Gene promoter and its application

Abstract

The present application relates to the technical field of Bacillus subtilis, and specifically to a promoter of a gene and its application. The promoter can initiate gene transcription, translation and expression in Bacillus subtilis in an inducer environment, and can achieve strict regulation. The background level of the promoter is extremely low, and the range of adding IPTG inducer exceeds 2000 times. This enables the promoter to provide a very advantageous tool for fine regulation of target gene expression in Bacillus subtilis.

Description

Technical Field

[0001] The present application relates to the technical field of Bacillus subtilis, and in particular to a gene promoter and application thereof. Background Art

[0002] As a model strain of Gram-positive bacteria, Bacillus subtilis has the characteristics of clear genetic background, simple genetic manipulation, strong protein secretion ability, large-scale fermentation process, etc. It is a recognized safe microorganism and has a wide range of industrial applications. Its products cover various fields such as food and medicine. It is an ideal bacterial "factory" for the production of various enzymes and recombinant proteins and has high application value.

[0003] The efficient expression of foreign proteins in Bacillus subtilis is an important way to achieve its industrial application. One of the main strategies for expressing foreign proteins is to construct an expression system with a strong promoter. The promoter is a DNA sequence that RNA polymerase recognizes, binds to and starts transcription, which controls the start time and extent of gene transcription. The regulation of bacterial gene expression mainly occurs at the transcription level, and the promoter is a key element in transcriptional level regulation. The strength of the promoter directly affects the expression level of the gene. With the development of synthetic biology and metabolic engineering, promoters of different strengths are needed to more finely regulate the target gene, so as to achieve the balance of intermediate metabolites, improve the expression of the target product, and enable it to be used on a large scale in cell factories and enzyme catalysis. Therefore, the use of strong and controllable promoters has become one of the key factors for the efficient expression of foreign proteins. In addition, in the field of basic research, the physiological function of the target gene can be effectively studied by perturbing the expression of the target gene using finely regulated promoter elements. Summary of the invention

[0004] The inventors of the present application provide a gene promoter and its application. The promoter can initiate gene transcription, translation and expression in Bacillus subtilis in an inducer environment and can achieve strict regulation. The background level of the promoter is extremely low, exceeding 2000 times the range of adding IPTG inducer. This enables the promoter to provide a very advantageous tool for fine regulation of target gene expression in Bacillus subtilis.

[0005] To this end, the embodiments of the present application disclose at least the following technical solutions:

[0006] In a first aspect, the embodiments disclose a promoter, the nucleotide sequence of which is shown in SEQ ID NO:1.

[0007] In a second aspect, the embodiments disclose a nucleic acid molecule comprising the promoter described in the first aspect.

[0008] In a third aspect, the embodiment discloses an operon comprising the nucleic acid molecule of the second aspect, wherein the nucleic acid molecule is chimerically linked to a heterologous nucleic acid molecule.

[0009] In some embodiments, the heterologous nucleic acid molecule encodes a protein or peptide.

[0010] In a fourth aspect, the embodiments disclose a vector comprising the nucleic acid molecule described in the second aspect.

[0011] In a fifth aspect, the embodiments disclose a host comprising the vector of the fourth aspect, wherein the host comprises Bacillus subtilis and / or Escherichia coli.

[0012] In a sixth aspect, the embodiments disclose the use of the promoter described in the first aspect and / or the nucleic acid molecule described in the second aspect in expressing proteins or peptides. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 The schematic diagram is a structure diagram of pHT01-P1-lacZ, pHT01-P2-lacZ, pHT01-P3-lacZ or pHT01-P4-lacZ plasmid. The plasmid has a lacI repressor protein gene. When the inducer is not present, the LacI repressor protein binds to the lacO operator gene to inhibit the transcription of downstream genes; when the inducer IPTG is present, IPTG binds to the repressor protein to promote the transcription of downstream genes.

[0014] Figure 2 This is a schematic diagram of the process of constructing plasmid pHT01-P1-lacZ from plasmid pHT01-P2.

[0015] Figure 3 This is a schematic diagram of the process of constructing plasmid pHT01-P2-lacZ from plasmid pHT01-P2.

[0016] Figure 4 This is a schematic diagram of the process of constructing plasmid pHT01-P3-lacZ from plasmid pHT01-P2-lacZ.

[0017] Figure 5 This is a schematic diagram of the process of constructing plasmid pHT01-P4-lacZ from plasmid pHT01-P2-lacZ.

[0018] Figure 6 The transcription activities of the four promoters under different IPTG concentrations. Figure 6 A is the P2 promoter; Figure 6 B is P3 promoter; Figure 6 C is the P4 promoter; Figure 6 D is the P1 promoter; Figure 6 E and Figure 6 F is the comparison of the strength of four promoters. DETAILED DESCRIPTION

[0019] In order to make the purpose, technical scheme and advantages of the present application clearer, the present application is further described in detail below in conjunction with the examples. It should be understood that the specific embodiments described herein are only used to explain the present application and are not intended to limit the present application. The reagents not described separately in detail in the present application are all conventional reagents and can be obtained from commercial channels; the methods not described in detail are all conventional experimental methods and can be obtained from the prior art.

[0020] The embodiment discloses a promoter, the nucleotide sequence of which is shown in SEQ ID NO: 1 (P1).

[0021] As a DNA molecule, the promoter can be prepared by a known biological synthesis method (such as PCR) or a chemical synthesis method. In order to verify the advantages of the promoter provided by the present application, the present application also provides a P2 promoter such as SEQ ID NO.2, a P3 promoter such as SEQ ID NO.3, and a P4 promoter such as SEQ ID NO.4. Plasmids carrying these promoters-lacZ will be constructed, and these plasmids will be respectively transferred into Bacillus subtilis to analyze the expression of the lacZ gene.

[0022] 1. Construction of pHT01-P2-lacZ plasmid

[0023] Figure 3 The schematic diagram of the structure of the plasmid pHT01-P2 (such as SEQ ID NO.6) is shown, wherein the promoter is IPTG-inducible and has a lacI repressor protein gene on it. The lacZ gene fragment is connected to the pHT01-P2 vector by enzyme digestion and ligation, and Escherichia coli DH5α is transformed, positive colonies are screened and identified, and pHT01-P2-lacZ plasmid is extracted from the positive colonies. The specific construction process of the pHT01-P2-lacZ plasmid includes:

[0024] Using the genome of Escherichia coli K-12MG1655 strain (Yale University Escherichia coli Genetic Collection Center CGSC) as a template, primers were designed for PCR amplification to obtain the lacZ gene fragment (such as SEQ ID NO.5). The primer pair is (the underlined part is the restriction site sequence): lacZ-BamHI-F:GTCAC GGATCC ATGACCATGATTACGGATTC (such as SEQ ID NO.7) and lacZ-SmaI-R:GTCAC CCCGGG TTATTTTTGACACCAGACCAA (such as SEQ ID NO. 8).

[0025] The PCR reaction system contains 22 μL 1.1×S4 Fidelity PCR mix (Cat. No.-Specification: SF212-5×1.125mL, Beijing GenesandBiotech), 1 μL 10 μM lacZ-BamHI-F, 1 μL 10 μM lacZ-SmaI-R, and 1 μL template in 25 μL. The PCR amplification system includes: pre-denaturation at 98°C for 3 min, denaturation at 98°C for 15 s, annealing at 55°C for 15 s, extension at 72°C for 10-15 s / kb, and final extension at 72°C for 3 min. After the PCR is completed, DNA electrophoresis is performed for verification, and after verification is correct, DNA is recovered to obtain the lacZ fragment.

[0026] The lacZ fragment and the vector pHT01-P2 were digested with the same restriction endonuclease and digested in a water bath at 37°C for 1 hour. The lacZ fragment digestion reaction system contained 10 μL lacZ, 3 μL FastDigest Green buffer (Cat. No.-Specification: B72-5×1ml, Thermo Scientific), 1 μL FastDigest BamHI (Cat. No.-Specification: FD0054-800 reactions, Thermo Scientific), 1 μL FastDigest SmaI (Cat. No.-Specification: FD0663-100 reactions, Thermo Scientific) and the balance of double distilled water in 30 μL. The pHT01-P2 digestion reaction system contained 3 μL pHT01-P2, 3 μL FastDigest Green buffer, 1 μL FastDigest BamHI, 1 μL FastDigest SmaI and the balance of double distilled water in 30 μL. The digested product was verified by DNA electrophoresis, and after verification, DNA gel recovery was performed to obtain the digested lacZ fragment and the digested plasmid pHT01-P2.

[0027] The digested lacZ fragment was ligated with the digested plasmid pHT01-P2 using T4 ligase for 2 hours. The ligation reaction system contained 6.5 μL lacZ, 2 μL pHT01-P2, 1 μL T4 buffer (Cat. No. - Specification: B69-1.5mL, Thermo Scientific), 0.5 μL T4 ligase (Cat. No. - Specification: EL0011-1,000 units, Thermo Scientific) and the balance double distilled water in 10 μL.

[0028] The enzyme-linked product was directly transformed into Escherichia coli DH5α commercial competent cells and screened using ampicillin (100 μg / mL) and X-gal (5-bromo-4-chloro-3-indolyl-β-D-galactoside) resistance plates. The next day, single colony PCR was picked to verify the positive clones on the plate. After overnight culture, the plasmids with band sizes consistent with the expected ones were extracted and sequenced for verification.

[0029] like Figure 3 As shown, plasmid pHT01-P2-lacZ was extracted and recovered from the culture fluid of the verified positive clone.

[0030] 2. Construction of pHT01-P3-lacZ and pHT01-P4-lacZ plasmids

[0031] like Figure 4 and 5 As shown, the synthesized P4 promoter fragment and P3 promoter fragment were connected to the obtained pHT01-P2-lacZ plasmid by enzyme digestion and ligation to obtain pHT01-P3-lacZ and pHT01-P4-lacZ plasmids. The specific construction process includes:

[0032] The P4 promoter, P3 promoter and vector pHT01-P2-lacZ were digested with the same restriction endonuclease, and digested in a water bath at 37°C for 1 hour. The enzyme digestion reaction system of the fragment contained 10 μL P3 or P4, 3 μL FastDigestGreenbuffer (Cat. No.: B72-5×1ml, Thermo Scientific), 1 μL FastDigest KpnI (Cat. No.: FD0524-300 reactions, Thermo Scientific), 1 μL FastDigest BamHI (Cat. No.: FD0054-800 reactions, Thermo Scientific) and the balance of double distilled water in 30 μL. The enzyme digestion reaction system of pHT01-P2-lacZ contained 3 μL pHT01-P2-lacZ, 3 μL FastDigest Greenbuffer, 1 μL FastDigestKpnI, 1 μL FastDigest BamHI and the balance of double distilled water in 30 μL. The enzyme-digested products were verified by DNA electrophoresis. After verification, DNA gel recovery was performed to obtain the enzyme-digested P3 promoter fragment, P4 promoter fragment and enzyme-digested plasmid pHT01-P2-lacZ.

[0033] The P3 promoter fragment and P4 promoter fragment were ligated with the restriction plasmid pHT01-P2-lacZ using T4 ligase for 2 hours. The ligation reaction system contained 6.5 μL P3 or P4, 2 μL pHT01-P2-lacZ, 1 μL T4 buffer (Cat. No.: B69-1.5mL, Thermo Scientific), 0.5 μL T4 ligase (Cat. No.: EL0011-1,000 units, Thermo Scientific) and the balance double distilled water in 10 μL.

[0034] The enzyme-linked product was directly transformed into Escherichia coli DH5α commercial competent cells and screened using ampicillin (100 μg / mL) and X-gal (5-bromo-4-chloro-3-indolyl-β-D-galactoside) resistance plates. The next day, single colony PCR was picked to verify the positive clones on the plate. After overnight culture, the plasmids with band sizes consistent with the expected ones were extracted and sequenced for verification.

[0035] Plasmids pHT01-P4-lacZ and pHT01-P3-lacZ were extracted and recovered from the culture fluid of the verified positive clones.

[0036] 3. Construction of pHT01-P1-lacZ plasmid

[0037] like Figure 2 As shown, pHT01-P1-spc R The plasmid and lacZ gene fragment were digested with BamHI / SmaI endonucleases and then ligated with T4 ligase to obtain pHT01-P1-lacZ plasmid. The specific construction process refers to the construction of pHT01-P2-lacZ plasmid.

[0038] Among them, pHT01-P1-spc R Plasmid map Figure 2 As shown in (SEQ ID NO: 9), the plasmid was constructed based on the pHT01-P2 plasmid, in which the P1 promoter replaced the P2 promoter, the spectinomycin resistance gene (spc R ) replaced the chloramphenicol resistance gene (cm R ). A gene relA D264G is inserted between the BamHI / SmaI restriction sites. This gene is the guanosine tetra(penta)phosphate hydrolyzing / synthesizing enzyme gene of Bacillus subtilis 168.

[0039] 4. Positive transformants

[0040] The plasmids pHT01-P1-lacZ, pHT01-P2-lacZ, pHT01-P3-lacZ and pHT01-P4-lacZ were respectively transferred into the wild-type strain of Bacillus subtilis 168, and the positive transformants B.s168 (pHT01-P2-lacZ), B.s168 (pHT01-P3-lacZ) and B.s168 (pHT01-P4-lacZ) were screened on chloramphenicol-resistant plates; the transformant Bs 168 (pHT01-P1-lacZ) was screened on spectinomycin-resistant plates. The screened positive clones were activated in LB liquid culture medium with chloramphenicol resistance or spectinomycin resistance, and then maintained in glycerol.

[0041] 5. Transcriptional activity detection

[0042] The positive transformants B.s168(pHT01-P1-lacZ), B.s168(pHT01-P2-lacZ), B.s168(pHT01-P3-lacZ), and B.s168(pHT01-P4-lacZ) were activated in LB plus erythromycin (2 μg / mL) and LB plus spectinomycin (100 μg / mL), respectively, and then the LacZ activity of the promoter was determined under the culture conditions of glucose plus casein hydrolysate.

[0043] Bacterial culture method: Pick a fresh single clone and inoculate it into 2 mL LB liquid medium plus erythromycin or 2 mL LB liquid medium plus spectinomycin, and culture it in a shaking incubator at 37°C and 200 rpm as a seed culture; take the seed culture and centrifuge it at 12000 rpm for 2 minutes, remove the supernatant, resuspend the precipitate with sterile water, and transfer it to C-restricted medium (the main components refer to J Bacteriol 190:3557-3564 (2008), containing 20 mM NH 4 Cl as nitrogen source; carbon source is 0.4% glucose plus 0.4% casein hydrolysate) overnight culture as pre-culture. The next day, the pre-culture was inoculated into the same C-restricted medium to make its OD 600 The concentration of IPTG was set to 0mM, 0.05mM, 0.1mM, 0.2mM, 0.5mM, and 1mM, which is called experimental culture. The OD of bacteria was measured by spectrophotometer. 600 .

[0044] Method for determining LacZ activity: When OD 600When ≈1.0, 3-4 samples of 0.5 mL were collected at each IPTG concentration, quickly frozen in liquid nitrogen, and stored in a -80°C refrigerator. The activity of LacZ was determined at 37°C using a conventional ONPG assay method (see Nature. 2013, 500(7462):301-6). 0.9 mL of Z-buffer (1 mL of Z-buffer contains 27 μL of β-mercaptoethanol) was added to the reaction tube, and 25 μL of 0.1% sodium dodecyl sulfate, 50 μL of chloroform, and 0.1 mL of sample were added to each reaction tube; the reaction tube was vortexed for 10 seconds in the first round and 20 seconds in the second round, and then incubated in a 37°C constant temperature water bath for 15 minutes; 200 μL of 4 mg / mL ONPG was added to each reaction tube, vortexed to mix, and the reaction start time was recorded; the reactants were observed until a distinct yellow color appeared, and 0.5 mL of 1 M sodium carbonate was added to terminate the reaction, and the reaction termination time was recorded; finally, the reaction solution was centrifuged at 12000 rpm for 10 minutes, and the OD was measured using a spectrophotometer. 420 0.02 mL of the samples at 0.1 mM, 0.2 mM, 0.5 mM, and 1 mM were diluted to 0.5 mL using Z-buffer plus β-mercaptoethanol, and then 0.1 mL was taken for determination according to the above steps.

[0045] The transcription activity obtained (unit: U / mL = OD 420 / min / mL) and the corresponding OD 600 The ratio is the "LacZ expression level" (unit: U / ml / OD 600 , or "Miller Unit" or "MU"). The LacZ activity at each IPTG concentration was biologically replicated three times. Table 1 shows the promoter activity of the four promoters with and without the addition of 1 mM IPTG. The expression control range is the ratio of the promoter activity of 1 mM IPTG to the transcriptional activity of the promoter without the addition of IPTG.

[0046] Table 1 Transcriptional activity of LacZ

[0047] Promoter Add inducer (1mMIPTG) No inducer added Expression control range P2 825.17±89.87 4.91±0.73 168.06 P3 743.17±119.80 2.90±0.24 256.27 P4 2330.49±281.03 203.36±16.32 11.46 P1 2550.06±50.20 0.96±0.03 2656.31

[0048] The promoter activity results of the four constructed Bacillus subtilis lacZ reporter gene strains are shown in Figure 6 From the perspective of induction, the strength of the two promoters P4 and P1 is greater than that of the two promoters P2 and P3; from the perspective of stringency control, the stringency of P1 is better, the expression level is very low when no inducer is added, and the expression intensity increases after the addition of inducer, and the expression difference range is 2600, as shown in Table 1.

[0049] The above is only a preferred specific implementation of the present application, but the protection scope of the present application is not limited thereto. Any changes or substitutions that can be easily conceived by any technician familiar with the technical field within the technical scope disclosed in the present application should be covered within the protection scope of the present application.

Claims

1. A promoter, the nucleotide sequence of which is shown in SEQ ID NO:

1. A nucleic acid molecule comprising the promoter according to claim 1.

3. An operon comprising the nucleic acid molecule of claim 2, wherein the nucleic acid molecule is chimerically linked to a heterologous nucleic acid molecule.

4. The operon of claim 3, wherein the heterologous nucleic acid molecule encodes a protein or a peptide.

5. A vector comprising the nucleic acid molecule of claim 2.

6. A host comprising the vector according to claim 5, wherein The host includes Bacillus subtilis and / or Escherichia coli.

7. Use of the promoter according to claim 1 or the nucleic acid molecule according to claim 2 in expressing a protein or a peptide.

Images