Aestivation radio mould and its application
By screening and optimizing the liquid fermentation process of Mucor radiata strain YZ-1, the problem of low protein production efficiency in traditional fungal protein research has been solved, realizing the production of mycelium with high protein content and the reuse of wastewater resources, thereby improving wastewater treatment efficiency.
Patent Information
- Application Number
- CN202410581074.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-05-11
- Publication Date
- 2025-11-18
- Estimated Expiration
- 2044-05-11
AI Technical Summary
In existing technologies, the production efficiency of animal and plant proteins is low, which cannot continuously meet the protein demand. Furthermore, agricultural production faces problems such as soil erosion, eutrophication, and freshwater consumption. Traditional fungal protein research mainly focuses on food fermentation rather than the development of mycelial proteins.
The *Rhizopus yazhi* strain YZ-1 was screened out. By optimizing the liquid fermentation and protein extraction processes and using soybean water as the culture medium, the extraction and component analysis of mycelial proteins were optimized, providing *Rhizopus yazhi* YZ-1 with high protein content and its applications.
It increases the amino acid content of mycelial protein, especially lysine, balances lysine-limiting proteins, reduces organic pollutants in soybean water, and promotes wastewater resource reuse and factory wastewater treatment efficiency.
Smart Images

Figure CN118931730B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to a Mucor circinodetus, in particular to a Mucor circinodetus and application thereof. BACKGROUND
[0002] The growth of the world population today increases the demand for high-quality protein. In terms of animal protein, the low efficiency of converting feed into meat and dairy products makes it impossible to sustainably meet the growing demand for protein; in terms of plant protein, current agriculture has problems such as soil erosion, eutrophication, and excessive consumption of fresh water. Fungal protein performs better than animal and plant protein in terms of land use efficiency and global warming. In recent years, researchers at home and abroad have studied a variety of microorganisms for production. When selecting microorganism species, the safety for consumption, ease of processing, production efficiency, and cost should be considered. Therefore, it is necessary to find high-quality strains.
[0003] There are not many protein-producing strains currently studied, so the main demand in today's market is to develop new protein-producing strains. Fungi are widely used in China's food industry, and traditional fermented products such as soybean paste and bean curd are produced using fungi. People have long focused their research on food fermentation rather than on mycelium itself. Therefore, screening strains with high protein content in traditional fermented foods in China is a very meaningful research direction at present.
[0004] Mao tofu is a fermented food formed by the action of protease produced by microbial growth and metabolism on tofu, and has a history of more than a thousand years in China. It is one of the Chinese traditional fermented foods. Mao tofu is not only a fermented soy food but also an intermediate product in the production of "Eastern cheese" - fermented bean curd. In addition to a large amount of free amino acids and free fatty acids, it also contains thiamine, riboflavin, and niacin, etc. It is loved by consumers because of its delicious taste, unique flavor, and rich nutrition. In the fermentation process of Mao tofu, commonly used strains include Mucor mucedo, Mucor rouxii, and Mucor circinodetus, etc. It is worth mentioning that Mucor circinodetus, as a commonly used microorganism in the production of traditional Chinese foods, not only has high safety but also has significant benefits. Its unique properties make it show broad development prospects and is worthy of further research and application.
[0005] People have long focused on the production of protease or fermented bean curd of Mucor circinelloides, instead of the production of filamentous fungal protein. Mucor circinelloides has a longer mycelium, which can form a fiber structure similar to meat structure after certain treatment. The strain in the bean curd is separated and purified, the bean water is used as a simple culture medium, the liquid fermentation process is optimized, the protein extraction process is optimized, the physicochemical and functional properties of fungal isolated protein and different protein components are explored, and the water quality of the bean water before and after fermentation is compared, so as to provide theoretical information for the filamentous fungal protein as a new type of alternative protein and the resource reutilization of soybean industrial wastewater. SUMMARY
[0006] In order to make up for the deficiencies of the prior art, the present application provides a Mucor circinelloides and application thereof.
[0007] The present application is realized by the following technical solutions:
[0008] In a first aspect, the present application provides a Mucor circinelloides, which is named Mucor circinelloides YZ-1 and has a preservation number of CGMCC No.41115, and is preserved in the General Microbiological Center of the Chinese Microorganism Strain Preservation Management Committee, located at No.3, Yitian West Road, Beichen, Chaoyang District, Beijing, China, with a postal code of 100101, and a preservation date of March 11, 2024. (Actinomucor elegans YZ-1)
[0009] Further, the Mucor circinelloides YZ-1 contains 18 kinds of amino acids, including leucine, isoleucine, lysine and tryptophan, wherein the content of lysine is 3.29 g / 100g, the total of amino acids is 31.79, the total of essential amino acids accounts for 82% of the total amino acids, the total of hydrophobic amino acids is 20.9 g / 100g, and the total of hydrophilic amino acids is 2.94 g / 100g.
[0010] Further, the Mucor circinelloides YZ-1 contains 27 mineral elements, as follows:
[0011]
[0012] Further, the C / N ratio of the fermentation liquid of the Mucor circinelloides YZ-1 is 4, which is the most economical and effective.
[0013] Further, the optimal culture conditions of the Mucor circinelloides YZ-1 are pH 5.0, liquid volume 140 mL / 250 mL, time 60 h, and rotation speed 180 rpm, and the obtained mycelium yield is 2.89 g / 140 mL.
[0014] In a second aspect, the present application provides an application of the Mucor circinelloides YZ-1, which is adding the Mucor circinelloides YZ-1 into low lysine food to balance the lysine restrictive protein.
[0015] In a third aspect, the present application provides an application of the Mucor circinelloides YZ-1, which is applying the Mucor circinelloides YZ-1 to bean water fermentation, so that the polluted organic matter in the bean water is greatly reduced, which is beneficial to the factory wastewater treatment and waste resource recycling.
[0016] Compared with the prior art, the present application has the advantages of:
[0017] 1. The present application provides a Mucor circinelloides, which is named as Mucor circinelloides YZ-1 and has a preservation number of CGMCC No.41115. (Actinomucor elegans YZ-1) The Mucor circinelloides YZ-1 is preserved in the China General Microbiological Culture Collection Center, which is located at No.3, Yuanmingyuan Road, Beijing, China, and has a postcode of 100101, and is preserved on March 11, 2024.
[0018] 2. The mycelium of the present application contains 18 kinds of amino acids, and after liquid fermentation, the mycelium has high contents of leucine, isoleucine, lysine and tryptophan. The content of lysine is 3.29 g / 100 g, which is higher than the requirement of 1.80 g / 100 g of FAO / WHO, which shows that in the subsequent development of protein substitutes, mycoprotein can be added to low lysine food to balance the lysine restrictive protein.
[0019] 3. The mycelium fermentation of the present application can greatly reduce the polluted organic matter in the bean water, which is beneficial to improving the efficiency and cost of factory wastewater treatment, and can realize the recycling of wastewater resources. BRIEF DESCRIPTION OF DRAWINGS
[0020] The present application will be further described below in combination with the drawings.
[0021] Figure 1 Fig. 1 is a colony morphology of the strain YZ-1, wherein a is the morphology of the strain cultured for 3 days, and b is the morphology of the strain cultured for 5 days;
[0022] Figure 2 Fig. 2 is the morphology of mycelium (a-c), spores (d) and sporangium (e) of the strain under a microscope, wherein (a-c) is 40X, and (d and e) is 100X;
[0023] Figure 3 Fig. 3 is the result of agarose gel electrophoresis of PCR amplification products;
[0024] Figure 4 Fig. 4 is an ITS phylogenetic tree constructed by using the NJ method;
[0025] Figure 5 Effect of C / N ratio on mycelium production;
[0026] Figure 6 Product chart of liquid fermentation under different C / N ratios;
[0027] Figure 7 Effect of pH on mycelium production;
[0028] Figure 8 Effect of pH on mycelium production;
[0029] Figure 9 Effect of inoculum on mycelium production;
[0030] Figure 10 Effect of temperature on mycelium production;
[0031] Figure 11 Effect of time on mycelium production;
[0032] Figure 12 Effect of rotation speed on mycelium production;
[0033] Figure 13 Mycelium morphology chart after drying. DETAILED DESCRIPTION
[0034] The application will be further described below in conjunction with the accompanying drawings.
[0035] Example 1
[0036] Test equipment
[0037] 1.1 Materials
[0038] The natural fermented soybean curd (Anhui) used in the test was purchased in the market.
[0039] 1.2 Culture medium
[0040] Potato dextrose agar medium (PDA): 200 g of potato, 20 g of glucose, 20 g of agar, 1000 mL of distilled water, natural pH value, and sterilized at 121°C for 30 min.
[0041] Potato dextrose liquid medium: 200 g of potato, 20 g of glucose, 1000 mL of distilled water, natural pH value, and sterilized at 121°C for 30 min.
[0042] 1.3 Reagents
[0043] Glucose and glacial acetic acid were purchased from National Pharmaceutical Group Chemical Reagent Co., Ltd. Agar was purchased from Beijing Aobosan Biotechnology Co., Ltd. D2000 DNA Marker (MD114), D2000 DNA Marker (MD114), 2x Taq PCR Mix (KT201-02), GeneRed Nucleic Acid Dye (RT211) and DNase / RNase-free Dl water (RT121) were purchased from Tiangeng Biochemical Technology (Beijing) Co., Ltd. AGAROSE G-10 Agarose was purchased from Guangzhou Sophon Biotechnology Co., Ltd. EDTA·Na2·2H2O was purchased from Beijing Zhongsheng Ruite Technology Co., Ltd. Fungal Genomic DNA Extraction Kit (D3390) was purchased from Anuo Ren (Beijing) Biotechnology Co., Ltd.
[0044] 1.4 Instruments
[0045] Autoclave (DSX-280B) Jinan Bukun Scientific Instrument Co., Ltd. Clean bench (JHT-SDC) Jinan Jikang Purification Equipment Factory Electrophoresis tank (JY-SPCT type) Beijing Junyi Oriental Electrophoresis Equipment Co., Ltd. Gel imaging system (JY04S-3C) Beijing Junyi Oriental Electrophoresis Equipment Co., Ltd. Horizontal intelligent precision shaker (BSD-WX2200) Shanghai Buxun Industry Co., Ltd. PCR instrument (OSE-GP-01) Tiangeng Biochemical Technology (Beijing) Co., Ltd. Vortex shaker (VX100) Lebert Company, USA Tabletop high-speed refrigerated centrifuge (H1650R) Xiangyi Centrifuge Instrument Co., Ltd. Metal bath (KR116) Tiangeng Biochemical Technology (Beijing) Co., Ltd.
[0046] 1.5 Research methods
[0047] 1.5.1 Isolation and purification of protein-producing strains
[0048] Isolation of fungi
[0049] 5 g of hairy tofu was weighed, crushed with a sterile pestle, and placed in a conical flask containing 50 mL of sterile water. The conical flask was shaken in a constant temperature air bath shaker for 1 h to prepare a bacterial suspension.
[0050] Primary screening of fungi
[0051] The bacterial suspension was diluted and streaked on PDA plate medium, then incubated in a 24°C incubator for 24 h. The growth of the colonies was observed. Mycelium that met the morphological characteristics of mold was selected and inoculated into potato glucose liquid medium, which was then cultured in a shaker at 160 rpm and 26°C for 24 h.
[0052] Secondary screening of fungi
[0053] The bacterial suspension in the potato glucose liquid medium was diluted and streaked on a plate, then incubated in a 24°C incubator for 48 h. The operation was repeated three times, and the last time the culture was incubated in an incubator for 3 d. The colonies with white mycelium were selected and transferred to test tube slants for incubation in an incubator for 5 d, then stored in a 4°C refrigerator.
[0054] 1.5.2 Morphological identification of protein-producing strains
[0055] The activated and purified strain was transferred to PDA plates, and cultured in a constant temperature incubator at 24°C for 5 days. Then, it was transferred to PDA plates again, and cultured in a constant temperature incubator at 24°C for 5 days. The morphology of the strain was observed and recorded, including the mycelium morphology, length, edge morphology and color. A small amount of mycelium was picked and mounted, and the mycelium morphology and spore characteristics were observed under a high-power microscope using a computer image acquisition system.
[0056] Molecular biology identification of protein-producing strains
[0057] DNA extraction
[0058] Genomic DNA was extracted according to the instructions of the Fungal Genomic DNA Extraction Kit.
[0059] PCR amplification
[0060] The IST universal primer sequence is shown in Table 1.1.
[0061] The amplification system is shown in Table 1.2.
[0062] The reaction procedure is shown in Table 1.3.
[0063] Table 1.1 ITS universal primer sequence
[0064]
[0065] Table 1.2 ITS PCR amplification system
[0066]
[0067] Agarose gel electrophoresis
[0068] A 1.0% agarose gel was prepared, and the voltage was set at 18 V / cm for electrophoresis for 20 minutes. Nucleic acid dye was used for staining, and a clear image was taken using an ultraviolet gel imaging system.
[0069] Table 1.3 PCR reaction procedure
[0070]
[0071] 1.5.3 Purification and recovery
[0072] The amplified product was recovered according to the instructions of the ordinary agarose gel DNA recovery kit, and the recovered product was sent to Qingdao Piseng Gene Technology Co., Ltd. for sequencing. The determined ITS sequence was subjected to BLAST comparison in NCBI, and the sequences with higher homology were selected to construct a phylogenetic tree in MEGA X using the Neighbor-Joining (NJ) method to determine the species relationship of the strain.
[0073] 1.5.4 Preparation of seed liquid
[0074] The purified mycelium was inoculated into 100 mL of potato dextrose liquid medium and cultured in a constant temperature culture oscillator at 26°C and 140 rpm for 12 h. 100 μL of the bacterial suspension from the liquid culture medium cultured for 12 h was inoculated into 100 mL of liquid medium, and the seed liquid was obtained by culturing in a constant temperature culture oscillator at 30°C and 140 rpm for 12 h.
[0075] 1.5.5 Determination of the C / N ratio of the medium
[0076] The C / N ratio in the soybean water was about 2.1, and the additional carbon source could make the M. elegans grow better. The dry weight of the obtained mycelium was used as an index, and the mycelial morphology after fermentation was observed and recorded. The experimental design gradient was 3, 4, 5, 6, and 7. Other liquid fermentation conditions: in a 250 mL conical flask, pH 6.0, liquid volume 120 mL, inoculation amount 6%, temperature 26°C, time 60 h, and rotation speed 160 rpm.
[0077] 1.5.6 Effect of fermentation conditions
[0078] In the single-factor experiment, the other fermentation conditions were the intermediate values except the research factors. After the mycelium was obtained after fermentation, it was placed in a forced air drying oven for low-temperature drying, and the temperature was set to 40°C. After drying, it was taken out and weighed.
[0079] Effect of pH on mycelial yield
[0080] The pH gradient was set to pH 4.0, 5.0, 6.0, 7.0, and 8.0.
[0081] Effect of liquid volume on mycelial yield
[0082] The liquid volume gradient was set to 80 mL, 100 mL, 120 mL, 140 mL, and 160 mL in a 250 mL triangular flask.
[0083] Effect of inoculation amount on mycelial yield
[0084] The inoculation amount gradient was set to 2%, 4%, 6%, 8%, and 10%.
[0085] Effect of temperature on mycelial yield
[0086] The temperature gradient was set to 22°C, 24°C, 26°C, 28°C, and 30°C.
[0087] Effect of time on mycelial yield
[0088] The fermentation time gradient was set to 48 h, 54 h, 60 h, 66 h, and 72 h.
[0089] Effect of rotation speed on mycelium yield
[0090] The rotation speed gradient was set to 120 rmp, 140 rmp, 160 rmp, 180 rmp and 200 rmp.
[0091] Table 1.4 Orthogonal test level table of mycelium protein liquid fermentation conditions
[0092]
[0093] 1.5.7 Orthogonal test of fermentation conditions
[0094] On the basis of single factor test, pH, liquid loading, time and rotation speed were comprehensively selected for the next experiment, and L9(3 4 ) orthogonal test was designed by using orthogonal assistant. The factor level design of orthogonal test is shown in Table 1.4.
[0095] Example 2
[0096] 2.1 Morphological identification and analysis of protein-producing strain
[0097] A protein-producing strain YZ-1 was obtained by isolation and purification, and the colony characteristics of the strain on PDA plate are shown in Figure 1 It can be seen that on the 3rd day, the mycelium was milk white, presented cotton-like, and yellow spores appeared at the top, and the milk white mycelium began to diffuse and grow from the center to the periphery of the culture medium. When it grew in the incubator for 5 days, it can be seen that the mycelium intertwined and covered the entire PDA culture medium, and a large number of yellow spores appeared at the top of the mycelium.
[0098] It was observed that the strain YZ-1 grew well on PDA plate, and was milk white in the early stage of culture, and the growth rate was extremely fast. When cultured for 2-3 days, yellow spores appeared at the top of the mycelium, and there was a tendency to diffuse to the periphery. Because of the fast growth rate, the colony covered the entire culture medium on the 5th day. After opening the plate, there was no peculiar smell.
[0099] Figure 2 The mycelium morphology and spore morphology of the strain under the microscope after isolation and purification. It can be seen from the figure that the strain sporangium stalk is straight, and the main branch has a larger oval-shaped spore sac at the top. After maturation, the spore sac wall is dissolved or cracked, and the collar is left after disappearance. In summary, it is preliminarily determined that the strain is a Mucorales fungus.
[0100] 2.2 Molecular biological identification and analysis of protein-producing strain
[0101] 2.2.1 Agarose gel electrophoresis results
[0102] The agarose gel electrophoresis of PCR amplification products is shown in Figure 3The left lane is Marker, and the three right lanes 1-1, 1-2, 1-3 are the PCR amplification products of the target product. As can be seen from the figure, the DNA band positions of the three parallel results are similar, the bands are clear and there is no obvious tailing phenomenon. Since the 1-3 band is brighter, the concentration is best, so 1-3 is selected for recovery and sequencing.
[0103] 2.2.2 ITS sequence results
[0104] The sequencing results are as follows:
[0105] ATATGCTTAAGTTCAGCGGGTAATCCCACCTGATTTCAGATCAAGTTGTTGAATGTTTTCTTTGGGAGGCCCCCAAGGCAATAATAAAGTTCTAGTTCGCAAGAGCTTTCGCTTGAAATTAAGAAAAAGTTCAGGCGCAATCAAACTTTGGCTTGCAGGCCTTTAGTCATTTAAAGCGTCTCCGGGCTAGAGATTTTACTTCTAAGCCAGATACCCTCAATGTCCCCTTAAGAAAAAAATCTTAAGGGAAGAGTTGTTTCTGATACTGAAACAGGCGTACCTGCTGGAATACCAGCAGGTGCAAGATGCGTTCAAAGACTCGATGATTCACTGAATATGCAATTCACACTAGTTATCGCACTTTGCTACGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTAAAAGTTGTTTTATAGGCCACCTTTCAGCGAGCCCATGTTACAATATTAATACTGAATTCATTTGGTAGAATAATTAATTTTTGGGGTACCAAGCTGAAAAAAAGTCGGCTTGACCATGGCTTCGATTAAAATCATCCTGTGCCGCCTACCCCGTATGGTGGCTCAGGCATCTCTACTAGCGCCATGCTATAAGACAGTTCACGGTAAAAAATAAGAGAAAAACCAAGCCCGTAAGCTCAGTTTCCCCTCAAGTTTTATTTAATGATCCTTCCGCAGGTTACCCTTACGGGA
[0106] 2.2.3 BLAST analysis
[0107] The ITS sequence gene of the target product measured by YZ-1 was subjected to BLAST comparison on NCBI. According to the analysis results, it can be concluded that the strain YZ-1 is closest to Actinomucor elegans, and the sequence consistency is 99.57%.
[0108] 2.2.4 Phylogenetic tree analysis
[0109] The ITS sequence of strain YZ-1 was subjected to comparison in MEGA X system software, and the results are shown in Figure 4 The phylogenetic tree was inferred by NJ method, Figure 4 and the optimal tree is shown. The percentage of repeated trees of related clade clustering in bootstrap test (1000 repetitions) is shown beside the branch. The evolutionary distance is calculated by Nei-Gojobori method, and the analysis involves 17 nucleotide sequences, with the unit of synonymous substitution per synonymous site.
[0110] As can be seen from Figure 4 , strain YZ-1 is in the same branch with 5 strains Actinomucor elegans , and the Bootstrap test value is 100, so the evolutionary relationship between strain YZ-1 and 4 strains Actinomucor elegans is reliable. This further indicates that strain YZ-1 is closest to Actinomucor elegans . Combined with the morphological characteristics of mycelial colony, the morphological characteristics of mycelium and spores under microscope and ITS sequence analysis, strain YZ-1 can be preliminarily identified as Actinomucor elegans , and it is named as Actinomucor elegans YZ-1 (Mucor circinelloides YZ-1).
[0111] In addition, it is preserved in China General Microbiological Culture Collection Center, address: No. 3, Yuanmingyuan West Road, Beijing, China Institute of Microbiology, Chinese Academy of Sciences, postcode: 100101, preservation date: March 11, 2024, preservation number: CGMCC No. 41115, named as Mucor circinelloides YZ-1 (Actinomucor elegans YZ-1) .
[0112] 2.3 C / N ratio analysis
[0113] Figure 5 The effect of different C / N ratios on the mycelial yield of YZ-1 is shown in Actinomucor elegans . It can be seen that with the increase of C / N ratio, the mycelial yield shows a trend of first increasing and then decreasing. When the C / N ratio is 2, the yield is low, and the mycelial morphology after fermentation is shown in Figure 6 a, the mycelium is white, and the surface is sticky and smooth, which may be due to the premature aging and autolysis of the mycelium in the early stage. When the C / N ratio is 4 and 6, the mycelial yield is significantly improved, and the mycelial morphology after fermentation is shown in Figure 6b and 6c, the mycelium was beige and the mycelium yield was large. When the C / N ratio was 8, the mycelium yield decreased, and the mycelium morphology after fermentation was as shown in d, the mycelium was white and the mycelium was spherical rather than filamentous. The reason for this phenomenon may be that as the C / N ratio increased, the viscosity of the fermentation broth increased, resulting in the mycelium being spherical after fermentation. Considering the mycelium yield, the morphology of the mycelium after fermentation, and the economy, the C / N ratio of 4 for liquid fermentation was selected for subsequent experiments. Figure 6 d, the mycelium was white and the mycelium was spherical rather than filamentous. The reason for this phenomenon may be that as the C / N ratio increased, the viscosity of the fermentation broth increased, resulting in the mycelium being spherical after fermentation. Considering the mycelium yield, the morphology of the mycelium after fermentation, and the economy, the C / N ratio of 4 for liquid fermentation was selected for subsequent experiments.
[0114] 2.4 Single factor analysis of fermentation conditions
[0115] 2.4.1 Effect of pH on mycelium yield
[0116] It can be seen from Figure 7 that with the increase of pH, the mycelium yield showed a trend of first increasing and then decreasing, and reached the maximum at pH 5.0, with a mycelium yield of 2.65 ± 0.03 g. In addition, it can be seen from the figure that the strain grows well in acidic fermentation broth. At the same time, the mycelium yield at pH 5.0 has a significant difference (P<0.05) compared with other conditions, so pH 5.0 is the best fermentation condition.
[0117] 2.4.2 Effect of liquid loading on mycelium yield
[0118] It can be seen from Figure 8 that with the increase of liquid loading, the mycelium yield showed a trend of first increasing and then decreasing. The amount of liquid loading affects the fermentation product, which may be related to the oxygen capacity and nutrient content. When the liquid loading is 140 mL, the maximum value of the mycelium yield is 2.87 ± 0.02 g. And the maximum value of the liquid loading has a significant difference (P<0.05) compared with other conditions, so the liquid loading of 140 mL is the best fermentation condition.
[0119] 2.4.3 Effect of inoculum size on mycelium yield
[0120] It can be seen from Figure 9 that the inoculum size has no obvious effect on the mycelium yield, and when the inoculum size is 4%, 6% and 8%, the mycelium yield is 2.50 ± 0.01 g, 2.49 ± 0.03 g and 2.53 ± 0.01 g, respectively. Too little inoculum size will prolong the fermentation time, and too large inoculum size will cause the growth of mycelium to be too fast, resulting in an increase in old cells in the later stage. Therefore, 4% inoculum size is selected as the fermentation condition of this experiment.
[0121] 2.4.4 Effect of temperature on mycelium yield
[0122] It can be seen from Figure 10It can be seen that mycelial yield increases from 22℃ to 24℃ and then plateauses, before slightly decreasing after 28℃. Temperature is a key factor in liquid fermentation, directly affecting microbial growth, metabolism, and product yield. However, the experimental results show... Actinomucor elegans YZ-1 is not sensitive to temperature changes, and its mycelial yield does not change significantly with temperature increases or decreases. Therefore, from an environmental protection perspective, this experiment chose 26℃.
[0123] 2.4.5 Effect of time on mycelial yield
[0124] Depend on Figure 11 It can be seen that mycelial yield increases with fermentation time. The fermentation time directly affects the yield of fermentation products. In the early stage of fermentation, the strain is in the adaptation period, and the mycelial yield is low. After fermentation time exceeds 48 hours, the mycelial growth reaches its peak, reaching its maximum at 60 hours, with a maximum value of 2.64 ± 0.02 g. Then, as the fermentation time continues to extend, the mycelial yield shows a decreasing trend; because in the later stage of fermentation, the mycelium enters the cell death phase. Therefore, a fermentation time of 60 hours is the optimal condition.
[0125] 2.4.6 Effect of Rotation Speed on Mycelial Yield
[0126] Depend on Figure 12 It can be seen that as the shaking speed increases, the mycelial yield first increases and then decreases. The shaking speed has a significant impact on the fermentation process; at low speeds, low oxygen levels and microbial hypoxia lead to lower yields. The mycelial yield reaches its maximum at 160 rpm, with a maximum value of 2.63 ± 0.01 g. However, as the shaking speed increases, the mycelial yield gradually decreases. This phenomenon may be due to the increased friction and shear forces at higher speeds, which are detrimental to the accumulation of mycelial yield. Therefore, a shaking speed of 160 rpm is the optimal condition.
[0127] 2.6.7 Analysis of Orthogonal Experiment Results
[0128] After single-factor experimental analysis, pH (X1), liquid volume (X2), time (X3) and rotation speed (X4) were selected as factors in the orthogonal experiment. The optimal combination was screened with mycelial yield as the indicator. The results of the orthogonal experiment are shown in Table 2.1.
[0129] As shown in Table 2.1, the range analysis results indicate that the influence of the four factors at different ratios is as follows: pH (X1) > rotation speed (X4) > liquid volume (X2) > time (X3). Therefore, the factor with the greatest influence has the greatest impact on mycelial yield in liquid fermentation. The optimal combination of fermentation processes determined by the orthogonal experiment is X. 12 X 22 X 32 X 43, the optimal conditions were pH 5.0, liquid volume 140 mL, time 60 h, and rotation speed 180 rpm. Since the optimal fermentation conditions obtained in theory were not in the orthogonal test table, they were verified. After verification, the mycelium yield of X 12 X 22 X 32 X 43 was 2.89 g / 140 mL, which was 6.25% higher than the mycelium yield of X 12 X 22 X 32 X 41 was 2.72 g, verifying the correctness of selecting the optimal fermentation conditions.
[0130] Table 2.1 Factors affecting the mycelium yield of YZ-1 Actinomucor elegans Orthogonal test results of the mycelium yield of YZ-1
[0131]
[0132] Example 3
[0133] Analysis of the composition of mycelium and the composition of soybean whey after liquid fermentation
[0134] 3.1 Test materials
[0135] The mycelium collected after the liquid fermentation optimization of Example 1 and the fermented soybean whey (without additional carbon source).
[0136] 3.2 Reagents
[0137] Methanol (chromatographically pure) was purchased from Thermo Fisher Scientific (China) Co., Ltd., formic acid (chromatographically pure) was purchased from Sigma Company of the United States, and nitric acid was purchased from National Pharmaceutical Group Chemical Pharmaceutical Co., Ltd.
[0138] 3.3 Instruments
[0139] LC-MS / MS (U3000-TSQ Quantiva) Thermo Fisher Scientific Centrifuge (5424R) Eppendorf Vortex shaker (Vortex-6) Qilinbel Instrument Manufacturing Company Ultrasonic cleaner (KQ5200E) Kunshan Sumu Ultrasonic Instrument Co., Ltd. Constant temperature shaker (THZ) Shanghai Buxun Industry Co., Ltd. Soxhlet extractor Hainuo Future Technology Group Co., Ltd. Automatic Kjeldahl nitrogen determination instrument Hainuo Future Technology Group Co., Ltd.
[0140] 3.4 Research methods
[0141] 3.4.1 Approximate analysis of mycelium composition
[0142] The moisture content was determined according to GB 5009.3-2016, the crude protein content was determined according to GB 5009.5-2016, the crude fat content was determined according to GB / T 15674-2009, and the crude ash content was determined according to GB 5009.4-2016.
[0143] 3.4.2 Determination of the amino acid content of mycelium
[0144] Take about 0.1 g of sample, add 1.0 mL of ultrapure water, vortex, ultrasonic for 60 min, add 700 μL of dichloromethane, vortex, centrifuge at 13000 rpm for 5 min, take the upper water phase, filter through a 0.22 μm filter membrane, and detect on the instrument. Liquid chromatography uses a Hypersil Gold C18 chromatographic column (100 mm x 2.1 mm, 3.5 μm); the column temperature is 40℃; the mobile phase A is 0.1% (v / v) formic acid aqueous solution; the mobile phase B is methanol; the flow rate is 0.2 mL / min; the injection volume is 3 μL, and the gradient elution program is 0~0.5 min, 4% B; 0.5~2.5 min, 4% B~35% B; 2.5~4.5 min, 35% B~77% B; 4.5~6.5 min, 77% B~100% B; 6.5~6.6 min, 100% B~4% B; 6.6~10 min, 4% B. The mass spectrometry analysis conditions are set as follows: the ion source uses ESI+ mode, the spray voltage is set to 3500V, the sheath gas flow is 35 Arb, and the auxiliary gas flow is 10 Arb. In addition, the atomization temperature is set to 275℃, and the ion transmission tube temperature is controlled at 325℃.
[0145] 3.4.3 Mycelial mineral element determination
[0146] During the preparation of microwave digestion, 0.2 g to 0.5 g of solid sample is accurately weighed (accurate to 0.001 g), and then the sample is placed in the inner tank of the microwave digestion. Add 5 mL~10 mL of nitric acid, cover and place for 1 h or overnight for digestion. After cooling, take it out, slowly open the tank cover to exhaust, rinse the inner cover with a small amount of water, place the digestion tank on a temperature-controlled hot plate or an ultrasonic water bath, heat at 100℃ for 30 min or ultrasonic degassing for 2 min - 5 min, and then use water to dilute to 25 mL or 50 mL, mix well, and use as needed. At the same time, a blank test is performed.
[0147] 3.4.4 Determination of bean water index
[0148] The pH value of the bean water before and after fermentation is determined by a laboratory pH meter; the determination of crude protein content is performed according to the method of 6.3.1; the determination of crude fat content is performed by alkaline ethanol extraction method; the determination of soluble solids content is performed by a handheld refractometer; the determination of COD content is performed according to GB 11914-89; the determination of BOD5 content is performed according to HJ 505-2009; and the determination of residual sugar content is performed by 3,5-dinitrosalicylic acid (DNS) method.
[0149] Example 4
[0150] 4.1 Mycelial component analysis
[0151] Actinomucor elegans YZ-1 effectively utilized the nutrients in the soybean water under the optimal liquid fermentation conditions, and the mycelium proliferated in large quantities and obtained a large amount of mycoprotein. As can be seen from Table 4.1, the moisture content of the mycelium was 5.61 ± 0.23%, the crude protein content was 29.78 ± 0.67%, the crude fat content was 7.83 ± 0.12%, and the ash content was 5.24 ± 0.08%. At the same time, as shown in Table 4.1, the dried mycelium was milky white and had a faint aroma. Figure 13
[0152] Table 4.1 Mycelium composition table
[0153]
[0154] 4.2 Analysis of mycelium amino acid composition
[0155] After determination, the mycelium contained 18 kinds of amino acids. As can be seen from Table 4.2, the amino acid content of the mycelium after liquid fermentation was high, including leucine, isoleucine, lysine and tryptophan. Among them, the content of lysine was 3.29 g / 100g, which was higher than the requirement of 1.80 g / 100g of FAO / WHO, which indicated that in the subsequent development of protein substitutes, mycoprotein could be added to low-lysine foods to balance the lysine-limited proteins. In addition, the total sum of amino acids was 31.79, which was lower than other proteins, but the total sum of essential amino acids (lysine, tryptophan, phenylalanine, methionine, threonine, isoleucine, leucine, and tyrosine) accounted for a high proportion of 82% of the total amino acids. The total sum of hydrophobic amino acids was 20.9 g / 100g, and the total sum of hydrophilic amino acids was 2.94 g / 100g.
[0156] Table 4.2 Amino acid types and contents of mycelium
[0157]
[0158] 4.3 Mycelium mineral analysis
[0159] The mineral element content of the mycelium is shown in Table 4.3. The mycelium contained 27 mineral elements.
[0160] For constant element analysis, the Ca content of mycelium was 10.7277 g / kg, lower than chicken meal (14.4310 g / kg), about 5.47 times of soybean protein concentrate (1.9603). The K content of mycelium was 10.3339 g / kg, lower than soybean protein concentrate (16.3481 g / kg), about 2.37 times of chicken meal (4.3480 g / kg). The Mg content of mycelium was 1.8700 g / kg, slightly higher than chicken meal (1.2820 g / kg). The Na content of mycelium was 0.3879 g / kg, much lower than chicken meal (3.4992 g / kg). Compared with plant protein (soybean protein concentrate), the calcium content of mycelium was high; compared with animal protein (chicken meal), the K and Mg contents of mycelium were high, and the Na content was low.
[0161] For heavy metal element analysis, the Pb content of mycelium was 0.3290 mg / kg, the Cr content was 1.4400 mg / kg, the Cd content was 0.0289 mg / kg, the As content was 0.1800 mg / kg, and the Hg content was 0.0022 mg / kg. From the above data, it can be seen that the heavy metal content in mycelium does not exceed the standard.
[0162] For trace element analysis, mycelium contains rich elements such as Fe, Mn and Zn. Among them, the content of Fe was 165.8597 mg / kg, the content of Mn was 46.7362 mg / kg, and the content of Zn was 143.6718 mg / kg.
[0163] Table 4.3 Mineral element content of mycelium
[0164]
[0165] 4.4 Comparison of compositions before and after fermentation of soybean water
[0166] The comparison of compositions before and after fermentation of soybean water is shown in Table 4.4. As can be seen from the table, the contents of crude protein, crude fat and reducing sugar of soybean water before fermentation were 0.72 ± 0.10%, 1.12 ± 0.30% and 1.41 ± 0.23% respectively, and the contents after fermentation were 0.23 ± 0.08%, 0.64 ± 0.11% and 0.17 ± 0.05% respectively. By comparison, it can be found that the contents of each nutrient component before and after fermentation decreased by 68.06%, 42.86% and 87.94% respectively, which indicates that Actinomucor elegansYZ-1 utilizes the nutrients in soybean water. The soluble solids content decreases before and after fermentation, and the pH value gradually changes from acidic to neutral. Notably, the COD and BOD5 levels before fermentation were 65480.45 mg / L and 21634.95 mg / L, respectively, while after fermentation they were 34556.78 mg / L and 10653.92 mg / L, representing reductions of 47.22% and 50.76% respectively. This indicates that fermentation can significantly reduce organic pollutants in soybean water, which is beneficial for improving the efficiency and cost of factory wastewater treatment, while also enabling wastewater resource reuse.
[0167] Table 4.4 Comparison of components before and after fermentation of soybean water
[0168]
[0169] This embodiment first determined the mycelial composition, amino acid composition, and mineral elements obtained under optimal fermentation conditions. The results showed that the mycelium had high crude protein and crude fat content, was milky white, and odorless. The mycelium was found to contain high levels of leucine, isoleucine, lysine, and tryptophan, with essential amino acids accounting for 82% of the total amino acids, indicating a rich amino acid composition. The mycelium also exhibited a rich variety of minerals. Compared to soybean protein concentrate, the mycelium had a higher Ca content; compared to chicken meal, it had higher K and Mg content and a lower Na content. Furthermore, the mycelium had high levels of Fe, Mn, and Zn, at 165.8597 mg / kg, 46.7362 mg / kg, and 143.6718 mg / kg, respectively. Additionally, the nutrient and organic pollutant content of the soybean water was significantly reduced after liquid fermentation, which is beneficial for factory wastewater treatment and the reuse of waste resources.
Claims
1. An elegant type of *Mucor*, characterized in that: Its accession number is CGMCC No. 41115, and it is named *Mucor radiata* YZ-1. (Actinomucor elegans YZ-1) It is deposited at the China General Microbiological Culture Collection Center, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, China, 100101, China, on March 11, 2024.
2. The application of *Rhizopus radiata* YZ-1 as described in claim 1, wherein the application is: adding it to low-lysine foods to balance lysine-limiting proteins.
3. The application of *Rhizopus radiata* YZ-1 as described in claim 1, wherein the application is: applying it to soybean water fermentation, which significantly reduces the amount of polluting organic matter in the soybean water, which is beneficial to factory wastewater treatment and the reuse of waste resources.
Citation Information
Patent Citations
Actinomucor elegans strain, application of actinomucor elegans strain, actinomucor elegans preparation, fermented red beancurd and preparation method of fermented red beancurd
CN112251361A
Fermented bean curd mucor with low white spot rate and application thereof
CN112375690A