A gene editing method and application for constructing hypoxia-resistant Megalobrama amblycephala by targeting the mylipb gene
Through CRISPR/Cas9 technology, the mylipb gene of tufts was targeted to edit, which solved the problem of tufts not tolerate hypoxia, achieved rapid and efficient breeding effects, and obtained new germplasm materials that were resistant to hypoxia.
Patent Information
- Application Number
- CN202411034146.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-30
- Publication Date
- 2025-09-02
- Estimated Expiration
- 2044-07-30
AI Technical Summary
The rogue is not resistant to hypoxia and is prone to death due to hypoxia. The existing technology is difficult to effectively enhance its hypoxia tolerance through gene editing methods, resulting in losses in the breeding industry. The traditional breeding methods have a long cycle and low efficiency.
The CRISPR/Cas9 system was used to target the editing of the mylipb gene, and specific gRNA was designed and microinjected with the Cas9 protein composition into the fertilized egg. The mylipb gene knockout individuals were screened, and the hypoxia-resistant mylipb+/mylipb-genotype heterozygote was obtained through hybridization.
It significantly improves the hypoxia tolerance of the slug head bream, shortens the breeding cycle, improves breeding efficiency, reduces time and cost, and obtains new germplasm materials with enhanced low-oxygen resistance performance.
Smart Images

Figure CN118956867B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of genetic engineering, and in particular to a gene editing method and application for constructing hypoxia-resistant Megalobrama amblycephala by targeting the mylipb gene. Background Art
[0002] Megalobrama amblycephala, also known as Wuchang fish, is a key freshwater aquaculture species in my country. Its rapid growth, high survival rate, and low production costs are increasingly prominent. Since the 1960s, it has been widely popular and has been increasingly farmed. In 2019, production reached 762,800 tons, ranking seventh among freshwater aquaculture fish in China, making it one of the country's most important aquaculture species.
[0003] In aquaculture, fish often encounter stressors such as high temperatures, crowding, hypoxia, and bacterial invasion, sometimes resulting in severe losses. In addition to these tangible external stressors, growth-related genetic regulatory mechanisms also limit annual fish production. Compared to other commonly farmed fish (carp and crucian carp), the amblycephala bream (Gallus amblycephala) is less tolerant to hypoxia and is highly susceptible to hypoxia-induced mortality, causing losses to the aquaculture industry. With the emergence of inbreeding depression, the development of new Gallus amblycephala germplasm with hypoxia tolerance has become increasingly valuable.
[0004] The frequency of spontaneous mutations in farmed fish is very low, usually less than 10 -6 , it needs to exist for a very long time or in a large population. Even if it occurs naturally, it is difficult to screen and obtain. Mutant families with genes related to important economic traits are often hard to come by, and the breeding cycle is long, which seriously hinders the pace of fish breeding. Therefore, gene editing and transgenics are important research directions in the field of fish breeding. However, at present, there are no reports on enhancing the hypoxia tolerance of the bighead carp through gene editing, or constructing new hypoxia-tolerant germplasm of the bighead carp. Summary of the Invention
[0005] The present invention discovered for the first time in research that editing the mylipb gene of the amblycephalic bream can enhance its hypoxia tolerance. Based on this, the present invention provides a method for gene editing the mylipb gene of the amblycephalic bream using the CRISPR / Cas9 system, and obtained a heterozygous amblycephalic bream with normal growth and development and greater hypoxia tolerance, thereby revealing the key regulatory role of the mylipb gene in the hypoxia tolerance of the amblycephalic bream.
[0006] The technical solution of the present invention is achieved as follows:
[0007] In a first aspect, the present invention provides a gRNA targeting the mylipb gene (NCBI Gene ID: 125243060), which targets the third exon of the mylipb gene, and the gRNA contains a targeting sequence as shown in SEQ ID NO: 1.
[0008] In a second aspect, the present invention provides a composition comprising the gRNA targeting the mylipb gene and the Cas9 protein; the composition is used to knock out the mylipb gene.
[0009] In a third aspect, the present invention provides a gene editing method targeting the mylipb gene of Megalobrama amblycephala, comprising the steps of:
[0010] (a1) Designing the mylipb gene target site, whose targeting sequence is shown in SEQ ID NO: 1;
[0011] (a2) Designing gRNA-specific primers based on the mylipb gene target sequence, performing PCR amplification to obtain template DNA, and then in vitro transcription using T7 polymerase to prepare gRNA for the CRISPR / Cas9 system;
[0012] (a3) The combination of gRNA and Cas9 protein was microinjected into wild-type amblycephalic bream fertilized eggs in vitro, and the F0 generation with mylipb gene knockout was screened by genotyping.
[0013] In some preferred embodiments, the template for PCR amplification in step (a2) is pUC19-gRNA plasmid, and the primer sequences are shown in SEQ ID NOs: 2-3, respectively.
[0014] In some preferred embodiments, the wild-type amblycephala fertilized egg in step (a3) is a fertilized egg at the I-cell stage.
[0015] In some preferred embodiments, the concentration of gRNA in the composition in step (a3) is 200 ng / μl, and the concentration of Cas9 protein is 500 ng / μl.
[0016] In a fourth aspect, the present invention provides the use of a gene-knockout Megalobrama amblycephala constructed according to the gene editing method targeting the mylipb gene of Megalobrama amblycephala in studying the biological function of the mylipb gene.
[0017] In a fifth aspect, the present invention further provides a method for constructing hypoxia-resistant Megalobrama amblycephala by knocking out the mylipb gene, comprising the steps of:
[0018] (b1) knocking out the wild-type mylipb gene of Megalobrama amblycephala according to the gene editing method targeting the mylipb gene of Megalobrama amblycephala
[0019] mylipb gene of bream;
[0020] (b2) mating male and female individuals of the screened F0 generation with mutations to obtain the F1 generation, and the amblycephala with mylipb gene mutation detected by genotype in the F1 generation is the hypoxia-resistant amblycephala.
[0021] In some preferred embodiments, the step (b2) includes: detecting the genotype of the F1 generation as mylipb + / mylipb - The heterozygous genotype of the bighead carp is hypoxia-tolerant.
[0022] In a sixth aspect, the present invention provides an application of the mylipb gene in improving the hypoxia tolerance of Megalobrama amblycephala, comprising: improving the hypoxia tolerance of Megalobrama amblycephala by knocking out the mylipb gene.
[0023] The beneficial effects of the present invention include at least the following:
[0024] (1) The present invention uses CRISPR / Cas9 technology to achieve the first specific knockout of the mylipb gene in the amblycephalic bream, obtaining a mylipb gene deletion mutant that can grow and develop normally.
[0025] (2) This invention reveals for the first time that the deletion of the mylipb gene can significantly improve the tolerance of the amblycephalic bream to hypoxia. At the same time, based on CRISPR / Cas9 technology, a new germplasm material of the amblycephalic bream with enhanced hypoxia tolerance was successfully cultivated. Compared with traditional breeding methods, this invention demonstrates significant advantages, achieving high precision in genetic modification, enabling rapid and accurate targeted modification of biological traits, greatly shortening the breeding cycle, improving breeding efficiency, and reducing time costs. BRIEF DESCRIPTION OF THE DRAWINGS
[0026] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0027] Figure 1 The target site for mylipb gene editing by the CRISPR / Cas9 system of the present invention;
[0028] Figure 2 The results of agarose gel electrophoresis of wild-type Megalobrama amblycephala and F1 heterozygous Megalobrama amblycephala of the present invention are as follows;
[0029] Figure 3 This is the result of comparing the target site gene sequences of the wild-type amblycephala and the F1 generation heterozygous amblycephala of the present invention;
[0030] Figure 4 It is a control of the wild-type amblycephala and the F1 generation heterozygous amblycephala under hypoxic conditions;
[0031] Figure 5 1 is a survival rate curve of the wild-type amblycephala and the F1 generation heterozygous amblycephala under normoxia (Nor in the figure represents the normoxia treatment group) and hypoxia (Hyp in the figure represents the hypoxia treatment group) conditions of the present invention;
[0032] Figure 6 These are the results of detecting the transcription levels of hypoxia downstream genes in the wild-type amblycephala and the F1 generation heterozygous amblycephala of the present invention under normoxic and hypoxic conditions, respectively. DETAILED DESCRIPTION
[0033] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and in no way limit the scope of protection of the present invention. The experimental methods for which detailed conditions are not specified in the following examples are generally carried out under conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. The experimental materials used in the examples of the present invention can be obtained from commercial channels unless otherwise specified. The experimental methods in the following examples, unless otherwise specified, are all conventional methods. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial channels.
[0034] Experimental Materials:
[0035] In the present invention, wild-type male and female parents of Megalobrama amblycephala are raised at the aquatic breeding base of Huazhong Agricultural University. Embryos used for microinjection of Megalobrama amblycephala are obtained by artificial breeding and spawning of sexually mature male and female parents.
[0036] Example 1: Construction of CRISPR / Cas9 system
[0037] (1) Design of mylipb gene target
[0038] In the third exon of the mylipb gene of the amblycephalic bream, the target site of the CRISPR / Cas9 system gene was designed as follows Figure 1 shown.
[0039] The targeting sequence of the mylipb gene of Megalobrama amblycephala is 5'-GGGCTCTTGACCGTAGATCT-3' (see SEQ ID NO: 1).
[0040] (2) Preparation of mylipb gRNA
[0041] Upstream and downstream primers for gRNA synthesis were designed based on the mylipb gene target (sequences are shown in the table below). The upstream primer is gRNA-F, which contains the T7 promoter and the mylipb gene targeting sequence; the downstream primer is the conservative primer gRNA-R. Primers were synthesized by Wuhan Tianyi Huayu Gene Technology Co., Ltd.
[0042] PCR amplification was performed using gRNA-F and gRNA-R as primers and pUC19-gRNA vector as a template. The pUC19-gRNA vector in the examples is referenced in Chang N, Sun C, Gao L, Zhu D, Xu X, Zhu X, Xiong JW, Xi JJ. Genome editing with RNA-guided Cas9 nuclease in zebrafish embryos, Cell Res, 2013, 23(4): 465-472. The public can obtain this biological material from the Institute of Hydrobiology, Chinese Academy of Sciences. This biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes.
[0043]
[0044] The PCR reaction system is:
[0045]
[0046] The reaction conditions are:
[0047]
[0048] 5 μL of the PCR reaction product was subjected to 1.5% agarose gel electrophoresis. After band size verification, the PCR product was purified and recovered, and the concentration of the recovered product was measured using a Biophotometer spectrophotometer. Mylipb gRNA was in vitro transcribed according to the TranscriptAid T7 High Yield Transcription Kit (purchased from Fermentas) and purified using lithium chloride precipitation.
[0049] The lithium chloride precipitation method involves adding 1 μl of DNase I to the mylipb gRNA in vitro transcription system and incubating for 15 minutes to remove residual DNA. The reaction is terminated by adding 2 μl of 0.2 M EDTA. Then, 2.5 μl of 4 M lithium chloride and 75 μl of pre-chilled anhydrous ethanol are added and the mixture is allowed to precipitate at -20°C for 16 hours. The precipitate is collected by centrifugation, washed with 50 μl of 70% (v / v) pre-chilled ethanol, centrifuged to remove the ethanol, and dissolved in 25 μl of DEPC water. A 1 μl aliquot is collected for RNA concentration and quality verification by 1.5% agarose gel electrophoresis. The aliquot is then stored at -80°C until use.
[0050] Example 2: Construction of mylipb gene knockout Megalobrama amblycephala
[0051] (1) Microinjection
[0052] At the same time, eggs and sperm of mature amblycephala parents were collected and microinjected after in vitro artificial fertilization. The injection system was prepared by mixing gRNA and Cas9 protein (purchased from Novoprotein), in which the final concentration of gRNA was 200ng / μl, and the final concentration of Cas9 protein was 500ng / μl. At the same time, phenol red with a final concentration of 0.2% (M / V) was added as an indicator. The experimental samples were injected into the fertilized eggs of amblycephala at the I-cell stage and spread in a culture dish using the American Warner PLI-100A pressure microinjector. The injection was completed within 40 minutes after the eggs were fertilized. 1000-2000 fertilized eggs can be injected with each 5ul mixed reagent. After the injection is completed, the fertilized eggs are placed in oxygenated water at a temperature of 23-28°C and incubated.
[0053] (2) Screening of F0 generation mutant individuals with mylipb gene knockout in Megalobrama amblycephala
[0054] The genomic DNA of the surviving individuals of Megalobrama amblycephala after step (1) was extracted, and the gene sequences nearby were amplified by PCR using target site detection primers (mylipb-F and mylipb-R).
[0055] name SEQ ID NO. Sequence(5'-3') mylipb-F 4 ACATTTGTTTCTGATGCATGTGAAGG mylipb-R 5 ACCATACACTTCTCAGTGCCCTTAC
[0056] The PCR reaction system is:
[0057]
[0058] The reaction conditions are:
[0059]
[0060]
[0061] After PCR is completed, 10 μL of PCR product is taken for 2.5% agarose gel electrophoresis identification and gel purification, and the product is sequenced and identified using target detection primers, such as Figure 3 As shown, the individual whose sequence was deleted by 7 bases compared with the wild-type amblycephalic bream was identified as the F0 generation mylipb gene mutant amblycephalic bream.
[0062] (3) Analysis of the genotype of the F1 generation mylipb gene mutant
[0063] After the F0 generation of mutant bream reached sexual maturity, they were mated to obtain F1 generation individuals. The genotypes of the F1 generation with the mylipb mutation were then analyzed in detail.
[0064] After extracting genomic DNA from F1 individuals, PCR amplification and product sequencing were performed using target detection primers (mylipb-F and mylipb-R). The amplified product was ligated into the pMD18-T vector (purchased from Takara) and sequenced. The mylipb gene sequence of the F1 mutant individuals obtained by sequencing was compared with that of the wild-type mylipb gene.
[0065] The sequencing peak diagram of the F1 generation mylipb gene mutant bream showed a double peak at the deletion position, indicating that the bream individual was a heterozygote for the mylipb gene mutation, and its genotype was mylipb + / mylipb - .
[0066] Example 3 Phenotypic Identification
[0067] The F1 generation of Megalobrama amblycephala was cultured indoors. When the F1 generation grew to 3 months old (3 mpf, 3 months after fertilization), the genotypes were identified and wild-type and mutant heterozygous Megalobrama amblycephala with the same weight were selected. Their corresponding genotypes were mylipb + / mylipb + 、mylipb + / mylipb - . Add 400 ml of oxygen-saturated aerated water into a 500 ml conical flask, and place three fish in each conical flask. Set up 10 replicates for each group with a total of 30 fish. The normoxic control group was set at a temperature of 28°C, an oxygen concentration of 21% VOL, and a carbon dioxide concentration of 5% VOL. The hypoxic experimental group was placed in a Ruskinn Invivo2I-400 hypoxic incubator set at a temperature of 28°C, an oxygen concentration of 10% VOL, and a carbon dioxide concentration of 5% VOL. The fish deaths were counted every 15 minutes and photographed and recorded.
[0068] The time it takes for the floating head to occur can be used to directly evaluate the hypoxia tolerance of Megalobrama amblycephala. Figure 4 As shown, mylipb + / mylipb - The hypoxia tolerance of heterozygous amblycephalic bream was significantly improved.
[0069] Survival statistics such as Figure 5 As shown, under low oxygen pressure, mylipb + / mylipb - The survival rate of mylipb genotype was significantly higher than that of wild type. + / mylipb - The hypoxia tolerance of heterozygous amblycephalic bream was significantly improved.
[0070] Example 4 Detection of transcriptional activity of hypoxia downstream genes
[0071] This example quantitatively measured the differences in transcription levels of the hypoxia downstream genes phd3, glut1, pkd2, and vegfa between the wild-type and heterozygous mylipb gene. These hypoxia downstream genes are closely linked to the hypoxia tolerance regulatory mechanism. They participate in hypoxia tolerance regulation through different mechanisms and pathways, jointly maintaining the survival and adaptation of cells in a hypoxic environment. When the transcription level of hypoxia downstream genes is higher, it represents stronger hypoxia tolerance. The test results can also indirectly reveal whether there is a correlation between the mylipb gene and the internal regulatory pathways of hypoxia downstream genes.
[0072] The F1 generation of Megalobrama amblycephala was cultured indoors. When the F1 generation grew to 3 months old (3 mpf, 3 months after fertilization), the genotype was identified and the mylipb + / mylipb + 、mylipb + / mylipb -Genotype of Megalobrama amblycephala. 400 ml of oxygen-saturated aerated water was added to a 500 ml conical flask, and three fish were placed in each conical flask. Each group was set up with 10 replicates, totaling 30 fish. The normoxic control group was set at a temperature of 28°C, an oxygen concentration of 21% Vol, and a carbon dioxide concentration of 5% Vol. The hypoxic experimental group was placed in a Ruskinn Invivo2I-400 hypoxic incubator set at a temperature of 28°C, an oxygen concentration of 12% Vol, and a carbon dioxide concentration of 5% Vol. After 3 hours of treatment, the fish were removed and killed, and their brain tissue was obtained. RNA in the brain tissue was extracted and cDNA was synthesized using a reverse transcription kit (purchased from Fermentas). Real-time fluorescence quantitative PCR kit (purchased from Monad) was used to amplify hypoxia-related downstream genes. The Ct value was obtained by real-time detection of the corresponding fluorescence signal intensity that changes with amplification. At the same time, several standards with known template concentrations were used as controls to determine the copy number of the target gene in the test specimen.
[0073] Test results such as Figure 6 As shown, mylipb + / mylipb - The transcription levels of hypoxia downstream genes in the mylipb genotype were significantly higher than those in the wild type. + / mylipb + This indicates that the mylipb gene is closely related to the internal regulatory pathway of hypoxia downstream genes. + / mylipb - The heterozygous amblycephalic bream has significantly improved tolerance and adaptability to hypoxia.
[0074] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.
Claims
1. A method for constructing hypoxia-resistant Megalobrama amblycephala by knocking out the mylipb gene, characterized in that: Including steps: (b1) knocking out the mylipb gene of wild-type Megalobrama amblycephala, the steps are as follows: (a1) Designing the mylipb gene target site, whose targeting sequence is shown in SEQ ID NO: 1; (a2) Designing specific primers for gRNA based on the mylipb gene target, performing PCR amplification to obtain template DNA, and then in vitro transcription using T7 polymerase to prepare gRNA for the CRISPR / Cas9 system; (a3) microinjecting the combination of gRNA and Cas9 protein into wild-type amblycephalic bream fertilized eggs in vitro, and screening the F0 generation with mylipb gene knockout by genotyping; The template for PCR amplification is pUC19-gRNA plasmid, and the primer sequences are as shown in SEQ ID NO: As shown in 2-3; the wild-type amblycephalic bream fertilized egg is a 1-cell stage fertilized egg; (b2) mating male and female individuals of the screened F0 generation with mutations to obtain the F1 generation, and the amblycephala with mylipb gene mutation detected by genotype in the F1 generation is the hypoxia-resistant amblycephala.
2. The method according to claim 1, characterized in that The step (b2) includes: detecting the genotype of the F1 generation as mylipb + / mylipb - The heterozygous genotype of the bighead carp is hypoxia-tolerant.
3. The application of Mylipb gene in improving the hypoxia tolerance of Megalobrama amblycephala is characterized in that: The hypoxia-resistant Megalobrama amblycephala is obtained by the method according to claim 1 or 2.
Citation Information
Patent Citations
Blunt snout bream MSTNa and MSTNab gene knockout method and application
CN110643636A