A SNP molecular marker rs640930109 related to growth traits of goats and application thereof
By detecting the goat SNP locus rs640930109, combined with PCR primers and MassARRAY mass spectrometry, the shortcomings in the genetic improvement of goat growth traits were addressed, enabling rapid and low-cost detection of growth traits and breeding enhancement.
Patent Information
- Application Number
- CN202411283751.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-13
- Publication Date
- 2025-11-21
- Estimated Expiration
- 2044-09-13
AI Technical Summary
Current research on the genetic variation of the TAOK3 gene in goats is insufficient, and there are few reports on the application of related SNP markers in economic traits of goats. Furthermore, the types of associated traits are limited, which has affected the progress of genetic improvement of growth traits in goats.
Using a combination of direct sequencing and MassARRAY mass spectrometry, PCR primer pairs and single-base extension primers were designed to detect the polymorphism of the SNP site rs640930109 in the goat genome, and molecular markers that significantly affect the growth traits of goats were screened out for selection-aided breeding.
It enables rapid, low-cost, and accurate detection of goat growth traits, improves the efficiency of genetic improvement of goat growth traits, and promotes the development of the local goat industry.
Smart Images

Figure CN118932084B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of biotechnology and livestock breeding, and particularly relates to a SNP molecular marker rs640930109 on goat chromosome 17 TAOK3 gene associated with growth traits and application thereof. BACKGROUND
[0002] Single nucleotide polymorphisms (SNPs) are nucleotide variations at specific positions in the genome, which are caused by a single nucleotide change, and are the simplest and most common type of heritable variation in livestock and poultry (Sacks, Lounsberry et al., 2021). Growth traits are extremely complex quantitative traits, which usually include body height, body length, body weight, average daily gain and carcass weight, and are controlled by micro-effect polygenes, and have a direct impact on the benefits of the mutton industry. Therefore, SNPs can be used as the preferred tool for goat molecular breeding, gene mapping, population evolution and other research. Haimen goat is a local goat breed in Jiangsu, which has high-quality fur and meat, and is a special product of Haimen District, Nantong City, and is also one of the national livestock and poultry resources protection varieties. Haimen goat has strong environmental adaptability, early maturity, multiple births and strong reproductive ability, and is an ideal object for improving local breeds. With the help of modern selection breeding technology, by adding molecular markers with significant effects to marker associated selection (MAS) and genomic selection (GS), the genetic improvement progress of growth traits of Haimen goat can be significantly improved, and the meat production of offspring goats can be improved, thereby promoting the efficient development of local goat industry in China.
[0003] At present, there have been many research reports on SNPs of different livestock animals and their effects on economic traits of livestock animals (including growth, meat traits, etc.). For example, the genetic variation sites of Prox1 gene promoter g.-930bp, g.-1421bp and g.-1573bp in pigs are significantly related to meat quality traits. In Jianzhou big-eared sheep, multiple SNPs in the CKMT2 gene were found to be significantly related to body length and body height of goats (CN 117987518 A). However, there is a lack of research on genetic variation of goat TAOK3 gene, and the function of this gene site in goat growth and development is still blank. In addition, there are few reports on the application of SNP markers in marker assisted selection of goat economic traits, and the related molecular markers have the disadvantages of single type of associated traits (for example, CN112176076A, CN 116004841A, CN 117385047A, etc.).
[0004] Protein kinases TAOKs (thousand and one amino acid protein kinases) are members of the serine / threonine protein kinase family, a kind of protein kinase closely related to cytoskeleton stability, and are widely expressed in various cells and tissues. As an upstream kinase of the mitogen-activated protein kinase (MAPK) cascade, TAOKs regulate important physiological and pathological responses in cells and tissues through p38 MAPK and JNK / SAPK signaling pathways, and are involved in cell mitosis and apoptosis and other life processes. Studies have reported that TAOK3 is related to obesity in mice and humans (Maes B, Fayazpour F, et al., 2023), and TAOK3 knockdown mice exhibit reduced bone mass and insufficient occipital bone mineralization (Li Z, Oh H, et al., 2020).
[0005] Currently, there is no report on the association between the goat rs640930109 molecular marker and growth traits. SUMMARY
[0006] The purpose of the present application is to provide a detection method for goat SNP site rs640930109 and its application, which can quickly establish a goat population with excellent genetic resources, and is conducive to accelerating the breeding of fine livestock breeds.
[0007] In order to achieve the above-mentioned purpose, the present application adopts the following technical solutions:
[0008] In the first aspect, the present application claims the application of a substance for detecting the polymorphism or genotype of SNP site rs640930109 in the goat genome in any of the following:
[0009] (a1) application in identifying or assisting in identifying goat growth traits;
[0010] (a2) application in preparing products for identifying or assisting in identifying goat growth traits;
[0011] (a3) application in screening or assisting in screening fast-growing goats;
[0012] (a4) application in preparing products for screening or assisting in screening fast-growing goats;
[0013] (a5) application in fast-growing goat assisted breeding;
[0014] The SNP site rs640930109 is the 14197982nt nucleotide site on chromosome 17 of the goat reference genome Capra hircus ARS1.1 version, and the base of this site is C or T (the reference base of this site is C, and the mutant base is T).
[0015] Further, the substance is (b1) or (b2) or (b3) as follows:
[0016] (b1) a primer set for jointly detecting the SNP site rs640930109 polymorphism or genotype by direct sequencing method and MassARRAY mass spectrometry detection;
[0017] (b2) a reagent containing the primer set of (b1);
[0018] (b2) a kit containing the primer set of (b1) or the reagent of (b2).
[0019] Further, the primer set comprises a PCR primer pair P1 and a single base extension primer pair P2 in MassARRAY mass spectrometry detection;
[0020] The PCR primer pair P1 comprises:
[0021] the upstream primer F1: 5'-GCAACCATTCCATCCCAAGC-3'(SEQ ID NO. 2);
[0022] the downstream primer R1: 5'-GCACTGTGAAGGGGATCATG-3'(SEQ ID NO. 3);
[0023] The single base extension primer pair P2 in MassARRAY mass spectrometry detection comprises:
[0024] the upstream probe primer F2: 5'-ACGTTGGATGGGAAGTGGAATTTACTGGGC-3'(SEQ ID NO. 4);
[0025] the downstream probe primer R2: 5'-ACGTTGGATGTGAACAGCATGCAAGAGGTC-3'(SEQ ID NO. 5).
[0026] Further, the growth traits are 6-month-old body weight, body length, body height, chest circumference, chest depth and chest width of the goat; the SNP site rs640930109 polymorphism or genotype in the goat genome has a significant influence on the 6-month-old body weight, body length, body height, chest circumference, chest depth and chest width of the goat, and the 6-month-old body weight, body length, body height, chest circumference, chest depth and chest width of the goat with CC genotype are significantly higher than those with CT genotype.
[0027] In a second aspect, the application claims the use of the aforementioned primer set in the preparation of a product for detecting the aforementioned SNP site rs640930109 polymorphism or genotype.
[0028] In a third aspect, the present application claims a product comprising the aforementioned substance or the aforementioned primer set.
[0029] In a fourth aspect, the present application claims a method for identifying or assisting in identifying the growth traits of goats, which detects the polymorphism or genotype of SNP site rs640930109 in the genome of the goats by using the aforementioned primer set or the aforementioned product; the goats with CC genotype have significantly higher 6-month-old body weight, body length, body height, chest circumference, chest depth and chest width than the goats with CT genotype.
[0030] In a fifth aspect, the present application claims a genetic breeding method for fast-growing goats, which detects the polymorphism or genotype of SNP site rs640930109 in the genome of the goats by using the aforementioned primer set or the aforementioned product; the individuals with CC homozygous genotype are retained, and the individuals with CT heterozygous genotype are eliminated, so as to improve the growth traits of the goats from generation to generation.
[0031] Further, the method for detecting the genotype of SNP site rs640930109 in the genome of the goats comprises the following steps: taking the blood genomic DNA of the goats to be detected as a template, using the aforementioned primer set or the aforementioned product, and adopting the method of direct sequencing of PCR amplification product and MassARRAY mass spectrometry to determine the genotype of SNP site rs640930109 in the genome of the goats.
[0032] The present application determines the genotype of SNP site rs640930109 of the breeding goats in the core group of goats, and makes corresponding selection according to the genotype of SNP site rs640930109 of the goats: the individuals with CC type at rs640930109 site are selected for the breeding of the next generation, and the individuals with CT genotype are eliminated, so as to increase the frequency of the genotype from generation to generation, thereby improving the 6-month-old growth traits of the offspring of Haimen goats.
[0033] In a sixth aspect, the present application claims a molecular marker comprising the aforementioned SNP site rs640930109, the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO. 1, and the SNP site rs640930109 is located at the 70th bp of SEQ ID NO. 1.
[0034] In the specific embodiment of the present application, the goats are selected from Haimen goats.
[0035] The present application has the following beneficial effects:
[0036] The present application is directed to a newly discovered goat SNP site rs640930109, and a primer (regular PCR primer and single base extension primer) is designed according to the reference sequence of the TAOK3 gene, and the amplified gene fragment is analyzed by PCR amplification and MassARRAY mass spectrometry detection, so that the genotype of the individual at the rs640930109 site can be detected simply, quickly, at low cost and accurately. The present application detects the rs640930109 site of the goat (for example, Haimen goat), analyzes the gene frequency, and performs correlation analysis on the corresponding site and the growth traits of the goat, and the results show that the goat rs640930109 site exists as a molecular marker for improving the growth traits (6-month-old body weight, body length, body height, chest circumference, chest depth and chest width) of the goat, and can be used to quickly establish a goat population with excellent genetic resources, thereby facilitating the process of marker-assisted selection and good seed selection of local goat growth traits. The present application screens a significant SNP molecular marker affecting the growth traits of the goat, which is used in molecular marker-assisted selection and genome selection, and the genotype for improving the growth traits of the goat is selected for seed saving, so as to improve the gene frequency of the superior alleles of the offspring, thereby accelerating the breeding efficiency of local breeds, and bringing great economic benefits to goat breeding. BRIEF DESCRIPTION OF DRAWINGS
[0037] Figure 1 : Electrophoretogram of goat blood genomic DNA.
[0038] Figure 2 : Electrophoretogram of goat rs640930109 site amplification product; the figure shows that the size of the amplification product of primer pair P1 is 159bp (M represents DL1500 DNA Marker, and 1-6 represents 6 mixed pool rs640930109 site PCR amplification products).
[0039] Figure 3 : Sequencing diagram of goat rs640930109 site (CC, CT two genotypes). DETAILED DESCRIPTION
[0040] The embodiment of the application finally obtains a molecular marker site rs640930109 site related to the growth traits (6-month-old body weight, body length, body height, chest circumference, chest depth and chest width) of Haimen goats by genotyping detection on 585 Haimen goats, and the site is the 14197982th nucleotide site on chromosome 17 of the goat reference genome Capra hircus ARS1.1 version 17, and the base of the site is C or T. The statistical analysis result shows that the 14197982 site is significantly related to the growth traits (6-month-old body weight, body length, body height, chest circumference, chest depth and chest width) of goats, and the 6-month-old body weight, body length, body height, chest circumference, chest depth and chest width of the individual with the genotype CC are significantly higher than those of the individuals with other genotypes, which indicates that the CC homozygous type is a genotype beneficial to the improvement of growth traits.
[0041] The molecular marker screened in the application can be applied to the genotype of the goat growth trait related gene or the correlation analysis related to the goat growth trait, and provides a new molecular marker resource for the molecular marker assisted selection of the goat growth trait.
[0042] In order to make the purpose, technical scheme and advantages of the application more clear, the application will be described in detail below in combination with examples. The examples are only used to explain the application, and are not limited to the protection scope of the application.
[0043] 1 Test material
[0044] 1.1 Test animal sampling
[0045] In September 2023, 5mL blood samples of 6-month-old (180 days ± 15 days) goats were collected from the jugular vein of Jiangsu Jinsheng Goat Breeding Technology Development Co., Ltd. using a veterinary blood needle, and were transported to the laboratory in an ice bag and stored in a-20℃ refrigerator.
[0046] 1.2 Main reagents and consumables
[0047] Main reagent consumables: Trizol reagent (Invitrogen, No. 15596026), anhydrous ethanol, isopropanol, reverse transcription kit (Vazyme, R323-01), AceQ qPCR SYBR Green Master Mix (Vazyme, Q711) fluorescence quantitative reagent kit, DNase / RNase free ddH2O (Bioteke, B029005020), TRANSGEN blood genomic DNA extraction kit (centrifugal column type), 50xTAE (Solarbio), agarose (BIOWEST), 2xTaq Plus Master Mix II (DyePlus) (Vazyme, P213-03), 10000xTS-GelRed nucleic acid gel dye (TSINGKE, TSJ003), DL2000Plus DNA Marker (Vazyme, MD102-02), disposable intravenous blood collection needle, vacuum blood collection tube (EDTA-K2 anticoagulant).
[0048] 1.3 Main instruments
[0049] Micro pipette gun (Germany, Eppendorf), liquid nitrogen tank (Thermo), ultraviolet spectrophotometer (Thermo, NanoDrop 1000), PCR instrument (Applied Biosystems), real-time fluorescent quantitative PCR instrument (Applied Biosystems, ABI 7500), centrifuge (Centrifuge 5417R) precision electronic balance (Sartorius, BSA124S), -20℃ medical low-temperature storage box (China Haier), -80℃ ultra-low temperature storage box (Thermo), water bath.
[0050] 2 Test method and result
[0051] 2.1 Determination of growth traits of goats
[0052] The test goats were standing on the flat ground and their body weight (unit: kg) and body size (unit: cm) traits were determined according to the following method:
[0053] (1) Body weight: the morning empty stomach weight was weighed using an electronic scale.
[0054] (2) Body height (withers height): the vertical distance from the withers top to the ground was measured with a measuring rod. First, make the main ruler vertical and stand near the left front limb of the animal, then lay the upper end of the horizontal ruler on the highest point of the withers (the horizontal ruler and the main ruler should be at right angles), and the height on the main ruler can be read.
[0055] (3) Body length (body slant length): the straight-line distance from the anterior edge of the shoulder to the posterior edge of the ischial tuberosity. It can be measured with a tape or measuring rod, but the measuring instrument used must be noted.
[0056] (4) Chest depth: the distance from the highest point of the scapula to the bottom of the sternum.
[0057] (5) Chest width: the straight-line distance of the widest point of the posterior edge of the scapula on both sides.
[0058] (6) Chest circumference: the vertical diameter of the chest measured from the posterior edge of the scapula, measured with a tape.
[0059] 2.2 Extraction of genomic DNA
[0060] The goat blood was taken out from the -20℃ refrigerator in advance and placed in the 4℃ refrigerator for thawing. After confirming that the blood was completely thawed, the DNA in the whole blood was extracted according to the instructions of the Blood Genomic DNA Kit (TRANSGEN, EE121) kit, and the specific steps were as follows:
[0061] (1) Add 20 μL Proteinase K, 500I BB3 to the sample, vortex for 15 seconds to mix the sample thoroughly, and incubate at room temperature for 10 minutes;
[0062] (2) Centrifuge briefly, add all the solution to the centrifugal column, centrifuge at 12,000 x g for 1 minute, and discard the effluent;
[0063] (3) Add 500 μL of solution CB3 (check whether anhydrous ethanol has been added before use), centrifuge at 12,000 x g for 30 seconds, and discard the effluent;
[0064] (4) Add 500 μL of solution WB3 (check whether anhydrous ethanol has been added before use), centrifuge at 12,000 x g for 30 seconds, and discard the effluent;
[0065] (5) Repeat step 4 once;
[0066] (6) Centrifuge at 12,000 x g for 2 minutes to completely remove the residual WB3;
[0067] (7) Place the centrifugal column in a clean centrifugal tube, add 100 μL of deionized water (pH > 7.0) to the center of the column, stand at room temperature for 1 minute, centrifuge at 12,000 x g for 1 minute, elute the DNA, and store in a -20℃ refrigerator.
[0068] The electrophoresis results of goat blood genomic DNA are shown in Figure 1 .
[0069] 2.3 DNA pool detection
[0070] 120 DNA samples were randomly selected from 6-month-old Haemen goats. According to the body weight data of 6-month-old Haemen goats, the blood DNA of the top 15 and bottom 15 individuals in weight ranking was selected, and a total of 30 DNA samples were obtained. Each sample was taken 1 μL into the same 1.5 mL centrifuge tube to make a DNA pool, and a total of 4 pools were prepared for subsequent primer verification and preliminary genotyping verification.
[0071] 2.4 SNP site primer design and sequence amplification
[0072] The sequence information of rs640930109 was searched in NCBI database (https: / / www.ncbi.nlm.nih.gov), and specific primers were designed by using Oligo7 software. The primer pair P1 was used for PCR amplification:
[0073] The upstream primer F1 was 5'-GCAACCATTCCATCCCAAGC-3';
[0074] The downstream primer R1 was 5'-GCACTGTGAAGGGGATCATG-3'.
[0075] The PCR amplification product of the DNA pool sample (as shown in Figure 2 ) was sent to Nanjing Qikexin Biotechnology Co., Ltd. for bidirectional sequencing, and the sequencing results were analyzed by SnapGene software for SNP typing (as shown in Figure 3 ). The peak graph of the pool sequencing showed double peaks, indicating that there was a mutation at this site in the population.
[0076] The amplified nucleotide sequence of rs640930109 is shown in SEQ ID NO. 1 (wherein the rs640930109 site is represented by [C / T]):
[0077] CTGTACCACGAGGAGTGGAATTTACTGGGCTTTCATCATCATGCATCATGACAAGTTCAGAGCTGCTAT[C / T]GTCCATGACCTCTTGCATGCTGTTCACGCTGCTGCCCTG GCTGCCTGTACTCACAGACATGCTTGGGATGGAATGGTTGCAAAACATGC (SEQ ID NO. 1)
[0078] 2.5 MassARRAY mass spectrometry detection
[0079] The qualified genomic DNA was sent to Beijing Compton Agricultural Technology Co., Ltd. for secondary inspection and MassARRAY mass spectrometry. First, according to the SNP site sequence information, the PCR reaction and single base extension primer were designed using the primer design software Assay design 3.1 and synthesized; after PCR amplification, the product was treated with alkaline phosphatase, single base extension, resin purification, chip spotting and mass spectrometry, and finally 585 individual rs640930109 site typing results were obtained.
[0080] The single base extension primer pair P2 used in MassARRAY mass spectrometry:
[0081] Upstream probe primer F2: 5'-ACGTTGGATGGGAAGTGGAATTTACTGGGC-3';
[0082] Downstream probe primer R2: 5'-ACGTTGGATGTGAACAGCATGCAAGAGGTC-3'.
[0083] 2.6 Application of rs640930109 site in association analysis of Haimen goat growth traits
[0084] Association analysis of rs640930109 molecular marker and Haimen goat growth traits (6-month-old body weight, body length, body height, chest circumference, chest depth and chest width):
[0085] (1) The phenotypes used for genotype and growth trait association analysis were measured by professional technicians strictly according to the above measurement specifications, and the determination age was 180±15 days, the body weight (kg) was measured in the morning on an empty stomach, and the body length, body height, chest circumference, chest depth and chest width (cm) were measured, a total of 585 samples.
[0086] (2) The Excel was used to respectively count the gene frequency of rs640930109 site in the test population of Haimen goats and conduct genetic diversity analysis. As shown in Table 1, the dominant genotype of rs640930109 site in the test population of 585 goat samples was CC, the frequency of which was 0.8615, the dominant allele was C, the frequency of which was 0.9308, and the frequency of allele T was 0.0692.
[0087] The genetic parameters and Hardy-Weinberg balance test are also shown in Table 1. The genetic homozygosity and heterozygosity of rs640930109 site were 0.8711 and 0.1289, respectively, the polymorphism information content was less than 0.250, i.e. in low polymorphism; the genotype distribution of rs640930109 site was in accordance with Hardy-Weinberg balance (P>0.05) by Hardy-Weinberg balance test.
[0088] Table 1. Gene frequency statistics and genetic diversity analysis of rs640930109 locus of Haimen goat test population
[0089]
[0090]
[0091] (3) The SNP locus was associated with the body size at 6 months old by using GLM program of SAS (8.0) software.
[0092] Single factor variance analysis was used, and the model was Yij = μ + Gi + Eij, wherein Yij was the individual trait phenotype value;
[0093] In the formula, μ was the population mean; Gi was the genotype effect; and Eij was the random error. Chi-square test was used to compare the difference between genotypes and alleles.
[0094] The association analysis results showed that the rs640930109 locus was significantly associated with the growth traits (body weight, body length, body height, chest circumference, chest depth, and chest width) of Haimen goats at 6 months old, and the analysis results are shown in Table 2.
[0095] Table 2. Association analysis of rs640930109 locus and growth traits (6 months old) of Haimen goat test population
[0096]
[0097] Note: The same superscript lowercase letters represent no significant difference (p>0.05), and different superscript lowercase letters represent significant difference (p<0.05).
[0098] As shown in Table 1 and Table 2, for the growth traits of Haimen goats at 6 months old, the 6-month-old body weight, body length, body height, chest circumference, chest depth, and chest width of the individual with genotype CC were significantly higher than those of the individual with genotype CT, indicating that the CC type is a genotype that is beneficial to the improvement of growth traits. These results can provide data support and theoretical reference for molecular marker-assisted selection breeding of Haimen goats.
[0099] The above only describes the preferred embodiments of the present application, and it should be noted that for those skilled in the art, without departing from the principles of the present application, a number of improvements and refinements can be made, and these improvements and refinements should also be considered as the protection scope of the present application.
Claims
1. The application of substances used to detect the polymorphism or genotype of the SNP site rs640930109 in the goat genome in any of the following: (a1) Application in identifying or assisting in the identification of growth traits in goats; (a2) Application in the preparation of products for the identification or auxiliary identification of growth traits in goats; (a3) Application in screening or assisting screening of goats with fast growth traits; (a4) Application in the preparation of products for screening or assisting in the screening of goats with fast growth traits; (a5) Application of molecular marker-assisted breeding in goats with fast growth trait; The SNP locus rs640930109 is located at position 14197982 on chromosome 17 of the Capra hircus ARS1.1 version of the goat reference genome, and the base at this locus is C or T; the goat is the Haimen goat; the growth traits are the weight, body length, body height, chest circumference, chest depth, and chest width of the goat at 6 months of age. The assisted breeding involves selecting individuals aged 6 months that exhibit rapid growth in weight, body length, body height, chest circumference, chest depth, and chest width; among which, At 6 months of age, CC genotype goats had significantly higher body weight, body length, body height, chest circumference, chest depth, and chest width than CT genotype goats.
2. The application according to claim 1, characterized in that, The substance is (b1) or (b2) or (b3) as follows: (b1) Primer set for detecting the polymorphism or genotype of the SNP locus rs640930109 by a combination of direct sequencing and MassARRAY mass spectrometry; (b2) A reagent containing the primer set described in (b1); (b3) A kit containing the primer set described in (b1) or the reagent described in (b2).
3. The application according to claim 2, characterized in that, The primer set includes PCR primer pair P1 and MassARRAY mass spectrometry detection single base expansion primer pair P2; The PCR primer pair P1: Upstream primer F1: 5'-GCAACCATTCCATCCCAAGC-3'; Downstream primer R1: 5'-GCACTGTGAAGGGGATCATG-3'; The single-base extended primer pair P2 used in the MassARRAY mass spectrometry detection described above: Upstream probe primer F2: 5'-ACGTTGGATGGGAAGTGGAATTTACTGGGC-3'; Downstream probe primer R2: 5'-ACGTTGGATGTGAACAGCATGCAAGAGGTC-3'.
4. A method for identifying or assisting in the identification of growth traits in goats, characterized in that, The polymorphism or genotype of the SNP site rs640930109 in the goat genome described in claim 1 was detected using the primer set described in claim 2 or 3; the body weight, body length, body height, chest circumference, chest depth and chest width of the CC genotype goat at 6 months of age were significantly higher than those of the CT genotype; the goat described was the Haimen goat.
5. A genetic breeding method for goats with a fast growth trait, characterized in that, The polymorphism or genotype of the SNP site rs640930109 in the goat genome described in claim 1 is detected using the primer set described in claim 2 or 3; individuals with the CC homozygous genotype are retained, while individuals with the CT heterozygous genotype are eliminated, and the growth traits of the goats are improved generation by generation; the goats are Haimen goats; the growth traits are the weight, body length, body height, chest circumference, chest depth, and chest width of the goats at 6 months of age.
6. The method according to claim 4 or 5, characterized in that, The method for detecting the genotype of the SNP site rs640930109 in the goat genome is as follows: using the genomic DNA of the goat blood to be tested as a template, and using the primer set described in claim 2 or 3, the genotype of the SNP site rs640930109 in the goat genome is determined by direct sequencing of the PCR amplification products and detection by MassARRAY mass spectrometry.
Citation Information
Patent Citations
NFAT5 gene molecular marker related to goat growth traits and application of NFAT5 gene molecular marker
CN112176076A
SNP molecular marker associated with white goat body size character in FHL3 gene, detection reagent, kit and application
CN116004841A
Application of SNP molecular marker rs642525408 related to goat growth traits
CN117385047A
Detection method for single nucleotide polymorphism of goat CKMT2 gene and application of detection method
CN117987518A
SNP (Single Nucleotide Polymorphism) molecular marker related to reproduction traits of Haimen goats and application of SNP molecular marker
CN117126946A