 minute. 15 mL of HAT medium was then added, and the mixture was allowed to stand in a 37°C incubator for 10 minutes. The pelleted cells were resuspended in 5 mL of HAT medium, brought to a total volume of 50 mL, and aliquoted into 96-well plates at 100 μL / well and cultured at 37°C. After five days, fresh HAT medium was added to the cells at 100 μL / well. Two days later, half of the culture medium in the plate wells was aspirated and an equal volume of fresh HAT medium was added. The cells were then cultured until the cells occupied about 1 / 10 of the bottom of the well. The cell culture medium was then used for INC-ELISA to analyze the binding activity of the immunogen Bt Cry1C toxin.

[0095] Identification process of target Bt Cry1C toxin idiotypic monoclonal antibodies: Referring to the indirect competitive enzyme-linked immunosorbent assay (IC-ELISA) method established by Xu et al. (“Screening and identification of vancomycin anti-idiotypic antibodies for against Staphylococcus aureus from a human phage display domain antibody library”, Immunology Letters, 2022, No. 246), BtCry 1C toxin, Px-BBMV and Ha-BBMV were used as competitive inhibitors, and their inhibition of the binding activity of the fusion cell supernatant to the coated Bt Cry 1C toxin was analyzed to identify the target Bt Cry1C toxin idiotypic monoclonal antibodies. The specific method is as follows: Bt Cry1C toxin was diluted to a mass concentration of 2 μg / mL with PBS buffer, and 100 μL was added to each well of a 96-well ELISA plate, and coated overnight at 4°C. Remove the coated plate, wash with 300 μL / well of PBST buffer, then add 300 μL / well of MPBS solution and incubate at 37°C for 2 hours. Remove the blocked plate, wash with 300 μL / well of PBST buffer, and add 50 μL of fused cell culture supernatant and 50 μL of a concentration series (0.1, 0.5, 1.5, 10, 20, 50, 100, and 1000 ng / mL) of competitive inhibitors (Bt Cry 1C toxin, Px-BBMV, Ha-BBMV) diluted in PBS to each well. PBS was used as a negative control and the cells were incubated at 37°C for 1 hour. Remove the incubated plate, wash with 300 μL / well of PBST buffer, and add 100 μL / well of Goat anti-mouse IgG-HRP secondary antibody (1:5000 diluted in PBS buffer) and incubate at 37°C for 1 hour. After washing the plate with 300 μL / well PBST buffer, add TMB colorimetric solution at 100 μL / well and develop the color in the dark at 37°C for 15 minutes. Then measure the OD of the relevant reaction wells. 450 The standard curve of the competitive inhibition rate of the corresponding IC-ELISAs was drawn according to the calculation formula [(PSN)] / (PN)]×100%; where P represents the OD of the positive control 450 Value (test sample is 50 μL of fusion cell culture supernatant + 50 μL PBS solution), S represents the OD of each standard 450Values ​​(test samples are 50 μL of fusion cell culture supernatant and 50 μL of competitive inhibitor solution with a series of concentration gradients diluted with PBS solution), N represents the OD of the negative control 450 Value (test sample is 50 μL PBS solution). Among them, Bt Cry 1C toxin, Px-BBMV and Ha-BBMV are used as competitive inhibitors, and the fusion cells that can inhibit the binding of the test supernatant to the coated Bt Cry 1C toxin are determined to be Bt Cry1C toxin idiotype monoclonal antibodies; the corresponding fusion cell lines can be used to prepare the target Bt Cry1C toxin idiotype monoclonal antibodies and antigen-binding fragments thereof, as follows: the number of cells of the corresponding subclone fusion cell lines identified as the target Bt Cry1C toxin idiotype monoclonal antibodies is quantified to 10 using DMEM high glucose medium. 6 , then injected into the abdominal cavity of female mice at a rate of 0.5 ml / mouse. After 5 days of feeding, ascites was extracted from the abdominal cavity of the test mice. Finally, referring to the saturated ammonium sulfate precipitation method reported by our team previously ("Preparation and Detection Application of Bt (Cry1F) Toxin Polyclonal Antibodies", Xu Chongxin et al., Agricultural Product Quality and Safety, Issue 4, 2016) and HiTrap Protein G HP (steps refer to the product operation manual) column purification method, the target Bt Cry1C toxin idiotypic monoclonal antibody (named 7C9-mAb) was separated and purified from the extracted ascites, and its antigen-binding fragment (named 7C9-mAb F(ab)2) was purified by Pierce purification method of Thermo Scientific (USA). TM The F(ab)2 Preparation Kit was prepared according to the product manual, and its antigen binding activity was analyzed by INC-ELISA.

[0096] Figure 2 (b) shows the IC-ELISAs standard curve using Bt Cry 1C toxin, Px-BBMV and Ha-BBMV as competitive inhibitors to inhibit the binding of the culture supernatant of the fusion cell line named 7C9-mAb to the coated Bt Cry toxin. The corresponding inhibitory concentrations were measured to be 7.7, 19.4 and 26.2 ng / ml, respectively, indicating that the inhibitory activity was relatively strong, thereby indicating that the monoclonal antibody meets the characteristics of the Bt Cry1C toxin idiotypic monoclonal antibody.

[0097] Figure 2(c) shows the antibody protein and its antigen-binding fragment (7C9-mAb F(ab)2) obtained by preparing ascites with 7C9-mAb fusion cell line, wherein lane M is a protein marker, lane 1 is ascites containing 7C9-mAb, lane 2 is a protein solution of ascites containing 7C9-mAb after crude purification by saturated ammonium sulfate, lane 3 is a protein solution of 7C9-mAb after purification by HiTrap Protein G HP column, lane 4 is a protein solution of 7C9-mAb after purification by HiTrap Protein G HP column and denaturation by β-mercaptoethanol, lane 5 is a protein solution of 7C9-mAb pure protein after Pierce TM Lane 6 shows the protein solution of F(ab)2 purified by enzyme digestion with the F(ab)2 Preparation Kit, and lane 6 shows the protein solution of 7C9-mAb F(ab)2 denatured with β-mercaptoethanol. Both proteins are consistent with the molecular weight characteristics of the corresponding proteins, demonstrating that the Bt Cry1C toxin idiotypic monoclonal antibody and its antigen-binding fragment were successfully prepared and performed well.

[0098] Figure 2 Middle (d) shows the ELISA binding activity of 7C9-mAb and its antigen-binding fragment with Bt Cry1C toxin. The results show that both have strong binding activity to Bt Cry1C toxin.

[0099] Example 3 Screening and Identification of Anti-Idiotypic Genetically Engineered Antibodies to Bt Cry1C Toxin Ab2β

[0100] (1) Take 20 μl of phage display human genetic engineering antibody library and add it to 200 ml of 2×TY-AG liquid culture medium, and culture at 37°C until OD 600 is 0.4, take 50ml of bacterial solution, add 1×10 12 pfu / ml helper phage KM13 was superinfected, incubated at 37°C for 30 min, centrifuged at 3300g for 10 min, the supernatant discarded, and the pellet resuspended in 100 ml of 2×TY-AKG liquid medium and cultured at 30°C overnight; the next day, the supernatant was centrifuged at 3300g for 30 min, the supernatant was collected and added with 20 ml of PEG / NaCl solution, ice-bathed for 1 h, and then centrifuged at 3300g for 30 min, and the pellet resuspended in 4 ml of PBS; the resuspended solution was centrifuged at 11600g for 10 min, and the supernatant was the amplified phage antibody library, which was titrated to 1×10 with PBS solution. 9 pfu / ml for standby use;

[0101] (2) The amplified phage antibody library obtained in step 1 was subjected to a total of 6 rounds of enrichment and panning (7C9-mAb F(ab)2) and Px-BBMV were used as coating antigens for 3 rounds of enrichment and panning respectively): In the first round of enrichment and panning, 4 ml of 100 μg / ml BtCry1C toxin idiotypic monoclonal antibody antigen-binding fragment (7C9-mAb F(ab)2)) was coated on the bottom of a cell culture flask and incubated at 4°C overnight. The next day, the cell culture flask was washed 3 times with 1 ml of PBS, and then 1 ml of the amplified phage antibody library and 4 ml of 3% MPBS solution were added. The flask was placed on a shaker and slowly shaken at room temperature for 1 hour. After standing for 1 hour, the liquid in the flask was poured out, and the flask was washed 20 times with 1 ml of PBST solution, and 1 ml of PBST solution was added. 10mg / ml trypsin was used to elute the specifically bound phage antibodies. The eluate was the phage antibodies from the first round of panning. The phage antibodies were amplified according to step 1 and the volume was adjusted to 1×10 9 pfu / ml for standby use; in the second, third, fourth, fifth, and sixth rounds of enrichment and panning, the coated materials were: 4 ml 100 μg / ml Px-BBMV, 4 ml 50 μg / ml 7C9-mAb F(ab)2, 4 ml 50 μg / ml Px-BBMV, 4 ml 50 μg / ml 7C9-mAb F(ab)2, and 4 ml 25 μg / ml Px-BBMV, respectively. The phage genetic engineering antibody library used was the secondary library (titer of 1×10 9 pfu / ml), and the panning method was the same as that of the first round; 10 μl of phage antibodies screened in the sixth round were used to infect 1 ml of TG1 bacteria in the logarithmic growth phase, incubated at 37°C for 1 hour, and then spread on TYE-AG solid medium and cultured at 37°C overnight; the next day, single colonies were randomly picked and inoculated into 96-well plates containing 100 μl / well 2×TY-AG liquid medium and cultured at 37°C overnight; the next day, 2 μl of bacterial solution was aspirated from the plate wells and transferred to new 96-well plates, incubated at 37°C for 2 hours, and 25 μl of a titer of 10 was added to each well. 12 pfu / ml of helper phage KM13, incubated at 30°C for 2h, centrifuged at 1800g for 10min, resuspended the pellet in 150μl 2×TY-AK liquid medium and cultured at 30°C overnight, centrifuged at 1800g for 30min the next day, and the supernatant was collected respectively;

[0102] (3) 7C9-mAb F(ab)2 and Px-BBMV at a concentration of 2 μg / ml were added to a 96-well plate, 100 μl / well, and incubated at 4°C overnight. The next day, 100 μl of the supernatant obtained in step 2 was added to each well. For the negative control, 100 μl of 2×TY-AK liquid culture medium was added. The plate was incubated at 37°C for 2 h. After washing the plate with 250 μl of PBST per well, 100 μl of 1:3000 diluted HRP-goat anti-M13-IgG was added to each well and incubated at 37°C for 2 h. 100 μl of substrate color development solution was added to each well and reacted at room temperature for 10-20 min until blue appeared. Finally, 50 μl of 2 mol / L H2SO4 was added to each well to quickly terminate the reaction and the OD was measured using a microplate reader. 450 The OD values ​​of the same solution coated with 7C9-mAb F(ab)2 and Px-BBMV were 450 Value / negative control OD 450 If the values ​​are all greater than 3.0, it is preliminarily determined to be positive, and the supernatant in step 2 corresponding to the solution is the screened supernatant preliminarily determined to contain the Bt Cry1C toxin Ab2β anti-idiotypic genetically engineered antibody.

[0103] (4) Referring to the IC-ELISA method steps established in the “Target Bt Cry1C toxin idiotypic monoclonal antibody identification process”, 7C9-mAb F(ab)2 was diluted to a mass concentration of 2 μg / ml in 100 μl / well of PBS solution as the coating antigen, and 7C9-mAb F(ab)2, Px-BBMV and Ha-BBMV were used as competitive inhibitors to inhibit the binding activity of the supernatant of the anti-idiotypic genetically engineered antibody against Bt Cry1C toxin Ab2β in (3) with the coating antigen 7C9-mAb F(ab)2. The step of adding the “Goat anti-mouse IgG-HRP (diluted 1:5000 in PBS buffer) secondary antibody” was replaced by the “anti-M13mAb-HRP (diluted 1:3000 in PBS buffer) secondary antibody”, and the other steps remained unchanged. The standard curve of the competitive inhibition rate of the corresponding IC-ELISAs was drawn according to the calculation formula [(PSN)] / (PN)]×100%; where P represents the OD of the positive control 450 Value (test sample is 50 μL of supernatant of the anti-idiotypic genetic engineering antibody preliminarily identified as Bt Cry1C toxin Ab2β + 50 μL PBS solution), S represents the OD of each standard 450 Values ​​(test samples were 50 μL of the supernatant of the anti-idiotypic genetic engineering antibody preliminarily identified as Bt Cry1C toxin Ab2β and 50 μL of a competitive inhibitor solution with a concentration gradient diluted in PBS solution), N represents the OD of the negative control 450Value (test sample is 50 μL PBS solution).

[0104] Using 7C9-mAb F(ab)2, Px-BBMV and Ha-BBMV as competitive inhibitors, the corresponding genetically engineered antibody that can simultaneously inhibit the binding of the supernatant of the Bt Cry1C toxin Ab2β anti-idiotypic genetically engineered antibody preliminarily identified in (3) to the coating antigen 7C9-mAb F(ab)2 can be confirmed as the "Bt Cry1C toxin Ab2β anti-idiotypic genetically engineered antibody". The corresponding antibody gene was sent to General Biotechnology Co., Ltd. (Anhui) for sequencing (sequencing universal primers, sequencing universal primers, upstream LMB3 nucleotide sequence is shown in SEQ IN NO.5, downstream PHEN nucleotide sequence is shown in SEQ IN NO.6).

[0105] Figure 3 The results of screening and identification of the Bt Cry1C toxin Ab2β anti-idiotypic genetically engineered antibody in this example are shown. (a) shows the primary library after enrichment and panning of the target phage-displayed Bt Cry1C toxin Ab2β anti-idiotypic genetically engineered antibody. The primary library was panned using 7C9-mAb F(ab)2 and Px-BBMV as coating antigens for three rounds of enrichment. Polyclonal phage ELISA analysis showed that the ELISA binding activity against the coated 7C9-mAb F(ab)2 and Px-BBMV gradually increased, indicating that the phage-displayed target genetically engineered antibody was effectively enriched. (b) The positive clone of the genetically engineered antibody labeled 3A7 (named 3A7 anti-I-GEAb by the applicant) showed strong binding activity to both the coated 7C9-mAb F(ab)2 and Px-BBMV as determined by monoclonal phage ELISA. Nc-1 was a negative control clone randomly selected during the screening process that had no binding activity to both 7C9-mAb F(ab)2 and Px-BBMV. (c) is the IC-ELISA standard curve using 7C9-mAb F(ab)2, Px-BBMV and Ha-BBMV as competitive inhibitors to inhibit the binding of the corresponding positive monoclonal phage-displayed expression supernatant of 3A7 anti-I-GEAb to the coated 7C9-mAb F(ab)2. The corresponding median inhibitory concentrations were measured to be 8.82, 10.70 and 13.20 ng / ml, respectively, indicating that the inhibitory activity was relatively strong. This indicates that the monoclonal phage-displayed genetically engineered antibody meets the characteristics of the Bt Cry1C toxin Ab2β anti-idiotypic genetically engineered antibody.

[0106] The applicant further sequenced the antibody 3A7 anti-I-GEAb obtained in this example. Its amino acid sequence is shown in SEQ IN NO. 2, and the nucleotide sequence of the encoding gene is shown in SEQ IN NO. 1, wherein the underlined portion is the heavy and light chain CDR region.

[0107] Example 4 Construction of a mutant library of Bt Cry1C toxin Ab2β anti-idiotypic genetically engineered antibodies and screening and identification of highly active mutants

[0108] The strategy for constructing the anti-idiotypic genetically engineered antibody mutation library against Bt Cry1C toxin Ab2β was based on the method reported by Zhong et al. (“Broadspecificity immunoassay for detection of Bacillus thuringiensis Cry toxins through engineering of a single chain variable fragment with mutagenesis and screening”, International journal of biological macromolecules, 2018, Vol. 107). The positive human phage-displaying genetically engineered antibody strain named 3A7 anti-I-GEAb obtained by screening in Example 3 was cultured overnight in 2×TY-A medium, and the corresponding target genetically engineered antibody gene was prepared by bacterial liquid PCR amplification the next day: 50 μL of PCR reaction system contained 25 μL of 2×PCR Mix-buffer, 1 μL of 3A7 anti-I-GEAb corresponding bacterial liquid culture, 1 μL of upstream primer (whose nucleotide sequence is shown in SEQ IN NO.7), 1 μL of downstream primer (whose nucleotide sequence is shown in SEQ IN NO.8) and 22 μL of ddH2O. The PCR reaction conditions were pre-denaturation at 94°C for 5 min, then denaturation at 94°C for 1 min, annealing at 56°C for 1 min, extension at 72°C for 1 min, and this cycle was repeated 35 times, and finally extension at 72°C for 10 min. The PCR product can be used as a gene template for constructing a mutation library after purification using GenElute Kits from Sigma (see the kit product manual for steps): a 50 μL PCR reaction system contains 25 μL 2×PCR Mix-buffer, 1 μL 3A7 anti-I-GEAb gene PCR amplification product, 0.5 μL upstream primer (CCATGGGTCATGGCCCAGGTGCAGCTGTTGGAGTCT), 0.1 μL downstream primer targeting random saturation mutation of the CDR3 region of the 3A7 anti-I-GEAb gene (its nucleotide sequence is shown in SEQ IN NO. 9) and 23.4 μL ddH2O.

[0109] The PCR reaction conditions are: pre-denaturation at 95°C for 10 min, denaturation at 95°C for 1.5 min, annealing at 59°C for 1.5 min, extension at 72°C for 1.5 min, 30 cycles of this, and finally extension at 72°C for 15 min. The PCR product can be used to construct a mutation library after purification using GenElute Kits from Sigma (see the kit product manual for steps).

[0110] The corresponding mutant gene of 3A7 anti-I-GEAb was double digested with Not I / Nco I endonucleases and cloned into a pIT2 phagemid vector. The cells were then electroporated into E. coli TG1 competent cells and plated onto TYE-A plate culture medium and cultured overnight at 37°C. The colonies that grew were collected to construct a mutant library targeting the CDR3 region of 3A7 anti-I-GEAb. The detailed operation steps were performed according to the literature (Xu et al., "Construction of an immunized rabbit phage display library for selecting high activity against Bacillus thuringiensis Cry1Ftoxin single-chain antibodies", Journal of agricultural and food chemistry, 2017, No. 651). The screening and identification process of 3A7 anti-I-GEAb highly active mutants was consistent with that in Example 3.

[0111] Figure 4 The results of the construction and analysis of the mutation library of the antibody 3A7 anti-I-GEAb in this example are shown, wherein: (a) is an electrophoresis diagram of the PCR products of 3A7 anti-I-GEAb and its mutants, wherein lane M is a nucleotide marker, lane ck is a control group without adding a gene template, lane 1 is a PCR amplification product of the 3A7 anti-I-GEAb gene, and lanes 2-4 are PCR products targeting mutations in the CDR3 region of the 3A7 anti-I-GEAb gene using the 3A7 anti-I-GEAb gene as a template; the results show that the corresponding PCR products are all consistent with the size of the target gene of 3A7 anti-I-GEAb, indicating that the PCR amplification was successful. (b) Electrophoresis of PCR amplification products of random single colonies of the 3A7 anti-I-GEAb mutant library constructed in this example: Lane M is a nucleotide marker, lane ck is a control group without gene template, and lanes 1-23 are PCR amplification products of the corresponding 3A7 anti-I-GEAb mutant genes from randomly selected single colonies; the results show that the PCR products of the corresponding mutants are consistent with the size of the target gene of 3A7 anti-I-GEAb, indicating that the mutant library was successfully constructed. (c) Diversity analysis of the CDR3 region amino acid alignment after sequencing of single colonies 1-23 in (b). The structure shows good amino acid diversity in this region, further confirming the successful construction of the mutant library.

[0112] Figure 5The results of screening and identification of high-activity mutants of antibody 3A7 anti-I-GEAb in this embodiment. Among them, (a) is the enrichment screening of the target phage-displayed 3A7 anti-I-GEAb mutants. The primary library after 2 rounds of enrichment screening with 7C9-mAb F(ab)2 and Px-BBMV as coating antigens respectively, and the polyclonal phage ELISA analysis showed that their ELISA binding activities to the coated 7C9-mAb F(ab)2 and Px-BBMV gradually increased, indicating that the target genetically engineered antibody displayed by phage was effectively enriched. (b) is the determination of the corresponding positive clones of 3A7 anti-I-GEAb mutant (the applicant self-named it as 3A7 anti-I-GEAb mutant 8) labeled as mutant 8 by monoclonal phage ELISA, which had higher binding activity to the coated 7C9-mAb F(ab)2 and Px-BBMV than the original 3A7 anti-I-GEAb. Nc-1 is a negative control clone randomly selected in the screening process without binding activity to 7C9-mAb F(ab)2 and Px-BBMV. The corresponding antibody gene of 3A7 anti-I-GEAb mutant 8 was sent to Universal Biological Company (Anhui) for sequencing. (Sequencing universal primers: LMB3 for upstream and PHEN for downstream).

[0113] The mutant 3A7 anti-I-GEAb mutant 8 was sequenced, and its amino acid sequence is shown in SEQ IN NO. 4, and the nucleotide sequence of the encoding gene is shown in SEQ IN NO. 3, wherein the underlined part is the heavy and light chain CDR region. Compared with the original antibody, the mutant has the same amino acids except that 3 amino acids in the CDR3 region are mutated. The CDR3 region amino acid of antibody 3A7 anti-I-GEAb is "YAIRSESVKDADLAF", and the CDR3 region of mutant 3A7 anti-I-GEAb mutant 8 is "YAIRSESPKFAPLAF".

[0114] Example 5 Expression and purification of 3A7 anti-I-GEAb and its mutant 3A7 anti-I-GEAb mutant 8

[0115] The corresponding strains of 3A7 anti-I-GEAb obtained in Example 3 and 3A7 anti-I-GEAb mutant 8 obtained in Example 4 were cultured overnight in 2×TY-A medium. The next day, the corresponding target genetically engineered antibody genes were prepared by bacterial liquid PCR amplification: 50 μL of PCR reaction system contained 25 μL of 2×PCR Mix-buffer, 1 μL of 3A7 anti-I-GEAb corresponding bacterial liquid culture, 1 μL of upstream primer (SEQ IN NO.10), 1 μL of downstream primer (SEQ IN NO.11) and 22 μL of ddH2O. The PCR reaction conditions were: pre-denaturation at 94°C for 5 min, followed by denaturation at 94°C for 1 min, annealing at 56°C for 1 min, and extension at 72°C for 1 min, 35 cycles of this, and finally extension at 72°C for 10 min.

[0116] The amplified PCR products were double-digested with Not I / Nco I endonucleases and cloned into the pET26b plasmid vector, then transformed into E. coli BL21 competent cells, spread onto LB-K plate culture medium and cultured at 37°C overnight; the next day, single colonies were randomly picked and amplified by PCR using T7 universal primers (upstream primer SEQ IN NO.12, downstream primer SEQ IN NO.13) and sequenced for identification.

[0117] Positive monoclonal colonies containing the corresponding target genes of 3A7 anti-I-GEAb and 3A7 anti-I-GEAb mutant 8 were identified and transferred to LB-K liquid medium. Cultures were shaken at 250 rpm at 37°C until the logarithmic growth phase (approximately 2.5 hours). IPTG was then added until its concentration reached 0.8 mM. The shaker temperature was then adjusted to 28°C, and induction was continued for 12 hours. The next day, the culture was removed and centrifuged at 6000 g for 15 minutes at 4°C. The pelleted cells were collected and resuspended in PBS buffer and then disrupted by sonication in an ice bath (sonication conditions: 300 W, 2.5 seconds on, 2 seconds off, for 30 minutes). The ultrasonically disrupted whole-cell lysate was removed and centrifuged at 10,000 g for 30 min in a 4°C centrifuge. The supernatant was removed and the corresponding target 3A7 anti-I-GEAb and 3A7 anti-I-GEAb mutant 8 proteins were purified by column chromatography using GE His-Trap HP affinity chromatography (see the product manual for steps).

[0118] Figure 6These are the prokaryotic expression and purification results of 3A7 anti-I-GEAb and its mutant 3A7 anti-I-GEAb mutant 8 in this example, where (a) is the electrophoresis graph of the PCR amplification products of the corresponding genes of 3A7 anti-I-GEAb and 3A7 anti-I-GEAb mutant 8: lane M is a DNA marker, ck1 is a blank control group without added gene template, ck2 is a negative control group using pET26b empty plasmid as a template, lanes 1-3 are positive monoclonal clones using bacteria containing the pET26b-3A7 anti-I-GEAb recombinant plasmid as a template, and lanes 4-6 are positive monoclonal clones using bacteria containing the pET26b-3A7 anti-I-GEAb mutant 8 recombinant plasmid as a template. (b) is the result of double enzyme digestion identification of pET26b-3A7 anti-I-GEAb recombinant plasmid, where M is DNA marker, 1 is the control group after double digestion of pET26b empty plasmid with Nco I / Not I endonuclease, and 2 is the positive group after double digestion of pET26b-3A7 anti-I-GEAb recombinant plasmid with Nco I / Not I endonuclease. (c) is the result of double enzyme digestion identification of pET26b-3A7 anti-I-GEAb mutant 8 recombinant plasmid, where lane M is DNA marker,

[0119] 1 is the control group after pET26b empty plasmid was double digested with Nco I / Not I endonuclease, 2 is the control group after pET26b-3A7

[0120] The positive group after double digestion of the anti-I-GEAb mutant 8 recombinant plasmid with Nco I / Not I endonucleases. (d) is the SDS-PAGE analysis result of the induced expression of the pET26b-3A7 anti-I-GEAb protein, where lane M is a protein marker and lane 1 is the whole cell lysate after the pET26b-3A7 anti-I-GEAb recombinant plasmid was transformed into E. coli BL21 for induced expression and ultrasonication. (e) is the SDS-PAGE analysis result of the induced expression of the pET26b-3A7 anti-I-GEAb mutant 8 protein, where lane M is a protein marker and lane 1 is the whole cell lysate after the pET26b-3A7 anti-I-GEAb mutant 8 recombinant plasmid was transformed into E. coli BL21 for induced expression and ultrasonication. (f) is the SDS-PAGE analysis result of column-purified 3A7 anti-I-GEAb and 3A7 anti-I-GEAb mutant 8 proteins, wherein lane M is the protein marker, lane 1 is the purified 3A7 anti-I-GEAb protein, and lane 2 is the purified 3A7 anti-I-GEAb mutant 8 protein.

[0121] The above test results indicate that the prokaryotic expression recombinant plasmid clones of the corresponding genes of 3A7 anti-I-GEAb and its mutant 3A7 anti-I-GEAb mutant 8 were successfully constructed, and after induced expression and column purification, 3A7 anti-I-GEAb protein with a concentration of 269.8 μg / mL and 3A7 anti-I-GEAb mutant 8 protein with a concentration of 377.2 μg / mL were successfully prepared.

[0122] Example 6 Determination of Antiinsect Activity of 3A7 Anti-I-GEAb and Its Mutant 3A7 Anti-I-GEAb Mutant 8

[0123] The bioassay process of diamondback moth larvae was as follows: the phage-displayed 3A7 anti-I-GEAb and phage-displayed Nc-1 (negative control) prepared in Example 3 and the phage-displayed 3A7 anti-I-GEAbmutant8 prepared in Example 4 were taken and their phage titers were quantified to 1.0×10 9cfu / ml for later use; the 3A7 anti-I-GEAb and its mutant 3A7 anti-I-GEAb mutant 8 proteins prepared in Example 5 were similarly quantified with PBS solution to a concentration of 500 ng / ml for later use; a negative control was a PBS solution, and a positive control was a Bt Cry1C toxin of the same concentration. The co-test materials were spread onto Petri dishes containing solid feed and allowed to air dry at room temperature. Twenty second-instar larvae of the diamondback moth (a conventional non-resistant strain, i.e., a susceptible strain) were placed in each Petri dish and raised in an incubator at 28°C ± 1°C, 80±5% relative humidity, and a 12h:12h photoperiod (L:D) cycle. The number of deaths was observed and recorded every 24 hours for five consecutive days. Larvae were considered alive if they survived to the fourth instar and were able to eclosion; otherwise, they were considered dead (Gao et al., “Roles of midgut cadherin from two moths in different Bacillus thuringiensis action mechanisms: correlation among toxin binding, cellular toxicity, and synergism”, Journal of Agricultural and Food Chemistry, 2019, No. 67).

[0124] The bioassay process for cotton bollworm larvae was as follows: the phage-displayed 3A7 anti-I-GEAb and phage-displayed Nc-1 (negative control) prepared in Example 3 and the phage-displayed 3A7 anti-I-GEAbmutant8 prepared in Example 4 were taken and their phage titers were adjusted to 1.0×10 10cfu / ml for later use; the 3A7 anti-I-GEAb and its mutant 3A7 anti-I-GEAb mutant 8 proteins prepared in Example 5 were quantified to a concentration of 1500 ng / ml using PBS buffer and set aside; a negative control was a PBS solution, and a positive control was a Bt Cry1C toxin of the same concentration. The co-test materials were spread onto Petri dishes containing solid feed and allowed to dry at room temperature. Twenty-four second-instar cotton bollworm larvae (a conventional non-resistant strain, i.e., a susceptible strain) were placed in each Petri dish and raised in an incubator at 28°C ± 1°C, 80±5% relative humidity, and a 12h:12h photoperiod (L:D) cycle. The number of deaths was observed and recorded every 24 hours for five consecutive days. Larvae were considered alive if they survived continuously and weighed more than 8 mg / head; otherwise, they were considered dead (Hao et al., "Synergistic selection of a Helicoverpa armigera cadherin fragment with Cry1Ac in different cells and insects", International journal of biological macromolecules, 2020, No. 164).

[0125] Figure 7These are the anti-insect activity test results of 3A7 anti-I-GEAb and its mutant 3A7 anti-I-GEAb mutant 8 in this example. Among them, (a) is the test results of the lethal activity of the antibody 3A7 anti-I-GEAb and its mutant 3A7 anti-I-GEAb against the tested diamondback moth larvae. It can be seen that the average lethality of the phage-displayed 3A7 anti-I-GEAb, the phage-displayed 3A7 anti-I-GEAb mutant 8, the purified 3A7 anti-I-GEAb protein, and the purified 3A7 anti-I-GEAb mutant 8 protein against diamondback moth were 46.6%, 63.3%, 40%, and 53.3%, respectively, while the PBS solution and phage-displayed NC-1 control groups were 5% and 6.6%, respectively, and the Bt Cry1C toxin positive control group was 100%. This shows that 3A7 anti-I-GEAb and its mutant 3A7 anti-I-GEAb mutant 8 have obvious lethal activity against the target pests, although their lethal toxicity to the target pests is not as good as that of the original Bt Cry1C toxin, but as a human-derived insecticidal genetically engineered antibody, it has high safety and potential application value. (b) shows the lethal activity of the antibody 3A7 anti-I-GEAb and its mutant 3A7 anti-I-GEAb against the tested cotton bollworm larvae. The results showed that the average lethality of the phage-displayed 3A7 anti-I-GEAb, the phage-displayed 3A7 anti-I-GEAb mutant 8, the purified 3A7 anti-I-GEAb protein, and the purified 3A7 anti-I-GEAb mutant 8 protein against cotton bollworm were 31.6%, 43.3%, 26.6%, and 38.3%, respectively, while the PBS solution and phage-displayed NC-1 control groups were 4.17% and 5.6%, respectively, and the Bt Cry1C toxin positive control group was 83.3%. These results indicate that 3A7 anti-I-GEAb and its mutant 3A7 anti-I-GEAb mutant 8 have significant lethal activity against the target pests, although their lethal toxicity to the target pests is not as good as that of the original Bt Cry1C toxin, but as a human-derived insecticidal genetically engineered antibody, it has high safety and potential application value.

[0126] Example 7 Establishment and Evaluation of Immunoassay Methods for 3A7 Anti-I-GEAb and Its Mutant 3A7 Anti-I-GEAb Mutant 8

[0127] 1. Establishment of IC-ELISA detection method

[0128] An IC-ELISA assay for Bt Cry1C toxin detection was established using 3A7 anti-I-GEAb and its mutant, 3A7 anti-I-GEAb mutant 8, as coating antigens in conjunction with 7C9-mAb F(ab)2: 3A7 anti-I-GEAb and 3A7 anti-I-GEAb mutant 8 proteins were diluted to a concentration of 2 μg / mL in PBS buffer, and 100 μL was added to each well of a 96-well microtiter plate. The plate was coated overnight at 4°C. The coated plate was removed and washed with 300 μL / well of PBST buffer. MPBS solution was then added at 300 μL / well and blocked at 37°C for 2 hours. The blocked plate was removed and washed with 300 μL / well of PBST buffer. Then, 50 μL of 7C9-mAb F(ab)2 diluted to 2 μg / mL in PBS and 50 μL of a concentration gradient of the competitive inhibitor Bt Cry1C toxin (0.1, 0.5, 1, 5, 10, 20, 50, 100, and 1000 ng / mL) diluted in PBS were added to each well. PBS was used as a negative control. The cells were incubated at 37°C for 1 hour. The plate was removed and washed with 300 μL / well of PBST buffer. Then, 100 μL / well of Goat anti-mouse IgG-HRP secondary antibody (diluted 1:5000 in PBS buffer) was added and incubated at 37°C for 1 hour. After washing the plate with 300 μL / well PBST buffer, add TMB colorimetric solution at 100 μL / well and develop the color in the dark at 37°C for 15 minutes. Then measure the OD of the relevant reaction wells. 450 The standard curve of the competitive inhibition rate of the corresponding IC-ELISAs was drawn according to the calculation formula [(PSN)] / (PN)]×100%; where P represents the OD of the positive control 450 Value (test sample is 50 μL of 7C9-mAb F(ab)2 solution quantified to 2 μg / mL in PBS solution + 50 μL of PBS solution), S represents the OD of each standard 450 Values ​​(test sample is 50 μL of 7C9-mAb F(ab)2 solution quantified to 2 μg / mL in PBS solution and 50 μL of competitive inhibitor solution with a series of concentration gradients diluted in PBS solution), N represents the OD of the negative control 450 Value (test sample is 50 μL PBS solution).

[0129] Figure 8Standard curves for IC-ELISAs for Bt Cry1C toxin detection were established using 3A7 anti-I-GEAb and 3A7 anti-I-GEAb mutant 8 corresponding proteins as coating antigens and 7C9-mAb F(ab)2 as detection antibody. The IC-ELISA developed based on the 3A7 anti-I-GEAb mutant 8 protein showed a sensitivity (IC10) of 0.35 ng / ml, a median inhibitory concentration (IC50) of 11.53 ng / ml, and a linear detection range (IC20-IC80) of 1.78-76.49 ng / ml for Bt Cry1C toxin. The IC-ELISA developed based on the 3A7 anti-I-GEAb protein showed a sensitivity (IC10) of 0.54 ng / ml, a median inhibitory concentration (IC50) of 15.08 ng / ml, and a linear detection range (IC20-IC80) of 2.35-157.65 ng / ml for Bt Cry1C toxin. These results indicate that the IC-ELISAs developed based on the 3A7 anti-I-GEAb and 3A7 anti-I-GEAb mutant 8 proteins both achieved high sensitivity for Bt Cry1C toxin detection (IC10 below ng / ml).

[0130] 2. Evaluation of the practicality and practicability of IC-ELISAs for the detection of Bt Cry1C toxin based on 3A7 anti-I-GEAb and its mutant 3A7 anti-I-GEAb mutant 8 protein:

[0131] To evaluate the practicality and applicability of the IC-ELISA method established above, tap water, non-GMO corn, rice, soybean, and farmland soil samples were selected for the recovery test of the Bt Cry1C toxin standard spike. Tap water samples were obtained from the applicant's laboratory and filtered through a 0.45μm filter membrane before sample spike. Non-GMO rice, wheat, and corn (all purchased from Nanjing Suguo Supermarket) and farmland soil (collected from the applicant's farmland) were air-dried at 65°C, ground into a powder, and filtered through a 100-mesh sieve before sample spike. According to the linear detection range of Bt Cry1C toxin of the IC-ELISA method established based on 3A7 anti-I-GEAb protein (2.35-157.65 ng / ml), the final concentrations of the Bt Cry1C toxin standard added to the test samples for this detection method were selected as 5, 50 and 100 ng / ml or g; according to the linear detection range of Bt Cry1C toxin of the IC-ELISA method established based on 3A7 anti-I-GEAb mutant 8 protein (1.78-76.49 ng / ml), the final concentrations of the Bt Cry1C toxin standard added to the test samples for this detection method were selected as 2, 10 and 50 ng / ml or g. Specifically, the corresponding concentration of the Bt Cry toxin standard to be tested was added to the tap water sample, and then the IC-ELISA method established in Example 7 was directly used for determination. When the corresponding concentration of the Bt Cry toxin standard to be tested was added to powder samples such as rice, wheat, corn, and farmland soil, an equal volume of PBS-T-BSA protein extract (PBS buffer containing 0.1% Tween 20 and 0.1% BSA) was added, and then the mixture was shaken and mixed at room temperature at 25°C for 4 hours, and then centrifuged at 10,000 g in a centrifuge at 25°C for 10 minutes. The supernatant was aspirated, diluted 10-fold with PBS buffer, and then determined according to the corresponding IC-ELISA method established in Example 7.

[0132] The test results are shown in Table 1 and Table 2 below:

[0133] Table 1. Recovery and coefficient of variation of samples spiked with Bt Cry1C toxin using the IC-ELISA assay based on 3A7 anti-I-GEAb protein

[0134]

[0135] Table 2 Recovery and coefficient of variation of samples spiked with Bt Cry1C toxin using IC-ELISA assay based on 3A7 anti-I-GEAb mutant 8 protein

[0136]

[0137] The test results in Tables 1 and 2 show that the IC-ELISAs method for detecting Bt Cry1C toxin established based on 3A7 anti-I-GEAb protein had recoveries of 81.77%-98.42%, 81.78%-98.20%, 80.17%-97.74%, 85.65%-96.40% and 81.80%-88.01% when Bt Cry1C toxin at different concentration gradients was added to samples such as tap water, rice, wheat, corn and farmland soil, and the corresponding coefficients of variation were 3.49%-8.33%, 1.31%-11.23%, 3.11%-9.12%, 3.11%-9.43% and 2.69%-10.67%, respectively.

[0138] The IC-ELISAs method for detecting Bt Cry1C toxin based on 3A7 anti-I-GEAb mutant 8 protein showed recoveries of 86.46%-98.50%, 80.90%-91.50%, 85.20%-94.00%, 83.34%-95.50% and 80.04%-89.20% when Bt Cry1C toxin at different concentration gradients was added to samples such as tap water, rice, wheat, corn and farmland soil, and the corresponding coefficients of variation were 2.96%-9.50%, 4.19%-11.05%, 5.63%-10.86%, 3.23%-11.44% and 5.72%-11.10%, respectively; the IC-ELISAs method for detecting Bt Cry1C toxin based on 3A7 anti-I-GEAb and its mutant 3A7anti-I-GEAb mutant 8 protein was The IC-ELISAs method for detecting Cry1C toxin has good accuracy and stability, strong practicality and wide applicability for test samples, and is expected to be used for highly sensitive monitoring of toxin residues in BtCry1C toxin preparations or their genetically modified insect-resistant crops.

Claims

1. A humanized genetically engineered antibody that mimics the structure and insecticidal function of Bt Cry1C toxin, the amino acid sequence of which is shown in SEQ IN NO.

2.

2. The gene encoding the humanized genetically engineered antibody according to claim 1, wherein the nucleotide sequence thereof is shown in SEQ IN NO.

1.

3. The mutant of the humanized genetically engineered antibody according to claim 1, wherein the amino acid sequence is shown in SEQ IN NO.

4.

4. Use of the humanized genetically engineered antibody according to claim 1 in killing Plutella xylostella or cotton bollworm.

5. Use of the humanized genetically engineered antibody according to claim 1 as a coating antigen in an ELISA test for non-diagnostic and therapeutic detection of Bt Cry1C toxin.

6. A recombinant expression vector, transgenic cell line or recombinant engineered bacteria containing the gene encoding the humanized genetically engineered antibody as claimed in claim 2; the cell line is a non-plant cell line.

7. The gene encoding the mutant according to claim 3, whose nucleotide sequence is shown in SEQ IN NO.

3.

8. Use of the mutant according to claim 3 in killing Plutella xylostella or cotton bollworm.

9. Use of the mutant according to claim 3 as a coating antigen in ELISA detection for non-diagnostic and therapeutic detection of Bt Cry1C toxin.

10. A recombinant expression vector, transgenic cell line or recombinant engineered bacteria containing the gene encoding the mutant according to claim 3; the cell line is a non-plant cell line.

Citation Information

Patent Citations

  • Bovine-derived reshaped antibody with insecticidal activity as well as preparation method and application thereof

    CN105131123A

  • Polypeptide for simulating general structure and function of Bt Cry toxin as well as coding gene and application of polypeptide

    CN116178512A