A ring-h2 type e3 ubiquitin ligase nbip1 gene and application thereof in mediation of phosphorus regulation of rice leaf angle

Abstract

This invention relates to the field of plant genetic engineering, and discloses a RING-H2 type E3 ubiquitin ligase gene, NBIP1, and its application in mediating phosphorus-mediated regulation of rice leaf angle. Transcription of the NBIP1 gene is phosphorus-induced. The nucleotide sequence of the NBIP1 gene is shown in SEQ ID NO:1, the CDS sequence is shown in SEQ ID NO:2, and the amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO:3. NBIP1 positively regulates rice leaf angle; knockout of NBIP1 leads to a smaller leaf angle, while overexpression of NBIP1 increases the leaf angle. Rice plant architecture affects its final yield, and leaf angle is an important factor regulating rice plant architecture. This invention provides a theoretical basis for breeding rice varieties with ideal plant architecture by regulating rice leaf angle at the molecular level.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, and in particular to a RING-H2 type E3 ubiquitin ligase NBIP1 gene and its application in mediating phosphorus regulation of rice leaf angle. Background Technology

[0002] With population growth and decreasing arable land, increasing crop yield per unit area is crucial for global food security. Rice, as one of the major food crops, feeds more than half of the world's population. Rice yield is a complex trait, mainly determined by three factors: the number of effective tillers, the number of grains per panicle, and the thousand-grain weight. In addition, plant architecture also has a significant impact on rice yield. Rice plant architecture is mainly determined by factors such as plant height, tiller angle, and leaf angle. Among these, the leaf angle is related to planting density. An upright leaf angle allows more light to penetrate the canopy, increasing leaf surface area and photosynthetic efficiency, which is beneficial for dense planting. Therefore, screening genetic loci that regulate rice leaf angle is of great significance for breeding crop varieties with small leaf angles and tolerance to dense planting.

[0003] Phosphorus is one of the essential mineral nutrients for plant growth and development, and the application of phosphate fertilizer can promote plant growth and increase crop yield. However, the application of phosphate fertilizer can increase the leaf angle in rice, which is not conducive to dense planting. Therefore, identifying the key factors mediating phosphorus regulation of leaf angle is of great significance for achieving efficient utilization of phosphate fertilizer and increased yield through dense planting. Summary of the Invention

[0004] The purpose of this invention is to provide a genetic engineering application of NBIP1, a gene that mediates phosphorus regulation of rice leaf angle. Under high phosphorus concentration conditions, the expression level of this gene increases, thereby increasing the rice leaf angle.

[0005] The objective of this invention can be achieved through the following technical solutions:

[0006] A RING-H2 type E3 ubiquitin ligase NBIP1 gene, characterized in that the nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0007] Furthermore, the amino acid sequence of the protein encoded by the RING-H2 type E3 ubiquitin ligase NBIP1 gene is shown in SEQ ID NO.3. The protein encoded by the NBIP1 gene is used to regulate the leaf angle in rice.

[0008] A recombinant expression vector containing the RING-H2 type E3 ubiquitin ligase NBIP1 gene.

[0009] Application of the RING-H2 type E3 ubiquitin ligase NBIP1 gene in mediating phosphorus regulation of rice leaf angle.

[0010] Furthermore, the NBIP1 gene is induced to express at the transcriptional level by high concentrations of phosphate, while its expression is inhibited by low concentrations of phosphate.

[0011] Furthermore, upregulating the expression of the NBIP1 gene can increase the leaf angle of transgenic rice plants, while rice plants with the NBIP1 gene knocked out show a smaller leaf angle and upright leaves. The rice RING-H2 type E3 ubiquitin ligase NBIP1 positively regulates the leaf angle of rice.

[0012] Furthermore, the rice RING-H2 type E3 ubiquitin ligase NBIP1 gene, which upregulates the gene, and a vector that knocks out the NBIP1 gene using CRISPER / Cas9 were transferred into rice callus tissue via Agrobacterium tumefaciens to obtain plants with upregulated NBIP1 expression and gene knockout mutants.

[0013] The beneficial effects of this invention are:

[0014] (1) This invention clones the RING-H2 type E3 ubiquitin ligase NBIP1 gene for the first time. This gene positively regulates the leaf angle of rice. By constructing NBIP1 gene overexpression materials, it was found that compared with wild-type rice (Zhonghua 11), the leaf angle of plants overexpressing the NBIP1 gene was significantly increased.

[0015] (2) By constructing NBIP1 knockout materials, this invention found that compared with wild-type rice (Zhonghua 11), the leaf angle of plants with the NBIP1 gene knocked out was significantly smaller than that of wild-type rice.

[0016] (3) By comparing the expression of the NBIP1 gene under different phosphorus concentrations, this invention found that high phosphorus concentrations activate the transcription of the NBIP1 gene in the pulvinus region.

[0017] (4) This invention is the first to apply the RING-H2 type E3 ubiquitin ligase NBIP1 gene to the regulation of rice leaf angle, which helps to understand the mechanism of phosphorus regulation of rice leaf angle and lays the foundation for the development and improvement of ideal plant type. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below.

[0019] Figure 1 Phenotypic diagram showing that NBIP1 overexpression increases the leaf angle in rice. Figure 1 A represents the expression level of NBIP1 in the NBIP1 overexpression line; Figure 1 Photo B shows a plant of an NBIP1 overexpressing line cultured in the field for 1.5 months.

[0020] Figure 2Phenotypic diagram of reduced leaf angle in rice from NBIP1 knockout lines. Figure 2 A represents the NBIP1 mutation form in the NBIP1 knockout line; Figure 2 Photo of NBIP1 knockout line plantlet after 1.5 months of field culture (B).

[0021] Figure 3 This invention provides an analysis of the effect of different phosphorus concentrations on NBIP1 gene expression in GUS transgenic materials driven by the NBIP1 promoter.

[0022] Figure 4 This section shows the leaf angle phenotypes of NBIP1 overexpression materials, knockout materials, and wild-type materials under high and low phosphorus conditions in embodiments of the present invention. Figure 4 A represents the leaf angle phenotypes of wild-type, NBIP1 knockout, and NBIP1 overexpression lines under low phosphorus conditions. Figure 4 The statistical results of leaf angle size under low phosphorus conditions for wild type, NBIP1 knockout line and NBIP1 overexpression line (B) are as follows: Figure 4 C represents the leaf angle phenotypes of wild-type, NBIP1 knockout, and NBIP1 overexpression lines under normal phosphorus conditions. Figure 4 D represents the statistical results of leaf angle size under normal phosphorus conditions for wild-type, NBIP1 knockout, and NBIP1 overexpression lines. Detailed Implementation

[0023] The embodiments of the present invention will be described in detail below with reference to examples. However, those skilled in the art will understand that the following examples are for illustrative purposes only and should not be considered as limiting the scope of the invention. Unless otherwise specified in the examples, conventional conditions or conditions recommended by the manufacturer are followed. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0024] pYLsgRNA-OsU3 plasmid and pYLCRISPR / Cas9P35S-H plasmid: obtained from Professor Liu Yaoguang's laboratory. Described in "Ma X., Zhang Q., Zhu Q., Liu W., Chen Y., Qiu R., Wang B. et al. (2015) A

[0025] The article “robust CRISPR / Cas9 system for convenient high-efficiency multiplexgenome Editing in Monocot and Dicot Plants. Mol. Plant, 8, 1274-1284” is available to the public from the applicant and may only be used to repeat experiments of this invention.

[0026] pCAMBIA2391Z plasmid: The pCAMBIA2391Z plasmid is publicly available from the applicant and can only be used to replicate the experiments of this invention. It is described in the paper “Hu B.,Wang W.,Ou S.,Tang J.,Li H.,Che R.,Zhang Z.,Chai X.,Wang H.,Wang Y.,et al.(2015).Variation in NRT1.1B contributes to nitrate-use divergence between rice subspecies.Nat.Genet.47:834-838.”

[0027] pCAMBIA1300-221-3×FLAG plasmid: recorded in "Liu C.,Ou S.,Mao B.,Tang J.,WangW.,Wang H.,Cao S., The article MR., Zhao B., Xiao G., Wang X., Chu C. (2018) Early selection of bZIP73 facilitated adaptation of japonica rice to cold climates. Nat Commun. 9, 3302. is available to the public from the applicant and may only be used to repeat experiments of this invention.

[0028] Example 1: Overexpression of the NBIP1 gene can increase the leaf angle.

[0029] The NBIP1 gene involved in this embodiment is derived from rice (Oryza sativa L.). The sequence of the NBIP1 gene is shown in SEQ ID No. 1, and the CDS sequence, i.e., the coding sequence, of the NBIP1 gene is shown in SEQ ID NO: 2. The CDS sequence encodes the NBIP1 protein shown in SEQ ID No. 3. This embodiment will overexpress the NBIP1 gene in rice to study its effect on the leaf angle of rice plants. Details are as follows:

[0030] 1.1 Extraction of total RNA

[0031] Rice Zhonghua 11 was disinfected with 30% NaClO, germinated, and cultured in tap water for three days. Then, it was cultured in Kimura phosphorus-free or normal phosphorus water for two weeks. Root and aerial materials were collected and quickly placed in liquid nitrogen for preservation. After grinding the material with liquid nitrogen, approximately 0.1g of sample was weighed into a 2mL centrifuge tube. 1mL of Trizol reagent was quickly added, and the mixture was thoroughly vortexed. 0.2mL of chloroform was added, and the mixture was centrifuged again. The supernatant was collected, and 0.5mL of isopropanol was added. After centrifugation, the supernatant was discarded. The precipitate was washed with 70% ethanol. RNA was dissolved in DEPC water (1‰ by volume). RNA quality was detected by agarose gel electrophoresis at a mass ratio of 1.0%, and the concentration and purity of total RNA were detected by spectrophotometry. Once qualified, the next step was performed.

[0032] 1.2 Total cDNA Synthesis

[0033] 2 μg of each RNA sample was added to 50 μmol·L⁻¹ -1 Oligo dT18 was added to a final volume of 10 μL with 1‰ DEPC water. The mixture was incubated at 70°C for 5 min, then placed on ice for 5 min. Next, 0.5 μL of RNase inhibitor, 5 μL of 5x RT buffer, 2.5 μL of 10 mM dNTPs, and 1 μL of M-MLV reverse transcriptase were added sequentially. The final volume was brought to 25 μL with 1‰ DEPC water. The mixture was incubated at 42°C for 60 min, then incubated at 70°C for 10 min to terminate the reaction. (Oligo dT18 was synthesized by Nanjing GenScript Biotech Co., Ltd.; the reverse transcription kit was purchased from Fermentas, Canada.)

[0034] 1.3 Construction of NBIP1 overexpression vector

[0035] To obtain plants overexpressing the NBIP1 gene, the inventors constructed an expression vector (35S:NBIP1-FLAG) driven by a 35S promoter and fused with a FLAG tag for rice transformation.

[0036] Primers containing the in-fusion adapter sequence were designed for the pCAMBIA1300-221-3×FLAG vector. The primer sequences are as follows: Using the NBIP1 gene shown in SEQ ID No. 2 as a template, the NBIP1 gene sequence was cloned using primers NBIP1-F and NBIP1-R, which have XhoI and SalI restriction sites at both ends, respectively. The cloned sequence was then ligated to the XhoI / SalI restriction site after the 35S promoter of the pCAMBIA1300-221-3×FLAG vector. The constructed vector was tested with XhoI and SalI restriction enzymes. The extraction of approximately 714 bp of the target fragment indicated that the target gene had been ligated into the vector. Sequencing of the plasmid confirmed that the NBIP1 sequence was correct, indicating that the plasmid was a valid vector.

[0037] NBIP1-F: (The underlined part is the recognition sequence of the restriction endonuclease XhoI, and the bolded sequence indicates the in-fusion adapter sequence.)

[0038] NBIP1-R: (The underlined part is the recognition sequence of the restriction endonuclease SalI, and the bolded sequence indicates the in-fusion adapter sequence.)

[0039] 1300-R:AAGACGCGTCCTAGGCTACG

[0040] Finally, the 35S:NBIP1-FLAG plasmid was transformed into competent Agrobacterium tumefaciens EHA105 cells by electroporation, and the cells were plated on a substrate containing an average concentration of kanamycin and rifampin of 50 μg / mL. -1 After growing on YEP solid medium for 48 hours, positive colonies were picked, plasmids were extracted, and after double digestion with XhoI and SalI to confirm their correctness, the bacterial culture was added with an equal volume of 50% glycerol and stored at -80℃ for transgenic use.

[0041] 1.4 Identification and Phenotypic Observation of Plants Overexpressing NBIP1

[0042] The genetic transformation of rice utilizes Agrobacterium-mediated transformation of rice callus. The specific method is as follows: A single colony of Agrobacterium positive containing the 35S:NBIP1-FLAG plasmid is selected and inoculated into 10 mL of YEP liquid medium (containing 50 mg / L kanamycin and 50 mg / L rifampin), and cultured at 28℃ and 200 rpm for 2-3 days. 4 mL of the bacterial suspension is centrifuged at 4,000 rpm for 3 min, the supernatant is discarded, and the bacteria are resuspended in a small amount of AAM liquid medium. Then, 20 mL of AAM medium (containing 0.1 mM acetylsyleugenol As) is added, and the mixture is cultured at 28℃ and 150 rpm in the dark for 1-2 hours until OD (Organic Oxygen Demand) is reached. 600= Approximately 0.4. Select healthy, granular rice ZH11 callus and immerse it in Agrobacterium culture medium at 28℃, 150-200 rpm for 20 min. After immersion, pour out the callus, blot off excess bacterial solution with sterile filter paper, spread the callus evenly on a sterile Petri dish containing multiple layers of filter paper, and air dry it on a laminar flow hood (the callus should be dispersed and not clump). Then transfer the callus tissue to NB co-culture medium and incubate in the dark for 2-3 days. Transfer the callus to NB medium containing 30 mg / L hygromycin and 400 mg / L cephalosporin for screening for 3-4 weeks (first screening). Transfer the surviving callus tissue to a second screening medium (NB medium containing 50 mg / L hygromycin and 200 mg / L cephalosporin) for screening for 3 weeks. The resistant callus was transferred to a differentiation medium (30 mg / L hygromycin) for differentiation. After the regenerated plants rooted on a seedling strengthening medium containing 30 mg / L hygromycin (about 3-4 weeks), they were transferred to a greenhouse to obtain NBIP1 overexpressing transgenic lines.

[0043] Transgenic plants that tested positive for hygromycin were further examined by extracting total RNA from their leaves. After reverse transcription, the expression of NBIP1 was detected by real-time quantitative PCR (see [link to PCR]). Figure 1 (A) The real-time quantitative PCR primers for NBIP1 are NBIP1-qRT-F / R, and the internal control primers are Actin1-qRT-F / R. Their sequences are as follows:

[0044] NBIP1-qRT-F:CGTGGAAATGGAAGACTTGG

[0045] NBIP1-qRT-R:ATTCGCCGCATATGCTACTG

[0046] Actin-qRT-F:TCTCAGCACATTCCAGCAGA

[0047] Actin-qRT-R:AGCATTCTTGGGTCCGAAGA

[0048] Two NBIP1 overexpressing lines and the wild-type ZH11 were cultured in the field for 1.5 months, and the leaf angle was observed. Their phenotypes are as follows: Figure 1 As shown in Figure B, the leaf angle of the NBIP1 overexpression lines was significantly larger than that of the wild type, indicating that NBIP1 overexpression increased the leaf angle of rice.

[0049] Example 2: NBIP1 knockout can suppress rice leaf angle

[0050] The NBIP1 gene involved in this embodiment is derived from rice (Oryza sativa L.), and its sequence is shown in SEQ ID No. 1. The NBIP1 gene encodes the NBIP1 protein shown in SEQ ID No. 3. This embodiment will utilize CRISPER / Cas9 technology to knock out the rice NBIP1 gene and then study its effect on the leaf angle of rice plants. Details are as follows:

[0051] 2.1 Primer Design for Rice NBIP1 Knockout Vector

[0052] Based on the principles of CRISPR / Cas9 gene editing technology, and through analysis of databases and tools, two target sequences for NBIP1 gene-specific gRNAs were selected, one before the NBIP1 start codon and the other inside the exon: CGGAGTATCGATCGATGGAT CGG and GCCGCGTTCGTGTCCGTGCT CGG( The underlined part represents the PAM sequence conforming to NGG. Two target sequence sites were designed, and two pairs of target primers (F1 and R1; F2 and R2) were designed.

[0053] Forward primer F1: ggcaCGGAGTATCGATCGATGGAT

[0054] Reverse primer R1: aaacATCCATCGATCGATACTCCG

[0055] Forward primer F2: gccgCCGCGTTCGTGTCCGTGCT

[0056] Reverse primer R2: aaacAGCACGGACACGAACGCGG

[0057] 2.2 Construction of Knockout Vector

[0058] (1) Dilute the primers to 100 μM, take 1 μL of each primer and add it to 98 μL of 1×TE buffer. Heat at 90 °C for 30 s and then cool to room temperature for annealing.

[0059] (2) pYLsgRNA-OsU3 and pYLsgRNA-OsU6a were digested with BasI, and the recovered vectors were ligated to the two targeting adapters respectively.

[0060] (3) Using the ligation product as a template, the first round of PCR amplification was performed using primers UF and gRNA-R.

[0061] (4) The PCR product was diluted 20 times and used as a template. PCR amplification was performed using B1' / B2 and B2' / BL respectively, and the product was recovered.

[0062] (5) The pYLCRISPR / Cas9-MH was digested with BasI and recovered, and then ligated with the purified second-round PCR product.

[0063] UF:CTCCGTTTTACCTGTGGAATCG

[0064] gRNA-R:CGGAGGAAAATTCCATCCAC

[0065] Uctcg-B1':TTCAGAggtctcTctcgCACTGGAATCGGCAGCAAAGG

[0066] gRctga-B2:AGCGTGggtctcGtcagGGTCCATCCACTCCAAGCTC-3

[0067] Uctga-B2':TTCAGAggtctcTctgaCACTGGAATCGGCAGCAAAGG

[0068] gRcggt-BL:AGCGTGggtctcGaccgGGTCCATCCACTCCAAGCTC

[0069] (6) The ligation product from step (5) was transferred into DH5α competent cells and positive clones were identified by sequencing.

[0070] (7) Pick positive clones into 10 mL of LB liquid medium, culture overnight, and then extract plasmids.

[0071] 2.3 Conversion of rice

[0072] Using ZH11 callus as the recipient, the NBIP1 knockout vector constructed in step 2.2 was transformed into the callus using an Agrobacterium-mediated transformation method. The specific transformation method is as described in step 1.4 of Example 1.

[0073] 2.4 Identification and Phenotypic Observation of NBIP1 Knockout Lines

[0074] Primers CR-NBIP1-F / R were designed at approximately 200 bp positions at both ends of the two target sequences. Genomic DNA was extracted from the NBIP1 knockout transgenic lines selected above, and PCR amplification was performed using this DNA as a template with the CR-NBIP1-F / R primers. The PCR products were sequenced, and two NBIP1 knockout mutants, nbip1-1 and nbip1-2, were identified. The sequencing results are shown below. Figure 2 A.

[0075] Two NBIP1 knockout mutants and wild-type ZH11 were cultured in the field for 1.5 months, and the leaf angle was observed. Their phenotypes are as follows: Figure 2 As shown in Figure B, the leaf angle of the NBIP1 knockout mutant is significantly smaller than that of the wild type, indicating that the inactivation of NBIP1 reduces the leaf angle of rice.

[0076] Example 3: NBIP1 Expression Analysis

[0077] The inventors constructed a transgenic line with the NBIP1 self-promoter driving the GUS reporter gene, observed GUS staining in the pulvinus region under different phosphorus concentrations, and analyzed the regulation of NBIP1 transcription levels by phosphorus. The specific process is as follows:

[0078] 3.1 Constructing the NBIP1pro-GUS vector

[0079] Primers containing the In-Fusion adapter were designed for the multiple cloning site of the reference vector pCAMBIA2391Z. The primer sequences are as follows:

[0080] NBIP1pro-GUS-F:TGATTACGCCAAGCTTAACCAGCTACCGACCAGATC (The underlined sequence is the HindIII enzyme recognition site sequence, and the bolded sequence is the In-Fusion adapter sequence).

[0081] NBIP1pro-GUS-R:GAATTCCCGGGGATCCGCTTCTCCCTTGGTTTGGTG (The double underlined sequence indicates the BamHI enzyme recognition site sequence, and the bolded sequence indicates the In-Fusion adapter sequence).

[0082] The NBIP1 promoter (2079 bp) was amplified using rice ZH11 genomic DNA as a template. The primer pair used consisted of NBIP1-GUS-F and NBIP1-GUS-R. After the PCR product was recovered, it was ligated into the linearized plant expression vector pCAMBIA2391Z, which was digested with HindIII and BamHI, using an In-Fusion cloning kit. This yielded a recombinant expression vector, NBIP1, in which the fragment between the HindIII and BamHI recognition sites of the pCAMBIA2391Z vector was replaced by the NBIP1 promoter (whose sequence is shown in the sequence listing 4), while keeping the other sequences of the pCAMBIA2391Z vector unchanged. Pro -GUS vector, named pCAMBIA2391Z-NBIP1 Pro -GUS.

[0083] 3.2 Identification of transgenic lines using the NBIP1 self-promoter to drive the GUS reporter gene

[0084] pCAMBIA2391Z-NBIP1 Pro The GUS plasmid was transformed into rice ZH11 via Agrobacterium-mediated transformation, following the method described in section 1.3 of Example 1. After the selected T0 generation transgenic rice was transferred to a greenhouse and allowed to regrow, roots, leaves, and leaf pulvinus were taken from each seedling and cut into appropriate sizes. The cut tissues were immersed in GUS staining solution, vacuumed for 30 minutes, and then incubated overnight at 37°C. The presence of GUS signals was observed to screen for positive seedlings.

[0085] 3.3 Expression analysis of NBIP1 in transgenic lines with NBIP1 self-promoted GUS reporter gene

[0086] Transgenic lines with GUS reporter gene expression driven by the selected NBIP1 self-promoter were subjected to low phosphorus (0.018 mM KH2PO4) treatment. 4) The leaves were cultured for 2 weeks under normal phosphorus (0.18 mM KH2PO4) conditions. The pulvinus portion was then immersed in GUS staining solution, vacuumed for 30 minutes, and then incubated overnight at 37°C. The staining of the pulvinus portion of the second leaf was observed. Results are as follows: Figure 3 As shown, under normal phosphorus culture conditions, the expression level of NBIP1 in the leaf pulvinus region is higher than that under low phosphorus conditions.

[0087] Example 4: Phenotypic observation of NBIP1 genetic material during seedling stage

[0088] The created NBIP1 mutant, overexpression material, and wild-type ZH11 were cultured for two weeks under low phosphorus and normal phosphorus conditions (three-leaf-one-heart stage), respectively. The pulvinus of the second leaf was photographed, and the leaf angle of the second leaf was measured using ImageJ software. The results are as follows: Figure 4 As shown, compared with low phosphorus conditions, the leaf angle of the wild type increased under normal phosphorus conditions, while the leaf angle of the mutant did not change significantly under either phosphorus condition. However, the leaf angle of the NBIP1 overexpression material increased significantly under normal phosphorus conditions, indicating that NBIP1 responds to the phosphorus concentration in the environment and promotes the increase of leaf angle.

[0089] from Figure 1 It can be seen that, compared with the wild type (Zhonghua 11), the NBIP1 overexpression transgenic materials (NBIP1-OE-1, NBIP1-OE-2) have more dispersed plant type and larger leaf angle.

[0090] from Figure 2 It can be seen that the NBIP1 knockout strains have a more compact plant type and smaller leaf angle compared to the wild type (Zhonghua 11).

[0091] from Figure 3It can be seen that the transgenic lines of the GUS reporter gene driven by the NBIP1 promoter stain deeply under normal phosphorus concentration conditions and lightly under low phosphorus concentration conditions, indicating that normal phosphorus concentration promotes NBIP1 gene expression.

[0092] from Figure 4 It can be seen that under normal phosphorus concentrations, the leaf angle of wild-type ZH11 increases, the change in NBIP1 knockout mutant is relatively small, while the leaf angle of NBIP1 overexpression plants increases more significantly, indicating that NBIP1 is a positive regulator of phosphorus-induced leaf angle in rice.

[0093] In summary, the NBIP1 gene mediates the regulation of phosphorus-induced leaf angle in rice by responding to environmental phosphorus concentration.

[0094] Although the invention has been illustrated and described with reference to specific embodiments, it should be understood that many other changes and modifications can be made without departing from the spirit and scope of the invention. Therefore, it is intended that all such changes and modifications falling within the scope of the invention be included in the appended claims.

Claims

1. The application of a RING-H2 type E3 ubiquitin ligase NBIP1 gene in increasing the leaf angle of transgenic rice plants, characterized in that... The nucleotide sequence of the gene is shown in SEQ ID NO.

1. Upregulating the expression of the NBIP1 gene increases the leaf angle of transgenic rice plants, while knocking out the NBIP1 gene results in a smaller leaf angle and upright leaves in rice plants.

2. The application of the RING-H2 type E3 ubiquitin ligase NBIP1 gene according to claim 1 in increasing the leaf angle of transgenic rice plants, characterized in that, The amino acid sequence of the protein encoded by the RING-H2 type E3 ubiquitin ligase NBIP1 gene is shown in SEQ ID NO.

3.

3. The application of the RING-H2 type E3 ubiquitin ligase NBIP1 gene according to claim 1 in increasing the leaf angle of transgenic rice plants, characterized in that... The rice RING-H2 type E3 ubiquitin ligase NBIP1 gene was transferred into rice callus tissue using Agrobacterium tumefaciens, and plants with upregulated NBIP1 expression were obtained by culturing.

Images