Compositions for PCSK9 gene modification or editing and methods of use thereof

Abstract

The present invention provides compositions for PCSK9 gene modification or editing and methods of using the same. Specifically, the present invention provides a composition for editing PCSK9 gene targets, comprising a base editor and a guide RNA for base editing the PCSK9 gene target. The composition of the present invention can effectively edit the target gene and can be used to treat diseases caused by abnormal polynucleotides encoding PCSK9 proteins.

Description

Technical Field

[0001] The present invention relates to the field of gene editing, and in particular, to a composition for PCSK9 gene modification or editing and a method for using the same. Background Art

[0002] The liver protein proprotein convertase subtilisin / kexin type 9 (PCSK9) is a secreted, globular, autoactivating serine protease that acts as a protein-binding adaptor within endosomal vesicles to bridge pH-dependent interactions with the LDL receptor (LDL-R) during endocytosis of low-density lipoprotein (LDL) particles, thereby preventing LDL-R recycling to the cell surface and leading to decreased LDL-cholesterol clearance. Blocking or inhibiting PCSK9 function to enhance LDL-R-mediated LDL cholesterol clearance is of great significance in drug development. Currently, a variety of drugs, such as antibodies, that target the PCSK9 protein are available, but there is still a need to develop safer and more effective treatments. Summary of the Invention

[0003] The main purpose of the present invention is to provide a safer and more effective treatment method.

[0004] A first aspect of the present invention provides a composition for editing a PCSK9 gene target, comprising:

[0005] (a) a first active ingredient, which is a base editor for base editing the PCSK9 gene target or an expression vector thereof, wherein the base editor comprises a programmable DNA binding domain and a DNA modifying enzyme, or a nucleotide sequence encoding the same, wherein the DNA modifying enzyme is adenosine deaminase, and the adenosine deaminase is a variant TA9999 of 005V1 (deaminase 005V1 of CN114634923A, whose amino acid sequence is shown in SEQ ID NO: 1 and whose nucleotide coding sequence is shown in SEQ ID NO: 18), and the amino acid sequence of the variant TA9999 is shown in SEQ ID NO: 2;

[0006] (b) a second active ingredient, wherein the second active ingredient is a guide RNA or an expression vector thereof, and the guide RNA guides the base editor to specifically modify the PCSK9 gene.

[0007] In another preferred example, the nucleotide coding sequence of the variant TA9999 is shown in SEQ ID NO: 3.

[0008] In another preferred example, the programmable DNA binding domain includes Cas9 (e.g., dCas9 and nCas9), saCas9 (e.g., saCas9d, saCas9d, saKKH Cas9), CasX, CasY, Cpf1, C2c1, C2c2, C2c3, and Argonaute.

[0009] In another preferred embodiment, the programmable DNA binding domain is Cas9, preferably nCas9.

[0010] In another preferred embodiment, the guide RNA comprises a backbone structure and a spacer sequence corresponding to the PCSK9 gene site.

[0011] In another preferred embodiment, the guide RNA is a modified or unmodified guide RNA.

[0012] In certain embodiments, the modified guide RNA includes chemical modifications of bases.

[0013] In certain embodiments, the chemical modification comprises methylation modification, methoxy modification, fluorination modification or thio modification.

[0014] In another preferred embodiment, the nucleotide sequence of the spacer sequence of the guide RNA is selected from the following group: SEQ ID NO: 10-11.

[0015] In another preferred embodiment, the nucleotide sequence of the guide RNA is selected from the following group: SEQ ID NO: 12-13.

[0016] In another preferred embodiment, when administered to a mammalian subject, the guide RNA guides the base editor to encode the polynucleotide encoding the PCSK9 protein, thereby achieving base changes in the polynucleotide encoding the nuclear PCSK9 protein, and the DNA modification enzyme is adenosine deaminase, comprising an amino acid sequence as shown in SEQ ID NO: 1 or 2.

[0017] In another preferred embodiment, the spacer sequence targets the PCSK9 gene, resulting in a base change at the splice donor or splice acceptor; preferably, the spacer sequence (i.e., the targeting sequence of the guide RNA) is as shown in SEQ ID NO: 10-11, and preferably, the guide RNA is chemically modified.

[0018] In another preferred embodiment, the composition comprises a pharmaceutical composition.

[0019] In another preferred embodiment, the dosage form of the composition is selected from the following group: a lyophilized preparation, a liquid preparation, or a combination thereof.

[0020] In another preferred embodiment, the composition is in the form of a liquid preparation.

[0021] In another preferred embodiment, the composition is in the form of an injection.

[0022] In another preferred embodiment, the composition is a cell preparation.

[0023] In another preferred embodiment, the expression vector includes a viral vector or a plasmid.

[0024] In another preferred embodiment, the viral vector is selected from the group consisting of adeno-associated virus (AAV), adenovirus, lentivirus, retrovirus, herpes virus, SV40, poxvirus, or a combination thereof.

[0025] In another preferred embodiment, the vector is selected from the group consisting of lentivirus, adenovirus, adeno-associated virus (AAV), or a combination thereof. Preferably, the vector is adeno-associated virus (AAV).

[0026] In another preferred example, the expression vector of the base editor and the expression vector of the guide RNA are the same vector or different vectors.

[0027] In another preferred embodiment, the weight ratio of component (a) to component (b) is 100:1-0.01:1, preferably, 10:1-0.1:1, and more preferably, 2:1-0.5:1.

[0028] In another preferred embodiment, in the composition, the content of component (a) is 0.001%-99%, preferably, 0.1%-90%, and more preferably, 1%-70%.

[0029] In another preferred embodiment, in the composition, the content of component (b) is 0.001%-99%, preferably, 0.1%-90%, more preferably, 1%-70%.

[0030] In another preferred embodiment, in the composition, the content of component (c) is 1%-99%, preferably, 10%-90%, and more preferably, 30%-70%.

[0031] In another preferred embodiment, in the composition, the components (a), (b) and (c) account for 0.01-99.99 wt%, preferably 0.1-90 wt%, and more preferably 1-80 wt% of the total weight of the composition. (Please review)

[0032] In another preferred embodiment, the composition further comprises one or more lipid moieties, wherein the one or more lipid moieties are selected from the group consisting of ionizable lipids, neutral lipids, PEG lipids, structured lipids, or a combination thereof.

[0033] In another preferred embodiment, the ionizable lipid includes a compound shown in the following structure:

[0034]

[0035] In another preferred embodiment, the neutral lipid includes any lipid molecule disclosed or undisclosed that exists in an uncharged form or a neutral zwitterionic form at a selected pH value or range. The selected useful pH value or range corresponds to the pH conditions of the environment in which the lipid is intended to be used, such as physiological pH.

[0036] In some embodiments, the neutral lipid comprises phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylserine (PS), phosphatidic acid (PA), or phosphatidylglycerol (PG).

[0037] As non-limiting examples, neutral lipids that can be used in conjunction with the present disclosure include, but are not limited to, phosphatidylcholines, such as 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC); phosphatidylethanolamines, such as 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 2-((2,3-bis(oleoyloxy)propyl))dimethylammonio)ethyl hydrogenphosphate (DOCP); sphingomyelin (SM); ceramides; steroids, such as sterols and their derivatives. The neutral lipids provided herein can be synthetic or derived from (isolated or modified from) natural sources or compounds.

[0038] In some embodiments, exemplary phospholipids that can form part of the nanoparticle compositions of the present invention include, but are not limited to, 1,2-dioleoyl-sn-glycero-3-phosphatidylethanolamine (DOPE), 1,2-distearoyl-sn-glycero-3-phosphatidylcholine (DSPC), 1,2-dipalmitoyl-sn-glycero-3-phosphatidylcholine (DPPC), 1,2-dioleoyl-sn-glycero-3-phosphatidylcholine (DOPC), dipalmitoylphosphatidylglycerol (DPPG), and 1,2-dioleoyl-sn-glycero-3-phosphatidylcholine (DOPC). ), oleoylphosphatidylcholine (POPC), 1-palmitoyl-2-oleoylphosphatidylethanolamine (POPE), 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine (DPPE), 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine (DMPE), distearoylphosphatidylethanolamine (DSPE) and 1-stearoyl-2-oleoylphosphatidylethanolamine (SOPE), or lipids modified with anionic or cationic modifying groups.

[0039] In another preferred embodiment, the PEG lipids include 1,2-dimyristoyl-sn-glyceromethoxy-polyethylene glycol (PEG-DMG), dimyristoylglycerol-polyethylene glycol (PEG-c-DMG), polyethylene glycol-dimyristoylglycerol (PEG-C14), PEG-1,2-dimyristoyloxypropyl-3-amine (PEG-c-DMA), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[amino(polyethylene glycol)] (PEG-DSPE), PEGylated phosphatidylethanolamine (PEG-PE), PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, Tween-20, Tween-20, One or a combination of two or more of Wen-80, 1,2-dipalmityl-sn-glycerol-methoxypolyethylene glycol PEG-DPG, 4-O-(2',3'-di(tetradecanoyloxy)propyl-1-O-(ω-methoxy(polyethoxy)ethyl)succinate (PEG-s-DMG), PEG-dialkoxypropyl (PEG-DAA), mPEG2000-1,2-di-O-alkyl-sn3-carbamoylglycerol ester (PEG-c-DOMG) and N-acetylgalactosamine ((R)-2,3-bis(octadecyloxy)propyl-1-(methoxypoly(ethylene glycol) 2000)propylcarbamate)) (GalNAc-PEG-DSG).

[0040] In some embodiments, the compositions may include one or more structural lipids. Without being bound by theory, it is expected that structural lipids can stabilize the amphiphilic structure of nanoparticles, such as, but not limited to, the lipid bilayer structure of nanoparticles. Exemplary structural lipids that can be used in conjunction with the present disclosure include, but are not limited to, cholesterol, coprosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatine, tomatine, ursolic acid, alpha-tocopherol, and mixtures thereof. In certain embodiments, the structural lipid is cholesterol. In some embodiments, the structural lipid includes cholesterol and corticosteroids (such as prednisolone, dexamethasone, prednisone, and hydrocortisone) or a combination thereof.

[0041] In another preferred embodiment, the composition may further include anionic lipids, including one or a combination of two or more of phosphatidylserine, phosphatidylinositol, phosphatidic acid, phosphatidylglycerol, dioleoylphosphatidylglycerol DOPG, 1,2-dioleoyl-sn-glycero-3-phosphatidylserine DOPS and dimyristoylphosphatidylglycerol.

[0042] In another preferred embodiment, the composition comprises ionizable lipids, anionic lipids, neutral lipids, structural lipids, and PEG lipids in a molar ratio of (20-65):(0-20):(5-25):(25-55):(0.3-15).

[0043] Exemplarily, the above molar ratio can be 20:20:5:50:5, 30:5:25:30:10, 20:5:5:55:15, 65:0:9.7:25:0.3, etc.; wherein, the molar ratio of the compound (YolTech-lipid) or its pharmaceutically acceptable salt, stereoisomer, tautomer, solvate, chelate, non-covalent complex or prodrug in the ionizable lipid and other cationic or ionizable lipids is (1-10): (0-10); exemplarily, the molar ratio can be 1:1, 1:2, 1:5, 1:7.5, 1:10, 2:1, 5:1, 7.5:1, 10:1, etc.

[0044] In another preferred embodiment, the molar ratio of ionizable lipids, anionic lipids, neutral lipids, structured lipids and polymer-bound lipids is (20-55):(0-13):(5-25):(25-51.5):(0.5-15); wherein, the molar ratio of the ionizable lipid compound (YolTech-lipid) or its pharmaceutically acceptable form such as salt, stereoisomer, tautomer, solvate, chelate, non-covalent complex or prodrug and other cationic or ionizable lipids is (3-4):(0-5).

[0045] In another preferred embodiment, the composition comprises ionizable lipids, neutral lipids, structural lipids and polymer-bound lipids in a molar ratio of 20-55:5-25:25-55:0.5-15.

[0046] In another preferred embodiment, the ionizable lipid may be YolTech-lipid (Compound 10).

[0047] In another preferred embodiment, the composition comprises YolTech-lipid, DSPC, cholesterol, and PEG-DMG in a molar ratio of 50:10:38.5:1.5.

[0048] A second aspect of the present invention provides a medicine kit, comprising:

[0049] (c1) a first container, and a first active ingredient in the first container, wherein the first active ingredient is a base editor for base editing the PCSK9 gene target or an expression vector thereof, wherein the base editor comprises a programmable DNA binding domain and a DNA modifying enzyme, or a nucleotide sequence encoding the same, wherein the DNA modifying enzyme is adenosine deaminase, and the adenosine deaminase is a variant TA9999 of 005V1 (deaminase 005V1 of CN114634923A, whose amino acid sequence is shown in SEQ ID NO: 1 and whose nucleotide coding sequence is shown in SEQ ID NO: 18), and the amino acid sequence of the variant TA9999 is shown in SEQ ID NO: 2; and

[0050] (c2) a second container, and a second active ingredient located in the second container, wherein the second active ingredient is a guide RNA or an expression vector thereof, and the guide RNA guides the DNA that specifically binds to the PCSK9 gene.

[0051] In another preferred example, the nucleotide coding sequence of the variant TA9999 is shown in SEQ ID NO: 3.

[0052] In another preferred embodiment, the first container and the second container may be the same container or different containers.

[0053] In another preferred embodiment, the medicine kit further contains instructions, which record the following instructions: a method for performing gene editing in the subject by simultaneously administering the first active ingredient and the second active ingredient to a subject in need.

[0054] In another preferred embodiment, the medicine in the first container is a single-ingredient preparation containing a first active ingredient.

[0055] In another preferred embodiment, the medicine in the second container is a single-ingredient preparation containing a second active ingredient.

[0056] In another preferred embodiment, the dosage form of the drug is selected from the following group: a lyophilized preparation, a liquid preparation, or a combination thereof.

[0057] In another preferred embodiment, the dosage form of the drug is an oral dosage form or an injection dosage form.

[0058] In another preferred embodiment, the kit further comprises instructions.

[0059] A third aspect of the present invention provides a base editing system, comprising:

[0060] (1) an adenosine base editor or an expression vector thereof, wherein the base editor comprises a programmable DNA binding domain and a DNA modifying enzyme, or a nucleotide sequence encoding the same, wherein the DNA modifying enzyme is an adenosine deaminase, and the adenosine deaminase is a variant TA9999 of 005V1 (deaminase 005V1 of CN114634923A, whose amino acid sequence is shown in SEQ ID NO: 1 and whose nucleotide coding sequence is shown in SEQ ID NO: 18), and the amino acid sequence of the variant TA9999 is shown in SEQ ID NO: 2;

[0061] (2) A guide RNA or an expression vector thereof, wherein the guide RNA guides the target site that specifically binds to the PCSK9 gene.

[0062] In another preferred example, the nucleotide coding sequence of the variant TA9999 is shown in SEQ ID NO: 3.

[0063] A fourth aspect of the present invention provides a vector, comprising:

[0064] (1) a first regulatory element, wherein the first regulatory element is operably linked to a nucleotide sequence encoding a base editor, wherein the base editor comprises a programmable DNA binding domain and a DNA modifying enzyme, wherein the DNA modifying enzyme is adenosine deaminase, and the adenosine deaminase is a variant TA9999 of 005V1 (deaminase 005V1 of CN114634923A, whose amino acid sequence is shown in SEQ ID NO: 1 and whose nucleotide coding sequence is shown in SEQ ID NO: 18), and the amino acid sequence of the variant TA9999 is shown in SEQ ID NO: 2; and

[0065] (2) a second regulatory element, which is operably linked to a nucleotide sequence encoding a guide RNA.

[0066] In another preferred example, the nucleotide coding sequence of the variant TA9999 is shown in SEQ ID NO: 3.

[0067] In another preferred embodiment, the first regulatory element and the second regulatory element are located on the same or different vectors.

[0068] In another preferred embodiment, the first regulatory element and / or the second regulatory element is a promoter, such as an inducible promoter.

[0069] In another preferred embodiment, the vector comprises one or more promoters, which are operably linked to the nucleic acid sequence, enhancer, transcription termination signal, polyadenylation sequence, replication origin, selectable marker, nucleic acid restriction site, and / or homologous recombination site.

[0070] In another preferred embodiment, the vector includes a plasmid or a viral vector.

[0071] In another preferred embodiment, the viral vector is selected from the group consisting of adeno-associated virus (AAV), adenovirus, lentivirus, retrovirus, herpes virus, SV40, poxvirus, or a combination thereof.

[0072] In another preferred embodiment, the vector includes a cloning vector, a transformation vector, an expression vector, a shuttle vector, an integration vector, and a multifunctional vector.

[0073] The fifth aspect of the present invention provides a cell, which is obtained by introducing the composition described in the first aspect of the present invention, the base editing system described in the third aspect of the present invention, or the vector described in the fourth aspect of the present invention into the cell or its progenitor cell.

[0074] In another preferred embodiment, the base editor is guided by a guide RNA to edit the PCSK9 gene site so that the SNP associated with hypercholesterolemia produces an A·T to G·C change; preferably, the produced cells are hepatocytes or progenitor cells thereof; preferably, the cells are from subjects with α1-antitrypsin deficiency; preferably, the cells are mammalian cells or human cells; preferably, the cells are in vitro, in vivo or in vitro.

[0075] The sixth aspect of the present invention provides a delivery system, which is configured to deliver the composition described in the first aspect of the present invention, the base editing system described in the third aspect of the present invention, or the vector described in the fourth aspect of the present invention.

[0076] In another preferred example, the delivery system comprises one or more vectors, or one or more polynucleotide molecules, and the one or more vectors or polynucleotide molecules comprise one or more polynucleotide molecules encoding the base editor and one or more nucleic acid components.

[0077] In another preferred embodiment, the delivery system comprises a delivery vehicle, and the delivery vehicle comprises a liposome, a particle, an exosome, a microvesicle, a gene gun or a viral vector.

[0078] In another preferred embodiment, the delivery vehicle is selected from lipid particles, sugar particles, metal particles, protein particles, liposomes, exosomes, microbubbles, gene guns or viral vectors (e.g., replication-defective retroviruses, lentiviruses, adenoviruses or adeno-associated viruses).

[0079] In another preferred embodiment, the delivery vehicle includes nanoparticles, liposomes, exosomes, microvesicles, electroporation equipment or gene gun.

[0080] The seventh aspect of the present invention provides a kit comprising the composition described in the first aspect of the present invention or the base editing system described in the third aspect of the present invention or the vector described in the fourth aspect of the present invention or the delivery system described in the sixth aspect of the present invention.

[0081] In another preferred embodiment, the kit further comprises a label or instructions.

[0082] In another preferred embodiment, the kit is used for one or more of gene or genome editing, disease treatment, target gene targeting, and cutting of target genes or non-target genes.

[0083] The eighth aspect of the present invention provides an enzyme preparation, which includes the composition described in the first aspect of the present invention or the base editing system described in the third aspect of the present invention or the vector described in the fourth aspect of the present invention or the delivery system described in the sixth aspect of the present invention.

[0084] In another preferred embodiment, the enzyme preparation includes an injection and / or a freeze-dried preparation.

[0085] The ninth aspect of the present invention provides a cell preparation comprising the cells described in the fifth aspect of the present invention.

[0086] In another preferred embodiment, the cell preparation further comprises a pharmaceutically acceptable carrier or excipient.

[0087] In another preferred embodiment, the cell preparation includes an injection and / or a lyophilized preparation.

[0088] The tenth aspect of the present invention provides a lipid nanoparticle composition, comprising an ionizable lipid or a pharmaceutically acceptable salt, stereoisomer, tautomer, solvate, chelate, non-covalent complex or a precursor thereof, as well as the composition described in the first aspect of the present invention, the system described in the third aspect of the present invention, the carrier described in the fourth aspect of the present invention, and the delivery system described in the sixth aspect of the present invention.

[0089] In another preferred embodiment, the ionizable lipid includes a compound shown in the following structure:

[0090]

[0091] In another preferred embodiment, the composition comprises a pharmaceutical composition.

[0092] The eleventh aspect of the present invention provides a pharmaceutical composition comprising an ionizable lipid or a pharmaceutically acceptable salt, stereoisomer, tautomer, solvate, chelate, non-covalent complex or a precursor thereof, as well as the composition described in the first aspect of the present invention, the system described in the third aspect of the present invention, the carrier described in the fourth aspect of the present invention, the delivery system described in the sixth aspect of the present invention, and a pharmaceutically acceptable excipient, carrier or diluent.

[0093] The twelfth aspect of the present invention provides a pharmaceutical preparation comprising an ionizable lipid or a pharmaceutically acceptable salt, stereoisomer, tautomer, solvate, chelate, non-covalent complex or a precursor thereof, and the composition described in the first aspect of the present invention, the system described in the third aspect of the present invention, the carrier described in the fourth aspect of the present invention, the delivery system described in the sixth aspect of the present invention, and a pharmaceutically acceptable excipient, carrier or diluent; or the pharmaceutical preparation includes the lipid nanoparticle composition described in the tenth aspect of the present invention, and a pharmaceutically acceptable excipient, carrier or diluent.

[0094] In another preferred embodiment, the ionizable lipid includes a compound shown in the following structure:

[0095]

[0096] In another preferred embodiment, the particle size of the pharmaceutical preparation is 30 to 500 nm. For example, the particle size can be 30 nm, 50 nm, 100 nm, 150 nm, 250 nm, 350 nm, 500 nm, etc.

[0097] In another preferred embodiment, the composition of the first aspect of the present invention, the system of the third aspect of the present invention, the carrier of the fourth aspect of the present invention, or the delivery system of the sixth aspect of the present invention in the pharmaceutical preparation has an encapsulation efficiency greater than 50%. For example, the encapsulation efficiency can be 55%, 60%, 65%, 70%, 75%, 79%, 80%, 85%, 89%, 90%, 93%, 95%, etc.

[0098] In another preferred embodiment, the hydrated particle size of the drug is 50-200 nm, preferably 70-150 nm, and most preferably 75-110 nm.

[0099] In another preferred embodiment, the pharmaceutical preparation can be used for the treatment and / or prevention of diseases.

[0100] In another preferred embodiment, the disease includes a disease related to PCSK9 gene expression.

[0101] In another preferred embodiment, the diseases include cardiovascular disease (such as atherosclerotic cardiovascular disease), hypercholesterolemia, dyslipidemia (such as hyperlipidemia), hypertriglyceridemia, inflammation, autoimmune disease, sepsis, tumors and other diseases related to PCSK9 gene expression.

[0102] In another preferred embodiment, the disease is hypercholesterolemia or cardiovascular disease.

[0103] In another preferred embodiment, the dosage form of the pharmaceutical preparation is selected from the following group: injection, lyophilized preparation, nebulized inhalation preparation, and smearable preparation.

[0104] In another preferred embodiment, the pharmaceutical preparation is administered by injection, i.e., intravenous, intramuscular, intradermal, subcutaneous, intrathecal, intraduodenal or intraperitoneal injection.

[0105] In another preferred embodiment, the pharmaceutical preparation is administered by inhalation, such as intranasal administration.

[0106] In another preferred embodiment, the pharmaceutical preparation is administered transdermally, such as by transdermal application or electrode introduction.

[0107] The thirteenth aspect of the present invention provides a use of the composition of the first aspect of the present invention, the base editing system of the third aspect of the present invention, the vector of the fourth aspect of the present invention, the cell of the fifth aspect of the present invention, the delivery system of the sixth aspect of the present invention, the enzyme preparation of the eighth aspect of the present invention, the cell preparation of the ninth aspect of the present invention, the lipid nanoparticle composition of the tenth aspect of the present invention, the pharmaceutical composition of the eleventh aspect of the present invention, or the pharmaceutical preparation of the twelfth aspect of the present invention for preparing a drug or preparation, wherein the drug or preparation is used for one or more uses selected from the following group:

[0108] (a) delivering a nucleic acid molecule to a cell;

[0109] (b) editing the genome of a cell;

[0110] (c) treating diseases associated with polynucleotides encoding PCSK9 proteins.

[0111] In another preferred embodiment, the diseases include cardiovascular disease (such as atherosclerotic cardiovascular disease), hypercholesterolemia, dyslipidemia (such as hyperlipidemia), hypertriglyceridemia, inflammation, autoimmune disease, sepsis, tumors and other diseases related to PCSK9 gene expression.

[0112] In another preferred embodiment, the disease is hypercholesterolemia or cardiovascular disease.

[0113] In another preferred embodiment, the cells include mammalian cells.

[0114] In another preferred embodiment, the cells include: liver cells and stem cells.

[0115] In another preferred embodiment, the mammal includes a human or a non-human mammal.

[0116] In another preferred embodiment, the non-human mammals include rodents (eg, mice, rats, rabbits) and primates (eg, monkeys).

[0117] The fourteenth aspect of the present invention provides a method for editing the genome of a cell, comprising providing to the cell the composition according to the first aspect of the present invention, the base editing system according to the third aspect of the present invention, the vector according to the fourth aspect of the present invention, the delivery system according to the sixth aspect of the present invention, the enzyme preparation according to the eighth aspect of the present invention, the lipid nanoparticle composition according to the tenth aspect of the present invention, the pharmaceutical composition according to the eleventh aspect of the present invention, or the pharmaceutical preparation according to the twelfth aspect of the present invention.

[0118] In another preferred embodiment, the cells include mammalian cells.

[0119] In another preferred embodiment, the cells include: liver cells and stem cells.

[0120] In another preferred embodiment, the mammal includes a human or a non-human mammal.

[0121] In another preferred embodiment, the non-human mammals include rodents (eg, mice, rats, rabbits) and primates (eg, monkeys).

[0122] The fifteenth aspect of the present invention provides a method for treating a disease in a subject in need thereof, comprising the steps of administering to a subject in need thereof the composition described in the first aspect of the present invention, the base editing system described in the third aspect of the present invention, the vector described in the fourth aspect of the present invention, the cell described in the fifth aspect of the present invention, the delivery system described in the sixth aspect of the present invention, the enzyme preparation described in the eighth aspect of the present invention, the cell preparation described in the ninth aspect of the present invention, the lipid nanoparticle composition described in the tenth aspect of the present invention, the pharmaceutical composition described in the eleventh aspect of the present invention, or the pharmaceutical preparation described in the twelfth aspect of the present invention.

[0123] In another preferred embodiment, the disease includes a disease related to PCSK9 gene expression.

[0124] In another preferred embodiment, the diseases include cardiovascular disease (such as atherosclerotic cardiovascular disease), hypercholesterolemia, dyslipidemia (such as hyperlipidemia), hypertriglyceridemia, inflammation, autoimmune disease, sepsis, tumors and other diseases related to PCSK9 gene expression.

[0125] In another preferred embodiment, the disease is hypercholesterolemia or cardiovascular disease.

[0126] In another preferred embodiment, the subject in need thereof includes a human or non-human mammal.

[0127] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features described in detail below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be listed here one by one. BRIEF DESCRIPTION OF THE DRAWINGS

[0128] Figure 1 The base editing activity mediated by TA9999-nCas9 in mammalian cells is shown. Compared with ABE8e, the editing efficiency mediated by TA9999-nCas9 is significantly higher at a dose of 0.25ng / 0.5ng. NC represents a nonspecific (non-targeted) control.

[0129] Figure 2 The data show the TA9999-nCas9-mediated base editing activity and PCSK9 protein levels in mammalian cells under different dosage conditions. When the total dose of TA9999-nCas9 mRNA and hPCSK9-sgRNA was 2 ng / well, the editing efficiency reached 60%, when the total dose was 4 ng / well, the editing efficiency reached 75%, when the total dose was 8 ng / well, the editing activity was close to 90%, and when the total dose was 16 ng / well, it reached a saturated editing efficiency of up to 95%. At the total doses of 8 ng / well and 16 ng / well, the PCSK9 protein levels were only 73 ng / ml and 37 ng / ml, respectively.

[0130] Figure 3 The figure shows the editing efficiency of TA9999-nCas9 and ABE8e in mammals under different doses (0.05 mpk, 2 mpk), and NC represents the non-specific (non-targeting) control.

[0131] Figure 4 The data show that after intravenous injection (0.05 mpk) of mice, blood was collected to measure changes in plasma LDL-C and PCSK9 protein levels. One month after administration, LDL-C levels were significantly reduced to approximately 40% relative to baseline. After 12 months, LDL-C levels were significantly below 40%. After intravenous injection, PCSK9 protein levels in plasma dropped significantly to 20%. PCSK9 protein levels remained at a low level until 12 months after injection, and at 12 months, PCSK9 protein levels were still at approximately 20%.

[0132] Figure 5The figure shows the different editing efficiencies mediated by TA9999-nCas9 under different LNP formulations (containing the ionizable lipid ALC-0315 and YolTech lipid, respectively). NC represents a nonspecific (non-targeted) control. As can be seen from the figure, the editing efficiency is much higher when delivered using LNPs containing YolTech lipid than when delivered using LNPs containing ALC-0315.

[0133] Figure 6 Shown are the TA9999-nCas9-mediated editing efficiencies after LNP administration (3 mpk) in cynomolgus monkeys. NC represents a nonspecific (non-targeting) control.

[0134] Figure 7 The graph shows the changes in PCSK9 protein levels in the plasma of cynomolgus monkeys over a period of time after LNP administration (3 mpk). From the third day to the ninth month after administration, the PCSK9 protein level in the plasma remained at around 20%. DETAILED DESCRIPTION

[0135] After extensive and in-depth research, the inventors unexpectedly discovered for the first time a composition for editing PCSK9 gene targets, including a base editor and a guide RNA for base editing the PCSK9 gene target. The composition of the present invention can effectively edit or cut the target gene and can be used to treat diseases related to PCSK9 gene expression, such as cardiovascular disease (e.g., atherosclerotic cardiovascular disease), hypercholesterolemia, dyslipidemia (e.g., hyperlipidemia), hypertriglyceridemia, inflammation, autoimmune diseases, sepsis, and tumors. On this basis, the inventors completed the present invention.

[0136] Many modifications and other embodiments of the inventions set forth herein will occur to one of ordinary skill in the art having the benefit of the teachings presented in the foregoing description. Therefore, it should be understood that the invention is not limited to the specific embodiments disclosed and that modifications and other embodiments are intended to be included within the scope of the appended claims. Although specific terms are employed herein, such terms are used in a generic and descriptive sense only and not for purposes of limitation.

[0137] the term

[0138] The following examples are only used to illustrate the present invention, rather than to limit the present invention. Unless otherwise specified, the experiments and methods described in the examples were basically carried out according to conventional methods well known in the art and described in various references.

[0139] In addition, if specific conditions are not specified in the examples, the experiments were performed under conventional conditions or the conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments is not specified, they are all conventional products that can be obtained commercially. It is understood that the examples describe the present invention by way of example and are not intended to limit the scope of the present invention. All publications and other references mentioned herein are incorporated herein by reference in their entirety.

[0140] In order to more easily understand the present disclosure, some terms are first defined. As used in this application, unless otherwise expressly provided herein, each of the following terms should have the meaning given below. Other definitions are set forth throughout the application.

[0141] Sequence identity (or homology) is determined by comparing two aligned sequences along a predetermined comparison window (which can be 50%, 60%, 70%, 80%, 90%, 95% or 100% of the length of the reference nucleotide sequence or protein) and determining the number of positions at which identical residues occur. Typically, this is expressed as a percentage. The measurement of sequence identity of nucleotide sequences is a method well known to those skilled in the art.

[0142] 1. Overview

[0143] As described below, the present disclosure provides compositions and methods for altering mutations associated with polynucleotides encoding PCSK9 proteins.

[0144] The present invention is based, at least in part, on the discovery that base editors comprising adenosine deaminase variants can efficiently and accurately edit polynucleotides encoding PCSK9 proteins, thereby treating hypercholesterolemia, atherosclerosis, and / or one or more symptoms or complications thereof. Accordingly, in a related aspect, the present disclosure provides methods for treating hypercholesterolemia, atherosclerosis, and / or one or more symptoms or complications thereof, which involve reducing PCSK9 gene expression in the liver.

[0145] 2. Definition

[0146] As used herein and in the claims, the singular forms "a," "an," and "the" include both singular and plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "an agent" includes a single agent and a plurality of such agents.

[0147] In this article, "administering" refers to individual or systemic administration of compositions. Those of ordinary skill in the art will appreciate that the various approaches that can be used to administer to individuals (e.g., humans) under appropriate circumstances. For example, in some embodiments, administration can be through the eye, oral, parenteral, topical, etc. In some specific embodiments, administration can be transbronchial (e.g., by bronchial instillation), buccal, transdermal (which can be or include, for example, one or more topical to the dermis, intradermal, interdermal, transdermal, etc.), enteral, intraarterial, intraventricular (intracerebralventricular), intracisterna (intracisterna manga), intradermal, intragastric, intramedullary, intramuscular, intranasal, intraperitoneal, intrathecal, intravenous, intraventricular, in a specific organ (e.g., intrahepatic), mucosal, nasal, oral, rectal, subcutaneous, sublingual, topical, transtracheal (e.g., by intratracheal instillation), vaginal, through the vitreous, by atomization administration, etc. In some embodiments, administration may involve intermittent dosing (e.g., multiple doses spaced at intervals) and / or periodic dosing (e.g., individual doses spaced at intervals of a common period of time). In some embodiments, administration may involve continuous dosing (e.g., perfusion) for at least a selected period of time. In some embodiments, pharmaceutical compositions comprising lipid nanoparticles can be formulated to be administered by parenteral (intramuscular, intraperitoneal, intravenous (IV) or subcutaneous injection), transdermal (passively or using iontophoresis or electroporation), or transmucosal (nasal, vaginal, rectal, or sublingual) routes of administration or using bioerodible inserts, and can be formulated in dosage forms suitable for each route of administration.

[0148] In this article, " cholesterol " refers to the lipid molecule biosynthesized by all animal cells. Without wishing to be bound by a particular theory, cholesterol is an essential structural component of all animal cell membranes, which is necessary to maintain both membrane structural integrity and fluidity. Cholesterol enables animal cells to be exempted from cell walls (to protect cell membrane integrity and cell viability), thereby allowing animal cells to change shape and allowing animals to move (unlike bacteria and plant cells restricted by their cell walls). In addition to its importance to animal cell structure, cholesterol can also serve as a precursor for the biosynthesis of steroid hormones and bile acids. Cholesterol is the main sterol synthesized by all animals. In vertebrates, hepatocytes usually produce more than other cells. It is usually not present in prokaryotes (bacteria and archaea).

[0149] "Hypercholesterolemia," also known as dyslipidemia, is the presence of high levels of cholesterol in the blood. It is a form of high cholesterol and "hyperlipoproteinemia" (elevated levels of lipoproteins in the blood). Elevated levels of non-HDL cholesterol and LDL in the blood may be the result of diet, obesity, inherited (genetic) disorders (such as LDL receptor mutations in familial hypercholesterolemia), or the presence of other medical conditions such as diabetes and hypothyroidism.

[0150] "Hypocholesterolemia" refers to the presence of abnormally low levels of cholesterol in the blood. Although the presence of high total cholesterol (hypercholesterolemia) is associated with cardiovascular disease, defects in the body's cholesterol production can also lead to adverse consequences.

[0151] As used herein, "proprotein convertase subtilisin / kexin type 9 (PCSK9)" refers to the enzyme encoded by the PCSK9 gene in humans. PCSK9 binds to receptors for low-density lipoprotein (LDL) particles. In the liver, LDL receptors remove LDL particles from the blood via a pathway called endocytosis. When PCSK9 binds to the LDL receptor, the receptor is directed to the lysosomal pathway and broken down by proteolytic enzymes, thereby limiting the number of LDL particles a given LDL receptor can take up from the blood. Therefore, blocking PCSK9 activity can lead to more LDL receptors being recycled and present on the surface of liver cells, and more LDL cholesterol will be removed from the blood. Therefore, blocking PCSK9 can lower blood cholesterol levels. PCSK9 orthologs are found in many species. PCSK9 is inactive when initially synthesized, i.e., a proenzyme, because a portion of the peptide chain blocks its activity; the proprotein convertase removes this portion to activate the enzyme. Pro-PCSK9 is a secreted, globular, serine protease that is capable of proteolytic autoprocessing of its N-terminal pro-domain into a potent endogenous inhibitor of PCSK9, which blocks its catalytic site. The role of PCSK9 in cholesterol homeostasis has been exploited medically. Drugs that block PCSK9 can lower blood levels of low-density lipoprotein cholesterol (LDL-C). The first two PCSK9 inhibitors, alirocumab and evolocumab, were approved by the US Food and Drug Administration in 2015 for cholesterol-lowering effects when statins and other medications are inadequate.

[0152] As used herein, the term "expression" of a nucleic acid sequence refers to the production of any gene product from the nucleic acid sequence. In some embodiments, the gene product may be a transcript. In some embodiments, the gene product may be a polypeptide. In some embodiments, expression of a nucleic acid sequence involves one or more of the following: (1) production of an RNA template from a DNA sequence (e.g., by transcription); (2) processing of the RNA transcript (e.g., by splicing, editing, 5' capping, and / or 3' end formation); (3) translation of the RNA into a polypeptide or protein; and / or (4) post-translational modification of the polypeptide or protein.

[0153] In this context, "encapsulated" means that a substance is completely surrounded by another material.

[0154] As used herein, in vitro refers to events that occur in an artificial environment, such as in a test tube or reactor, in cell culture, etc., rather than in a multicellular organism.

[0155] As used herein, "in vivo" refers to events that occur within multicellular organisms, such as humans and non-human animals. In the context of cell-based systems, the term can be used to refer to events that occur within living cells (as opposed to, for example, in vitro systems).

[0156] A "subject in need thereof" is an individual having a disease, a symptom of a disease, or a predisposition to a disease, and the purpose is to treat, cure, alleviate, relieve, alter, remedy, ameliorate, improve, or influence the disease, the symptoms of a disease, or the predisposition to a disease. In some embodiments, the subject has hypercholesterolemia. In some embodiments, the subject is a mammal. In some embodiments, the subject is a non-human primate. In some embodiments, the subject is a human. Alleviating a disease includes delaying the development or progression of a disease, or reducing the severity of a disease. Alleviating a disease does not necessarily require a cure. In some embodiments, the subject also includes farm animals such as cattle, horses, sheep, goats, pigs; domestic animals such as rabbits, dogs, and cats; laboratory animals, including rodents such as rats, mice, and guinea pigs, etc.

[0157] As used herein, a "pharmaceutical composition" refers to an active agent formulated with one or more pharmaceutically acceptable carriers. In some embodiments, the active agent is present in an amount of a unit dose suitable for administration in a therapeutic regimen that, when administered to a relevant population, shows a statistically significant probability of achieving a predetermined therapeutic effect. In some embodiments, the pharmaceutical compositions can be specifically formulated for administration in solid or liquid form, including pharmaceutical compositions suitable for the following administration routes: oral, such as drenches (aqueous or non-aqueous solutions or suspensions), tablets, such as tablets targeted for buccal, sublingual, and systemic absorption, boluses for application to the tongue, powders, granules, pastes; parenteral, such as by subcutaneous, intramuscular, intravenous, or epidural injection, for example, in the form of a sterile solution or suspension or sustained release formulation; topical, such as in the form of a cream, ointment, or controlled release patch or spray applied to the skin, lungs, or oral cavity; intravaginally or intrarectally, for example, as a pessary, cream, or foam; sublingually; ophthalmically; transdermally; or nasally, pulmonary, and other mucosal surfaces.

[0158] The term "prevent" refers to delaying the onset of one or more symptoms of a particular disease, disorder, or condition, and / or reducing their frequency and / or severity. In some embodiments, prevention is assessed on a population basis, such that an agent is considered to "prevent" a particular disease, disorder, or condition if a statistically significant reduction in the development, frequency, and / or intensity of one or more symptoms of the disease, disorder, or condition is observed in a population susceptible to the disease, disorder, or condition. Prevention can be considered accomplished when the onset of the disease, disorder, or condition has been delayed for a predetermined period of time.

[0159] As used herein, "treating" refers to applying or administering a polypeptide or polynucleotide, or a composition comprising a polypeptide or polynucleotide, to a subject in need thereof.

[0160] As used herein, "deaminase" refers to an enzyme that catalyzes the removal of an amine group from a molecule, or catalyzes deamination (eg, by hydrolysis).

[0161] Compositions for editing PCSK9 gene targets

[0162] The present disclosure relates to compositions that can be used to edit polynucleotides encoding PCSK9, the compositions comprising an adenosine base editor comprising a programmable DNA binding domain and a DNA modifying enzyme, or mRNA encoding the same,

[0163] A guide RNA comprising a backbone structure and a spacer sequence corresponding to the PCSK9 gene, wherein when administered to a mammalian subject, the guide RNA guides the base editor to encode the polynucleotide encoding the PCSK9 protein, thereby achieving base changes in the polynucleotide encoding the PCSK9 protein in the nucleus, and the DNA modification enzyme comprises the amino acid sequence shown in SEQ ID NO: 1 or 2.

[0164] In some embodiments, the programmable DNA binding domain includes a DNA binding protein that can be programmed to target any desired nucleotide sequence within the genome. In order to program the DNA binding protein to bind to the desired nucleotide sequence, the DNA binding protein can be modified to change its binding specificity, such as a zinc finger DNA binding domain, zinc finger nuclease (ZFN) or transcription activator-like effector protein (TALE).

[0165] In some embodiments, the programmable DNA binding domain includes a guide nucleotide sequence-programmable DNA binding protein, in which the "guide nucleotide sequence-programmable DNA binding protein" refers to a protein, polypeptide or domain capable of binding to DNA, and the binding to its target DNA sequence is mediated by a guide nucleotide sequence. Therefore, it should be understood that the guide nucleotide sequence-programmable DNA binding protein is bound to the guide nucleotide sequence."Guide nucleotide" can be an RNA or DNA molecule (e.g., a single-stranded DNA or ssDNA molecule) that is complementary to the target sequence and can guide the DNA binding protein to the target sequence. Therefore, the guide nucleotide sequence-programmable DNA binding protein can be an RNA-programmable DNA binding protein (e.g., Cas9 protein), or an ssDNA-programmable DNA binding protein (e.g., Argonaute protein). "Programmable" means that the DNA binding protein can be programmed to bind to any DNA sequence targeted by the guide nucleotide. Exemplary guide nucleotide sequence-programmable DNA binding proteins include, but are not limited to, Cas9 (e.g., dCas9 and nCas9), saCas9 (e.g., saCas9d, saCas9d, saKKH Cas9), CasX, CasY, Cpf1, C2c1, C2c2, C2c3, Argonaute, and any other suitable protein described herein, or variants thereof.

[0166] In some embodiments, the guide nucleotide sequence-programmable DNA binding protein is Cas9, specifically, the guide nucleotide sequence-programmable DNA binding protein is nCas9, the amino acid sequence of nCas9 is shown in SEQ ID NO.9, and the nucleotide sequence is shown in SEQ ID NO.8.

[0167] In some embodiments, the gene editing is performed in vitro. In some embodiments, the gene editing is performed in cultured cells. In some embodiments, the gene editing is performed in vivo. In some embodiments, the gene editing is performed in a mammal. In some embodiments, the mammal is a human. In some embodiments, the mammal can be a rodent. In some embodiments, the editing is performed ex vivo.

[0168] In some embodiments, the spacer sequence of the guide RNA sequence for editing the polynucleotide encoding PCSK9 used in the compositions described herein is selected from SEQ ID NOs: 10-11. In some embodiments, the guide RNA sequence for editing the polynucleotide encoding PCSK9 used in the compositions described herein is selected from SEQ ID NOs: 12-13. In some embodiments, the composition comprises a nucleic acid encoding a fusion protein described herein and a guide nucleotide sequence described herein. In some embodiments, the composition described herein further comprises a pharmaceutically acceptable carrier. In some embodiments, the nucleobase editor (i.e., fusion protein) and gRNA are provided in two different compositions.

[0169] In some embodiments, the DNA modifying enzyme is adenosine deaminase. In some embodiments, the adenosine deaminase is a variant TA9999 of 005V1 (deaminase 005V1 of CN114634923A, whose amino acid sequence is shown in SEQ ID NO: 1 and whose nucleotide coding sequence is shown in SEQ ID NO: 18), wherein the amino acid sequence of the variant TA9999 is shown in SEQ ID NO: 2 and whose nucleotide coding sequence is shown in SEQ ID NO: 3.

[0170] In some embodiments, the adenosine deaminase comprises an amino acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identical to the amino acid sequence set forth in SEQ ID NO: 1 or 2.

[0171] In some embodiments, the base editor fusion protein does not include a linker. In some embodiments, a linker is present between one or more domains or proteins (e.g., adenosine deaminase, programmable DNA binding protein, and / or NLS). The linker is an amino acid or multiple amino acids (e.g., a peptide or protein). In some embodiments, the linker is a bond (e.g., a covalent bond), an organic molecule, a group, a polymer, or a chemical moiety. In one embodiment, the linker is 5-100 amino acids in length, e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 30-35, 35-40, 40-45, 45-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100-110, 110-120, 120-130, 130-140, 140-150, or 150-200 amino acids in length. In some embodiments, the linker comprises the amino acid sequence SGSETPGTSESATPES (XTEN linker), SGGS, (SGGS)n, (GGGS)n, (GGGGS)n, (G)n, (EAAAK)n, (GGS)n, SGSETPGTSESATPES, (XP)n, or a combination thereof, wherein n is independently an integer between 1 and 30, and wherein X is any amino acid. In some embodiments, n is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15.

[0172] In some embodiments, the linker comprises SGSETPGTSESATPES, SGGSSGSETPGTSESATPESSGGS, SGGSSGGSSGSETPGTSESATPESSGGSSGGS, GGSGGSPGSPAGSPTSTEEGTSESATPESGPGTSTEPSEGSAPGSPAGSPTSTEEGTSTEPSEGSAPGTSTEPSEGSAPGTSESATPESGPGSEPATSGGSGGS, SGSETPGTSESATPES (also known as an XTEN short peptide or XTEN linker), SGGSSGGSSGSETPGTSESATPES, SGGSSGGSSGSETPGTSESATPESSGGSSGGSSGGSSGGS, SGGSSGGSSGSETPGTSESATPESSGGSSGGSSGGSSGGSSGSETPGTSESATPE SSGGSSGGS, PGSPAGSPTSTEEGTSESATPESGPGTSTEPSEGSAPGSPAGSPTSTEEGTSTEP SEGSAPGTSTEPSEGSAPGTSESATPESGPGSEPATS.

[0173] guide RNA

[0174] Some aspects of the present disclosure provide a complex comprising any one of the fusion proteins provided herein and a guide RNA bound to a programmable DNA binding protein (e.g., a Cas9 domain of a base editor fusion protein). In some embodiments, the guiding polynucleotide is a guiding polynucleotide, a guide RNA (gRNA), or a nucleic acid encoding the same.

[0175] In some embodiments, the guide polynucleotide comprises a single nucleic acid sequence. In some embodiments, the guide polynucleotide comprises two nucleic acid sequences. In some embodiments, the length of the guide nucleic acid (e.g., guide RNA) is 15-100 nucleotides and comprises a sequence with at least 10 consecutive nucleotides complementary to the target sequence. In some embodiments, the length of the guide RNA is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides. In some embodiments, the guide RNA comprises a sequence having 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 consecutive nucleotides that are complementary to the target sequence. In some embodiments, the target sequence is a DNA sequence. In some embodiments, the target sequence is a sequence in the genome of a mammal. In some embodiments, the target sequence is a sequence in the genome of a human. In some embodiments, the 3' end of the target sequence is closely adjacent to the typical PAM sequence (NGG). In some embodiments, the guide nucleic acid (e.g., guide RNA) is complementary to a sequence associated with a disease or condition. In some embodiments, the guide nucleic acid (e.g., guide RNA) is complementary to a sequence associated with a disease or condition having a mutation in the PCSK9 gene.

[0176] As used herein, the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. In some instances, vectors are expression vectors that are capable of directing the expression of nucleic acids to which they are operably linked. As used herein, the term "operably linked" means that a target nucleotide sequence is linked to one or more regulatory sequences in a manner that allows the expression of the nucleotide sequence. As used herein, the term "regulatory sequence" includes, but is not limited to, promoters, enhancers, and other expression control elements. Such regulatory sequences are well known in the art and are described, for example, in Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990). Examples of expression vectors include, but are not limited to, plasmid vectors, viral vectors based on vaccinia virus, poliovirus, adenovirus, adeno-associated virus, SV40, herpes simplex virus, human immunodeficiency virus, retroviruses (e.g., murine leukemia virus, spleen necrosis virus, and vectors derived from retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukemia virus, lentivirus, human immunodeficiency virus, myeloproliferative sarcoma virus, and mammary tumor virus), and other recombinant vectors.

[0177] In some embodiments, the vector system comprises one or more vectors comprising: a first regulatory element, which is operably linked to a nucleotide sequence encoding a base editor fusion protein, and a second regulatory element, which is operably linked to a nucleotide sequence encoding a guide RNA.

[0178] Ionizable lipids

[0179] In certain embodiments, compositions disclosed herein can include one or more ionizable lipids, and ionizable lipids refer to lipids containing one or more groups that can be ionized to produce a positive charge in polymer. Ionizable lipids generally have secondary amino, tertiary amino or quaternary amino groups, or specifically alkylated amines, or more specifically monoalkylamine or dialkylamine groups, any one of which can be protonated or alkylated to produce alkylated ammonium groups. Cationic lipids can contain trialkylamine groups, which are necessarily positively charged when combined with lipids. In a specific embodiment, cation or ionizable lipids have dimethylamino or trimethylamino (or dimethylammonium or trimethylammonium) groups. In a specific embodiment, the cationic or ionizable lipids are selected from the group consisting of 1,2-dilinoleyloxy-N,N-dimethylaminopropane DLinDMA, 1,2-dioleyloxy-N,N-dimethylaminopropane DODMA, DLin-MC2-MPZ, 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane DLin-KC2-DMA, 1,2-dioleoyl-3-trimethylammonium-propane Any one or a combination of at least two of DOTAP, 1,1'-(2-(4-(2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazin-1-yl)ethylazanediyl)di-dodecan-2-ol C12-200, 3β[N-N'N'-dimethylaminoethane)-carbamoyl]cholesterol or N-[1-(2,3-dioleoyl chloride)propyl]-N,N,N-trimethylamine chloride DOTMA

[0180] In some embodiments, the compositions disclosed herein comprise one or more ionizable lipids. In principle, there are no particular restrictions on the ionizable lipids of the compositions disclosed herein. In some embodiments, the one or more ionizable lipids are selected from the group consisting of: 3-(didodecylamino)-N1,N1,4-triadecyl-1-piperazineethylamine (KL10), N1-[2-(didodecylamino)ethyl]-N1,N4,N4-triadecyl-1,4-piperazinediethylamine (KL22), 14,25-ditridecyl-15,18,21,24-tetraaza-triadecane (KL25), 14,25-ditridec ... ), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLin-DMA), 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA), heptatriacontane-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butyrate (DLin-MC3-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane Pentyl ring (DLin-KC2-DMA), 1,2-dioleyloxy-N,N-dimethylaminopropane (DODMA), 2-({8-[-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadec-9,12-dien-1-yloxy]propan-1-amine (octyl-CLinDMA), (2R)-2-({8-[-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadec-9,12-dien-1-yloxy]propan-1-amine}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadec-9,12-dien-1-yloxy]propan-1-amine (octyl-CLinDMA(2R)), and (2S)-2-({8-[-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadec-9,12-dien-1-yloxy]propan-1-amine (octyl-CLinDMA(2S)).

[0181] In some embodiments, the ionizable lipid is YolTech-lipid, whose chemical structure is shown below:

[0182]

[0183] phospholipids

[0184] In some embodiments, the helper lipid in the composition is one or more phospholipids. In some embodiments, the phospholipid is selected from the group consisting of 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-di-stearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-di-di-oleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-di-di-palmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-di ... PC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 diether PC), 1-oleoyl-2-cholesteryl hemisuccinyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME16:0PE), 1,2-distearoyl-sn-glycero-3 -phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-diamidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine, rac-(1-glycerol) sodium salt (DOPG), sphingomyelin, and any mixture thereof.

[0185] Exemplary neutral lipids include, for example, dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleoylphosphatidylethanolamine (POPE) and dioleoylphosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidylethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearoyl-2-oleoylphosphatidylethanolamine (SOPE) and 1,2-ditransoleoyl-sn-glycero-3-phosphoethanolamine (trans-DOPE). In one embodiment, the neutral lipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC). In one embodiment, the neutral lipid is selected from DSPC, DPPC, DMPC, DOPC, POPC, DOPE and SM.

[0186] In one embodiment, the neutral lipid is phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylserine (PS), phosphatidic acid (PA), or phosphatidylglycerol (PG).

[0187] Structured lipids

[0188] In some embodiments, the compositions disclosed herein may comprise one or more steroids and their derivatives.

[0189] Without being bound by theory, it is expected that structural lipids can make the amphipathic structure of nanoparticles, such as but not limited to the lipid bilayer structure of nanoparticles stable.Exemplary structural lipids that can be used in conjunction with the present disclosure include but are not limited to cholesterol, coprosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatine, tomatine, ursolic acid, alpha-tocopherol and mixtures thereof.In certain embodiments, structural lipids are cholesterol.In some embodiments, structural lipids include cholesterol and corticosteroids (such as prednisolone (prednisolone), dexamethasone (dexamethasone), prednisone (prednisone) and hydrocortisone (hydrocortisone)) or its combination.

[0190] In some embodiments, the structured lipids include steroids and derivatives thereof. In some embodiments, the steroids and derivatives thereof can be selected from the group consisting of, but not limited to, cholesterol, coprostanol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatine, tomatin, ursolic acid, α-tocopherol, hornane, phytosterol, steroids, and mixtures thereof. In some embodiments, the steroids and derivatives thereof are cholesterol.

[0191] In certain embodiments, the amount of steroid and derivatives thereof (for example, cholesterol) in the compositions disclosed herein is from about 10mol% to about 80mol%, from about 20mol% to about 70mol%, from about 30mol% to about 60mol% or from about 40mol% to about 50mol%. In certain embodiments, the amount of steroid and derivatives thereof in the compositions disclosed herein is from about 25mol% to about 30mol%, from about 30mol% to about 35mol% or from about 35mol% to about 40mol%. In certain embodiments, the amount of steroid and derivatives thereof (for example, cholesterol) in the compositions disclosed herein is about 24mol%, about 29mol%, about 34mol% or about 39mol%. In some embodiments, the amount of steroids and their derivatives in the compositions disclosed herein is at least about 10 mol%, 20 mol%, 25 mol%, 30 mol%, 35 mol%, 40 mol%, 45 mol%, 50 mol%, 55 mol%, 60 mol%, 65 mol%, 70 mol%, 75 mol%, or 80 mol%.

[0192] PEG-lipid

[0193] In some embodiments, the compositions disclosed herein comprise one or more polyethylene glycol (PEG) lipids.

[0194] The term "PEG-lipid" refers to a lipid modified by polyethylene glycol (PEG). Such lipids are also referred to as PEGylated lipids. Non-limiting examples of PEG-lipids include phosphatidylethanolamine and phosphatidic acid, PEG-ceramide conjugates (e.g., PEGCerC14 or PEG-CerC20), PEG-modified dialkylamines, and PEG-modified 1,2-diacyloxypropane-3-amines. For example, PEG lipids can be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or PEG-DSPE lipids. In some embodiments, PEG-lipids include but are not limited to 1,2-dimyristoyl-sn-glyceromethoxypolyethylene glycol (PEGDMG), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[amino(polyethylene glycol)] (PEG-DSPE), PEG-disteryl glycerol (PEG-DSG), PEG-dipalmitoyl, PEG-dioleyl, PEG-distearoyl, PEG-diacylglycamide (PEG-DAG), PEG-dipalmitoylphosphatidylethanolamine (PEG-DPPE), or PEG-1,2-dimyristyloxypropyl-3-amine (PEG-c-DMA). In one embodiment, PEG-lipids are selected from the group consisting of PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, and mixtures thereof. In some embodiments, the lipid portion of the PEG-lipid includes those having a length from about C14 to about C22, preferably from about C14 to about C16. In some embodiments, the PEG portion (e.g., mPEG-NH2) has a size of about 1000, 2000, 5000, 10,000, 15,000, or 20,000 daltons. In some embodiments, the PEG-lipid is PEG2k-DMG. In some embodiments, the one or more PEG lipids of the smLNP composition include PEG-DMPE. In some embodiments, the one or more PEG lipids of the smLNP composition include PEG-DMG.

[0195] In some embodiments, the amount of PEG-lipid in the compositions disclosed herein is from about 0.1 mol% to about 5 mol%, from about 0.5 mol% to about 5 mol%, from about 1 mol% to about 5 mol%, from about 1.5 mol% to about 5 mol%, from about 2 mol% to about 5 mol% mol%, from about 0.1 mol% to about 4 mol%, from about 0.5 mol% to about 4 mol%, from about 1 mol% to about 4 mol%, from about 1.5 mol% to about 4 mol%, from about 2 mol% to about 4 mol%, from about 0.1 mol% to about 4 mol%. In the range of 1% to about 3mol%, from about 0.5mol% to about 3mol%, from about 1mol% to about 3mol%, from about 1.5mol% to about 3mol%, from about 2mol% to about 3mol%, from about 0.1mol% to about 2mol%, from about 0.5mol% to about 2mol%, from about 1mol% to about 2mol%, from about 1.5mol% to about 2mol%, from about 0.1mol% to about 1.5mol%, from about 0.5mol% to about 1.5mol%, or from about 1mol% to about 1.5mol%. In certain embodiments, the amount of PEG-lipid in the lipid composition disclosed herein is about 2mol%. In certain embodiments, the amount of PEG-lipid in the lipid composition disclosed herein is about 1.5mol%.

[0196] In some specific embodiments, the nanoparticle compositions described herein comprise the following lipids: YolTech-lipid; DSPC; cholesterol; and PEG-DMG.

[0197] In some specific embodiments, the molar ratio of YolTech-lipid, DSPC, cholesterol, and PEG-lipid is about 50:10:38.5:1.5.

[0198] Rationale for genome editing to treat diseases caused by polynucleotides encoding PCSK9 protein

[0199] For example, a cytosine base editor can be used to directly introduce a stop codon into the coding sequence of a gene (nonsense mutation) by changing a specific base under the guidance of a gRNA that specifically targets a polynucleotide encoding a PCSK9 protein, resulting in an inability to translate the PCSK9 protein normally. For example, an adenine base editor can be used to edit the start codon of a coding nucleotide, such as ATG→GTG or ATG→ACG, under the guidance of a gRNA that specifically targets a polynucleotide encoding a PCSK9 protein, thereby causing abnormal protein translation; or it can edit and destroy the splice site (the splice donor at the 5' end of the intron or the splice acceptor at the 3' end of the intron), so that the intron sequence is included in the messenger RNA (mRNA) - which may introduce nonsense, frameshift or in-frame insertion / deletion mutations, which produce premature stop codons or amino acid insertions / deletions that destroy protein activity - or exclude exon sequences, which can also introduce nonsense, frameshift or in-frame insertion / deletion mutations, resulting in abnormal PCSK9 protein expression. The above-mentioned base editing ultimately inhibits the endocytosis of LDLR and increases the number of LDLR, thereby enhancing the ability to take up and decompose cholesterol and achieving the treatment of related diseases.

[0200] Pharmaceutical compositions and kits

[0201] The present invention also provides a pharmaceutical composition, which is a pharmaceutical composition for editing the PCSK9 gene target, and the pharmaceutical composition comprises: (a) a first active ingredient, which is a base editor or an expression vector thereof for base editing the PCSK9 gene target, wherein the base editor comprises a programmable DNA binding domain and a DNA modification enzyme, or an mRNA encoding the same, wherein the DNA modification enzyme is an adenosine deaminase, and the adenosine deaminase is a variant TA9999 of 005V1 (deaminase 005V1 of CN114634923A, whose amino acid sequence is shown in SEQ ID NO: 1, and whose nucleotide coding sequence is shown in SEQ ID NO: 18), wherein the amino acid sequence of the variant TA9999 is shown in SEQ ID NO: 2, and its nucleotide coding sequence is shown in SEQ ID NO: 3; and (b) a second active ingredient, which is a guide RNA or an expression vector thereof. The diseases include (but are not limited to): cardiovascular disease (e.g., atherosclerotic cardiovascular disease), hypercholesterolemia, dyslipidemia (e.g., hyperlipidemia), hypertriglyceridemia, inflammation, autoimmune disease, sepsis, tumors, and other diseases related to PCSK9 gene expression. In another preferred embodiment, the disease is hypercholesterolemia or cardiovascular disease.

[0202] Typically, these active ingredients are formulated in a non-toxic, inert, and pharmaceutically acceptable aqueous carrier medium, wherein the pH is generally about 5-8, preferably about 6-8, although the pH value may vary depending on the nature of the substance being formulated and the condition to be treated. The formulated pharmaceutical composition can be administered by conventional routes, including (but not limited to): intratumoral, intraperitoneal, intravenous, or topical administration.

[0203] The pharmaceutical composition of the present invention can be used for gene editing therapy of the PCSK9 gene, and thus can be used to treat diseases caused by abnormal polynucleotides encoding the PCSK9 protein. In addition, other therapeutic agents can also be used simultaneously.

[0204] The pharmaceutical composition of the present invention contains a safe and effective amount (such as 0.001-99wt%, preferably 0.01-90wt%, more preferably 0.1-80wt%) of the above-mentioned active ingredient of the present invention and a pharmaceutically acceptable carrier or excipient. Such carriers include (but are not limited to): saline, buffer, glucose, water, glycerol, ethanol, and combinations thereof. The pharmaceutical preparation should match the mode of administration. The pharmaceutical composition of the present invention can be prepared in the form of an injection, for example, by conventional methods using physiological saline or an aqueous solution containing glucose and other adjuvants. Pharmaceutical compositions such as injections and solutions are preferably manufactured under sterile conditions. The dosage of the active ingredient is a therapeutically effective amount, for example, about 10 micrograms / kg body weight to about 50 mg / kg body weight per day. In addition, the pharmaceutical composition of the present invention can also be used in conjunction with other therapeutic agents.

[0205] When using the pharmaceutical composition, a safe and effective amount of the first active ingredient and the second active ingredient is administered to a mammal, wherein the safe and effective amount is generally at least about 10 μg / kg body weight and, in most cases, does not exceed about 50 mg / kg body weight. Preferably, the dosage is about 10 μg / kg body weight to about 10 mg / kg body weight. Of course, the specific dosage will also take into account factors such as the route of administration and the patient's health condition, which are all within the skill of a skilled physician.

[0206] Generally, the pharmaceutical composition of the present invention can be placed in a sterile container to prepare a medicine kit, which comprises: (c1) a first container, and a first active ingredient located in the first container, the first active ingredient being a base editor or an expression vector thereof for base editing the PCSK9 gene target, the base editor comprising a programmable DNA binding domain and a DNA modification enzyme, or mRNA encoding the same, the DNA modification enzyme being adenosine deaminase, the adenosine deaminase being a variant TA9999 of 005V1 (deaminase 005V1 of CN114634923A, whose amino acid sequence is shown in SEQ ID NO: 1, and whose nucleotide coding sequence is shown in SEQ ID NO: 18), the amino acid sequence of the variant TA9999 being shown in SEQ ID NO: 2, and its nucleotide coding sequence being shown in SEQ ID NO: 3; and (c2) a second container, and a second active ingredient located in the second container, the second active ingredient being a guide RNA or an expression vector thereof, the guide RNA guiding the DNA that specifically binds to the PCSK9 gene.

[0207] Typically, the kit contains one or more unit dosage forms containing a first active ingredient and one or more unit dosage forms containing a second active ingredient.

[0208] As used herein, the term "unit dosage form" refers to a composition prepared into a dosage form required for single use for ease of use, including but not limited to various solid dosage forms (such as lyophilized preparations), liquid dosage forms, and sustained-release preparations.

[0209] The instructions provided by the present invention may include the following description: the method for using the medicine kit is to use the unit dosage form containing the first active ingredient and the unit dosage form containing the second active ingredient at the same time.

[0210] The medicine kit provided by the present invention is prepared by the following steps: placing a preparation containing a first active ingredient and a preparation containing a second active ingredient, as well as instructions, together to form a medicine kit.

[0211] The main advantages of the present invention include:

[0212] (1) The present invention unexpectedly discovered for the first time a composition for editing PCSK9 gene targets, including a base editor and a guide RNA for base editing the PCSK9 gene target. The composition of the present invention can effectively edit or cut the target gene and can be used to treat diseases related to polynucleotides encoding PCSK9 proteins.

[0213] (2) By optimizing the editing system, the base editor used in the present invention has a high editing efficiency at a specific site under the guidance of gRNA that specifically targets the PCSK9 gene. After editing, the levels of LDL-C (low-density lipoprotein cholesterol) and PCSK9 protein are significantly reduced.

[0214] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the invention. The experimental methods in the following examples, for which specific conditions are not specified, are generally based on conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are weight percentages and parts by weight.

[0215] Unless otherwise specified, the reagents and materials in the examples of the present invention are all commercially available products.

[0216] In order to more fully understand the invention described herein, the following examples are set forth.The synthetic examples described in this application are provided to illustrate the compounds and methods provided herein and are not to be construed in any way as limiting the scope thereof.

[0217] Example 1. Design of sgRNA targeting PCSK9 and selection of adenine base editor (ABE)

[0218] 1. hPCSK9-sgRNA was designed based on the human PCSK9 gene locus. The specific sequence and modification method are as follows:

[0219] CCCGCACCUUGGCGCAGCGG GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO. 12), wherein the underlined sequence is the spacer sequence, and the other sequence parts are scaffold sequences.

[0220] The modified hPCSK9-sgRNA sequence is as follows:

[0221] mC*mC*mC*rGrCrArCrCrUrUrGrGrCrGrCrArGrCrGrGrGrUrUrUrUrArGrArGrCrUrArGrArArArUrArGrCrArArGrUrUrArArArArU rArArGrGrCrUrArGrUrCrCrGrUrUrArUrCrArArCrUrUrGrArArArArGrUrGrGrCrArCrCrGrArGrUrCrGrGrUrGrCrU*mU*mU*mU.

[0222] mPCSK9-sgRNA was designed based on the mouse PCSK9 gene locus. The specific sequence and modification method are as follows:

[0223] CCCAUACCUUGGAGCAACGG GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO. 13), wherein the underlined sequence is the spacer sequence, and the other sequence parts are scaffold sequences.

[0224] The modified mPCSK9-sgRNA sequence is as follows: mC*mC*mC*rArUrArCrCrUrUrGrGrArGrCrArArCrGrGrGrUrUrUrArGrArGrCrUrArGrArArArUrArGrCrArArGrUrUrArArArArGrGrCrUrArGrUrCrCrGrUrUrArArArArUrArArGrGrCrUrArGrUrCrCrGrUrUrArUrCrArArCrUrUrGrArArArArGrUrGrGrCrUrArGrUrCrCrGrUrUrArUrCrArArCrUrUrGrArArArArGrUrGrGrCrArCrGrArGrUrUrCrUrGrCrUrUrGrArArArArArGrUrGrGrCrUrUrGrCrUrGrCrUrUrGrCrUrUrCrArArArArGrUrGrGrCrArCrCrGrArGrUrCrGrUrGrCrUrGrCrU*mU*mU*mU.

[0225] In the above sequences, capital nucleotides (A, C, G, and U) indicate ribonucleotides, adenine, guanine, cytosine, and uracil, respectively; m indicates 2'oxymethyl; * indicates phosphorothioate; and r indicates ribonucleotide.

[0226] The hPCSK9-sgRNA was synthesized by Nanjing GenScript Biosynthesis using a chemical synthesis method.

[0227] 2. Selection of Adenine Base Editors (ABEs)

[0228] In order to find an adenine base editor suitable for the PCSK9 gene site, adenosine deaminase 005V1 (deaminase 005V1 described in CN114634923A, whose amino acid sequence is shown in SEQ ID NO: 1, the base editor 005V1-nCas9 obtained by fusion of deaminase 005V1 and nCas9 protein (nCas9 protein amino acid sequence is shown in SEQ ID NO: 9, nucleotide coding sequence is shown in SEQ ID NO: 8) is shown in SEQ ID NO: 19. NO: 20) was subjected to sequence mutation (relative to 005V1, its mutant form is A46C+I47V+T48H+L49N+Q66K+I67R+V68L+Q69H+V104M+C139A+S140Y+M142L+Q148R+P150L+E152L+V153A+F154P+N155G+L163E+N164V+Q165N+P166L) to obtain the deaminase variant TA9999, whose amino acid sequence is shown in SEQ ID NO: 2, and its nucleotide coding sequence is shown in SEQ ID NO: 3. The amino acid sequence of the base editor TA9999-nCas9 obtained by fusion of the deaminase variant TA9999 and nCas9 is shown in SEQ ID NO: 4, and its nucleotide coding sequence is shown in SEQ ID NO: 21.

[0229] Example 2. Synthesis of ionizable lipid Yoltech Lipid (ie, compound 10)

[0230] 7-Butyl-21-(10-butyl-3,9-dioxyidene-2,8-dioxahexadecan-1-yl)-19-[3-(diethylamino)propyl]-8-oxyidene-19-aza-9-oxadocosan-22-yl 5-[(2-butyl-1-oxyoctylene)oxy]pentanoate

[0231]

[0232] Step 1: Synthesis of compound 1-2

[0233] To a 500 mL round-bottom flask, cyclohexyl ester (25.00 g, 249.70 mmol, 1.0 eq), distilled water (20 mL), ethanol (200 mL), and sodium hydroxide (10.99 g, 274.67 mmol, 1.1 eq) were added. After reacting at 70°C for 3 hours, the solvent was removed by concentration under reduced pressure. 200 mL of acetone, tetrabutylammonium iodide (4.61 g, 12.48 mmol, 0.05 eq), and benzyl bromide (51.25 g, 299.64 mmol, 1.2 eq) were then slowly added to the flask. The reaction was then allowed to react at 70°C overnight. The reaction was quenched by the addition of 500 mL of water and extracted twice with 500 mL of ethyl acetate. The organic phases were combined, washed with saturated brine, dried over anhydrous sodium sulfate, concentrated under reduced pressure, and purified by column chromatography to yield 5-hydroxyvalerate benzyl ester (37.00 g, 71.2% yield).

[0234] Step 2: Synthesis of Compounds 1-4

[0235] A 500 ml round-bottom flask was charged with benzyl 5-hydroxyvalerate (37.00 g, 177.67 mmol, 1.0 eq), 2-butyloctanoic acid (35.59 g, 177.67 mmol, 1.0 eq), 250 ml of dichloromethane, and 4-dimethylaminopyridine (21.70 g, 177.67 mmol, 1.0 eq). Finally, 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (51.09 g, 266.50 mmol, 1.5 eq) was added. The mixture was reacted at room temperature for 4 hours, diluted with 500 ml of water, and extracted twice with 500 ml of dichloromethane. The organic phases were combined, washed with saturated brine, dried over anhydrous sodium sulfate, concentrated under reduced pressure, and purified by column chromatography to obtain 5-(benzyloxy)-5-oxypentyl 2-butyloctanoate (64.00 g, 92.2% yield).

[0236] Step 3: Synthesis of Compounds 1-5

[0237] A 250 mL round-bottom flask was charged with 5-(benzyloxy)-5-oxyidenepentyl 2-butyloctanoate (64.00 g, 163.87 mmol, 1.0 eq), methanol (75 mL), and tetrahydrofuran (75 mL). Finally, Pd / C (3.49 g, 32.78 mmol, 0.2 eq, 10% purity) was added. The mixture was reacted at room temperature under an atmospheric pressure of hydrogen for 16 hours. The mixture was filtered and concentrated to yield 5-[(2-butyl-1-oxyoctylene)oxy]pentanoic acid (45.00 g, 91.4% yield).

[0238] Step 4: Synthesis of Compounds 1-7

[0239] At room temperature, 5-[(2-butyl-1-oxyoctyl)oxy]pentanoic acid (10.00 g, 33.29 mmol, 1.0 eq), 2-hydroxymethylpropane-1,3-diol (3.53 g, 33.29 mmol, 1.0 eq), 4-dimethylaminopyridine (0.81 g, 6.66 mmol, 0.2 eq), N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride (9.57 g, 49.94 mmol, 1.5 eq) and N,N-diisopropylethylamine (8.60 g, 66.58 mmol, 2.0 eq) were added to a round-bottom flask containing 100 ml of dichloromethane and stirred at room temperature for 4 hours. The reaction solution was quenched by adding 200 ml of water, extracted twice with 200 ml of dichloromethane, and the organic phases were combined, washed with brine, dried over anhydrous sodium sulfate, filtered, concentrated, and purified by column chromatography to give 2-butyloctanoic acid-18-butyl-8-(hydroxymethyl)-5,11,17-trioxy-6,10,16-trioxatetracosane-1-yl ester (7.80 g, yield 69.9%).

[0240] Step 5: Synthesis of Compound 1-8

[0241] At room temperature, the compound 2-butyloctanoate-18-butyl-8-(hydroxymethyl)-5,11,17-trioxydeca-6,10,16-trioxa-tetracosane-1-yl ester (3.90 g, 5.81 mmol, 1.0 eq) and triethylamine (1.76 g, 17.43 mmol, 3.0 eq) were added to 30 ml of dichloromethane, and methylsulfonic anhydride (2.02 g, 11.62 mmol, 2.0 eq) was slowly added at zero degrees Celsius. The temperature was slowly restored to room temperature and the reaction was allowed to react for 4 hours. The reaction solution was quenched by adding 30 ml of water, extracted twice with 50 ml of dichloromethane respectively, the organic phases were combined, washed with brine, dried over anhydrous sodium sulfate, filtered, concentrated, and purified by column chromatography to give methanesulfonic acid-12-butyl-2-(10-butyl-3,9-dioxy-2,8-dioxahexadecan-1-yl)-5,11-dioxy-4,10-dioxahexadecan-1-yl ester (3.85 g, yield 88.4%).

[0242] Step 6: Synthesis of Compound 1-10

[0243] At room temperature, compound 1-8 (600.0 mg, 0.80 mmol, 1.0 eq), 3-amino-1-propanol (300.0 mg, 3.99 mmol, 5.0 eq), potassium carbonate (280.0 mg, 2.00 mmol, 2.5 eq), and potassium iodide (130.0 mg, 0.80 mmol, 1.0 eq) were added to 10 ml of acetonitrile, protected by nitrogen, heated to 90 degrees Celsius, and reacted for 16 hours. The reaction mixture was concentrated, diluted with water, and extracted three times with ethyl acetate. The organic phases were combined, washed with saturated brine, dried over anhydrous sodium sulfate, concentrated, and purified by column chromatography to obtain the compound 5-[(2-butyl-1-oxyoctyl)oxy]pentanoic acid-12-butyl-2-{[(3-hydroxypropyl)amino]methyl}-5,11-dioxyidene-4,10-dioxaoctadec-1-yl ester (210.0 mg, 36.11%). MS: m / z [M+H] + =728.6.

[0244] Step 7: Synthesis of compound 10

[0245] At room temperature, the compound 2-butyloctanoic acid-8-(10-butyl-3,9-dioxyidene-2,8-dioxahexadecan-1-yl)-14-ethyl-5-oxyidene-10,14-diaza-6-oxahexadecan-1-yl ester (500.0 mg, 0.64 mmol, 1.0 eq), 2-butyloctanoic acid-9-bromononyl ester (390.0 mg, 0.96 mmol, 1.5 eq), potassium carbonate (270.0 mg, 1.92 mmol, 3.0 eq), potassium iodide (110.0 mg, 0.64 mmol, 1.0 eq) were added to 20 ml of acetonitrile, protected by nitrogen, heated to 90 degrees Celsius, and reacted overnight. The reaction mixture was concentrated, diluted with water, and extracted three times with dichloromethane. The organic phases were combined, washed with saturated brine, dried over anhydrous sodium sulfate, concentrated, and purified by column chromatography to obtain 7-butyl-21-(10-butyl-3,9-dioxyidene-2,8-dioxahexadecan-1-yl)-19-[3-(diethylamino)propyl]-8-oxyidene-19-aza-9-oxadocosan-22-yl 5-[(2-butyl-1-oxyoctyl)oxy]pentanoate (132.8 mg, 18.8% yield). MS: m / z [M+H] + =1107.9. 1 H NMR(300MHz, CDCl3)δ4.15-4.01(m,10H),3.44-3.20(m,4H),2.71-2.50(m,6H), 2.39-2.23(m,12H),2.02-1.40(m,28H),1.38-1.22(m,48H),0.92-0.75(m,18H).

[0246] Example 3. Cell-level PCSK9 gene base editing experiment

[0247] The DNA transcription template of TA9999-nCas9 mRNA (SEQ ID NO.5) was synthesized by Nanjing GenScript Biotechnology and used In vitro transcription was performed using the T7 High Yield RNA Synthesis Kit (NEB, E2040S) to generate TA9999-nCas9 mRNA. In this example, the adenine base editor ABE8e (amino acid sequence shown in SEQ ID NO: 14, nucleotide coding sequence shown in SEQ ID NO: 15) was used as a comparison. The ABE8e plasmid was purchased from Addgene (Plasmid, #138489) and expressed and purified in the laboratory to generate ABE8e mRNA. This example used the modified hPCSK9-sgRNA described in Example 1.

[0248] HepG2 cells (purchased from ATCC) were seeded in DMEM medium (Gibco, 11965092) supplemented with 10% FBS (v / v) and 1% Penicillin Streptomycin (v / v) (Gibco, 15140122) and cultured in a 37°C cell culture incubator with 5% CO2. The cells for transfection were seeded in 96-well cell culture plates the day before and cultured. The cells were observed the next day. When the cells grew to a cell density of approximately 80%, TA9999-nCas9 mRNA and hPCSK9-sgRNA were delivered into the cells using LNP technology. The amounts of TA9999-nCas9 mRNA and hPCSK9-sgRNA used per well were as follows:

[0249] Table 1

[0250]

[0251] Preparation of LNP@mRNA: A four-component LNP lipid, including Yoltech Lipid, DSPC, cholesterol, and PEG-DMG, was dissolved in anhydrous ethanol at a molar ratio of 50:10:38.5:1.5. TA9999-nCas9 mRNA and hPCSK9-sgRNA (mass ratio 1:1), prepared according to the amounts in Table 1, were dissolved in 100 mM enzyme-free citrate buffer, pH 4 (RNA concentration 0.2 mg / mL). The ethanolic lipid carrier solution was mixed with the mRNA buffer at a 1:3 (volume / volume) ratio (where the mass ratio of total lipid to mRNA was 40:1). Nucleic acid lipid nanoparticles were obtained by using a microfluidic nanomedicine manufacturing system (NanoAssemblr Ignite, Canada) at a flow rate of 12 ml / min. The obtained nucleic acid lipid nanoparticles were immediately diluted 40 times the volume into 1× DPBS buffer. Cells were collected 48 hours after LNP lipid transfection to detect editing efficiency.

[0252] The collected cells were subjected to genomic extraction (TIANGEN, DP304-03), and primers were designed according to experimental requirements. The identification primer sequences used were hPCSK9-F (SEQ ID NO: 6) and hPCSK9-R (SEQ ID NO: 7).

[0253] Using the genome as a template, PCR amplification of the sequence near the target site was performed. The system used for target site sequence amplification was as follows: 2× Taq Master Mix (Vazyme, P112-03) 25 μL; Primer-F (10 pmol / μL) 1 μL; Primer-R (10 pmol / μL) 1 μL; Template 1 μL; ddH2O was added to 50 μL. The amplified PCR products were used for high-throughput deep sequencing (Genwizhi Biotechnology Co., Ltd.) or Sanger sequencing (Boshang Biotechnology (Shanghai) Co., Ltd.) to identify the editing efficiency ( Figure 1 ), analysis showed that the editing activity when the mass of ABE mRNA and sgRNA was 0.5 ng per well was much higher than that when the mass of both was 0.25 ng. When both doses were used, the editing activity of TA9999-nCas9 at the target site was significantly higher than that of ABE8e (blank control, ABE mRNA and sgRNA were replaced with the same dose of PBS).

[0254] The next step was to test the delivery dose. Different doses (see the table below) were set for LNP delivery experiments, and the editing efficiency and protein expression were measured.

[0255] Table 2

[0256]

[0257]

[0258] The PCSK9 protein content in total cell protein was detected using a human PCSK9 ELISA kit (Abcam, Cat No. ab209884). The results are shown in Table 2 and Figure 2 Analysis showed that when the total addition amount (total dose) of TA9999-nCas9 mRNA and hPCSK9-sgRNA was 2 ng / well, the editing efficiency reached 60%, when the addition amount was 4 ng / well, the editing efficiency reached 75%, when the addition amount was 8 ng / well, the editing activity was close to 90%, and when the addition amount was 16 ng / well, it reached a saturated editing efficiency of up to 95%, with a PCSK9 protein content of only 37 ng / ml.

[0259] Example 4. PCSK9 gene base editing experiment in animals

[0260] A lipid nanoparticle formulation (LNP formulation) loaded with TA9999-nCas9 and mPCSK9-sgRNA was obtained according to the method of Example 3. For comparison, a lipid nanoparticle formulation (LNP formulation) containing ABE8e mRNA and mPCSK9-sgRNA was also prepared according to the method of Example 3. The sgRNA in this example was modified according to the modification method of Example 1.

[0261] Nine C57BL / 6 mice aged 6-7 weeks and weighing about 20 g (purchased from Jicui Yaokang) were used as experimental subjects and randomly divided into an experimental group (n=3 in each of the TA9999-nCas9 and ABE8E groups) and a control group (n=3).

[0262] The LNP preparation was administered to C57BL / 6 mice (purchased from Jicui Yaokang) by intravenous injection (IV) at 0.05mpk and 2mpk of total RNA. One week after administration, the mice were euthanized and liver tissues were collected. Genomic DNA was extracted, and deep sequencing analysis was performed on the mPCSK9 gene site to determine the base editing activity (blank control, ABEmRNA and mPCSK9-sgRNA were replaced with the same dose of PBS) ( Figure 3 ), and the assay primers used were as follows: upstream primers mPCSK9-F (SEQ ID NO: 16) and mPCSK9-R (SEQ ID NO: 17).

[0263] After high-throughput deep sequencing (Genwizhi Biotechnology Co., Ltd.), the editing efficiency of each group was found as shown in the following table:

[0264]

[0265] Analysis showed that TA9999-nCas9 and mPCSK9-sgRNA showed efficient editing activity on PCSK9 sites, with editing activities reaching 33.6% (0.05mpk), 45% (2mpk) ( Figure 3 ), at the same dose (0.05mpk), the editing efficiency mediated by TA9999-nCas9 was significantly higher than that of ABE8e.

[0266] Blood samples were also collected from mice to detect LDL-C and PCSK9 protein levels (injection dose was 0.05 mpk). The administration time was the morning of the day, and the LDL-C and PCSK9 protein levels in the blood of mice on the day of administration were defined as 100%. All mice were fasted for 4-5 hours at 1-6, 12, and 15 months after the first administration, and then blood was collected from the eye sockets. After separating the plasma, the LDL-C level was detected, and the PCSK9 protein content was detected using a mouse PCSK9 ELISA kit (Abcam, Cat No. ab215538). Analysis found that compared with the basal PCSK9 protein level, its level decreased by 80% one month after administration, and at 15 months after administration, the PCSK9 protein level was still only about 20%. One month after administration, the LDL-C level was significantly reduced to about 40% compared with the basal level. After 12 months after administration, the LDL-C level was still significantly lower than 40% ( Figure 4 ).

[0267] A lipid nanoparticle preparation (LNP preparation) consisting of cationic lipid ALC-0315 (purchased from Avituo (Shanghai) Pharmaceutical Technology Co., Ltd.), DSPC, cholesterol, PEG-DMG, and TA9999-nCas9 mRNA and mPCSK9-sgRNA (modified using the modification method of Example 1) was also prepared in the above proportions and manner as a comparison. C57BL / 6 mice were randomly divided into a control group (n=3), a YolTech-lipid group, and an ALC-0315 group. The mice were injected intravenously into the tail of the mice (injection dose of 0.1 mpk) according to the above method, and the editing activity caused by the LNP preparation in each group was measured. The test results are shown in FIG. Figure 5 As shown, analysis shows that the editing activity caused by the LNP preparation of YolTech-lipid can reach more than 60%, while the editing activity caused by the LNP preparation of ALC-0315 is only about 20%.

[0268] Example 5. PCSK9 gene editing in a non-human primate model

[0269] Six cynomolgus macaques weighing 3-4 kg (purchased from Lingkang Sinoco Biotechnology Co., Ltd., Nanning, Guangxi Province) were used. The animals were quarantined and acclimated for 14 days before use. The room temperature was maintained at 18°C-26°C, the relative humidity was 40-70%, and the light cycle was 12 hours per day with alternating light and dark. The animals had free access to water during the experiment.

[0270] According to the method of Example 3, a lipid nanoparticle formulation (LNP formulation) was prepared with YolTech-lipid, DSPC, cholesterol, PEG-DMG, TA9999-nCas9 mRNA and hPCSK9-sgRNA (SEQ ID NO. 12), wherein the hPCSK9-sgRNA was chemically modified as in Example 1 and administered to cynomolgus monkeys by intravenous injection at a dose of 3 mpk. Two weeks later, a biopsy was performed to evaluate base editing, and the editing activity was detected by NGS sequencing. The analysis found that the editing activity was 76.22% ( Figure 6 ).

[0271] Taking the day of administration as day 0, the PCSK9 protein content in the plasma of crab-eating macaques was detected to be around 62ng / ml 3 days before administration; blood was collected 3 days, 67 days, 3 months, 6 months, and 9 months after the first administration, and after plasma separation, the PCSK9 protein level was detected using a human PCSK9 ELISA kit (Abcam, Cat No.ab209884). The results showed that the PCSK9 protein level in the body decreased significantly from 3 days to 9 months after administration. At the 9th month, the PCSK9 protein content in the plasma decreased by more than 70% relative to the basal concentration and maintained at a level of 20ng / ml ( Figure 7 ).

[0272] Sequence information:

[0273]

[0274]

[0275]

[0276]

[0277]

[0278]

[0279]

[0280]

[0281]

[0282]

[0283]

[0284]

[0285]

[0286]

[0287]

[0288] The descriptions presented in the above exemplary embodiments are only intended to illustrate the technical solutions of the present invention and are not intended to be exhaustive or to limit the present invention to the precise forms described. Obviously, it is possible for a person of ordinary skill in the art to make many changes and variations based on the above teachings. The exemplary embodiments are selected and described to explain the specific principles of the present invention and its practical applications, so that other persons skilled in the art can easily understand, implement and utilize the various exemplary embodiments of the present invention and its various selected forms and modified forms. The scope of protection of the present invention is intended to be defined by the scope of the claims and their equivalents.

[0289] Various modifications and variations of the methods, pharmaceutical compositions and kits described herein will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the present invention has been described in conjunction with specific embodiments, it will be understood that the present invention is capable of further modifications and that the claimed invention should not be unduly limited to such specific embodiments. In fact, various variations of the described modes for implementing the present invention that are apparent to those skilled in the art are intended to fall within the scope of the present invention. This application is intended to cover any variations, uses or changes that are generally consistent with the principles of the present invention, including those that are not within the scope of the present invention but are within the known and commonly used technical means in the field to which the present disclosure belongs and that can be applied to the essential features set forth above.

Claims

1. A composition for editing PCSK9 gene targets, characterized in that include: (a) a first active ingredient, which is a base editor for base editing the PCSK9 gene target or an expression vector thereof, wherein the base editor comprises a programmable DNA binding domain and a DNA modifying enzyme, or a nucleotide sequence encoding the same, wherein the DNA modifying enzyme is adenosine deaminase, and the adenosine deaminase is a variant of 005V1, TA9999, and the amino acid sequence of the variant TA9999 is shown in SEQ ID NO: 2; (b) a second active ingredient, wherein the second active ingredient is a guide RNA or an expression vector thereof, and the guide RNA guides the base editor to specifically modify the PCSK9 gene.

2. A medicine box comprising: (c1) a first container, and a first active ingredient in the first container, wherein the first active ingredient is a base editor for base editing the PCSK9 gene target or an expression vector thereof, wherein the base editor comprises a programmable DNA binding domain and a DNA modifying enzyme, or a nucleotide sequence encoding the same, wherein the DNA modifying enzyme is adenosine deaminase, and the adenosine deaminase is a variant of 005V1, TA9999, and the amino acid sequence of the variant TA9999 is shown in SEQ ID NO: 2; and (c2) a second container, and a second active ingredient located in the second container, wherein the second active ingredient is a guide RNA or an expression vector thereof, and the guide RNA guides the base editor to specifically bind to the DNA of the PCSK9 gene.

3. A base editing system, characterized in that include: (1) an adenosine base editor or an expression vector thereof, wherein the base editor comprises a programmable DNA binding domain and a DNA modifying enzyme, or a nucleotide sequence encoding the same, wherein the DNA modifying enzyme is an adenosine deaminase, and the adenosine deaminase is a variant of 005V1, TA9999, and the amino acid sequence of the variant TA9999 is shown in SEQ ID NO: 2; (2) A guide RNA or an expression vector thereof, wherein the guide RNA guides the base editor to specifically bind to the target site of the PCSK9 gene.

4. A carrier, characterized in that The carrier comprises: (1) a first regulatory element, wherein the first regulatory element is operably linked to a nucleotide sequence encoding a base editor, wherein the base editor comprises a programmable DNA binding domain and a DNA modifying enzyme, wherein the DNA modifying enzyme is adenosine deaminase, and the adenosine deaminase is a variant TA9999 of 005V1, and the amino acid sequence of the variant TA9999 is shown in SEQ ID NO: 2; and (2) a second regulatory element, which is operably linked to a nucleotide sequence encoding a guide RNA.

5. A cell, characterized in that The cell is obtained by introducing the composition of claim 1, the base editing system of claim 3, or the vector of claim 4 into the cell or its progenitor cell.

6. A delivery system, characterized in that The delivery system comprises the composition of claim 1 or the base editing system of claim 3 or the vector of claim 4.

7. A kit, characterized in that Comprising the composition of claim 1, the base editing system of claim 3, the vector of claim 4, or the delivery system of claim 6.

8. A cell preparation, characterized in that Comprising the cell of claim 5.

9. A lipid nanoparticle composition, characterized in that It includes an ionizable lipid or a pharmaceutically acceptable salt, tautomer, solvate, chelate, or non-covalent complex thereof, as well as the composition of claim 1, the base editing system of claim 3, the vector of claim 4, and the delivery system of claim 6.

10. A pharmaceutical composition, characterized in that Comprising an ionizable lipid or a pharmaceutically acceptable salt, stereoisomer, tautomer, solvate, chelate, non-covalent complex or a precursor thereof, and the composition of claim 1, the base editing system of claim 3, the vector of claim 4, the delivery system of claim 6, and a pharmaceutically acceptable excipient, carrier or diluent.

11. A pharmaceutical preparation, characterized in that Comprising an ionizable lipid or a pharmaceutically acceptable salt, stereoisomer, tautomer, solvate, chelate, non-covalent complex or a precursor thereof, and the composition of claim 1, the base editing system of claim 3, the vector of claim 4, the delivery system of claim 6, and a pharmaceutically acceptable excipient, carrier or diluent; or the pharmaceutical preparation comprises the lipid nanoparticle composition of claim 9, and a pharmaceutically acceptable excipient, carrier or diluent.

12. Use of the composition of claim 1, the base editing system of claim 3, the vector of claim 4, the cell of claim 5, the delivery system of claim 6, the cell preparation of claim 8, the lipid nanoparticle composition of claim 9, or the pharmaceutical composition of claim 10 in the preparation of a medicament for treating a disease associated with a polynucleotide encoding a PCSK9 protein, wherein the disease is selected from the group consisting of cardiovascular disease, hypercholesterolemia, dyslipidemia, and hypertriglyceridemia.

13. A method for editing the genome of a cell for non-therapeutic purposes, characterized in that: Comprising providing the cell with the composition according to claim 1, the base editing system according to claim 3, the vector according to claim 4, the delivery system according to claim 6, the lipid nanoparticle composition according to claim 9, the pharmaceutical composition according to claim 10, or the pharmaceutical preparation according to claim 11.

Images