An alginate-based thermal genetic cxcl12 releaser, and a preparation method and application thereof
The alginate-based thermogenetic CXCL12 releaser loads thermogenetic CXCL12 genetically engineered cells onto a porous magnetic scaffold and uses an alternating magnetic field to activate the release of CXCL12 chemokines, solving the problems of chemotherapy resistance and immune escape in peritoneal metastases of gastric cancer and achieving effective recruitment of DTCs and activation of peritoneal immunity.
Patent Information
- Application Number
- CN202411041485.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-31
- Publication Date
- 2025-12-09
- Estimated Expiration
- 2044-07-31
AI Technical Summary
Current technologies for treating peritoneal metastases of gastric cancer suffer from severe chemotherapy resistance and side effects. Intraperitoneal immunotherapy faces challenges such as immune escape and time-consuming adoptive cell therapy, making it difficult to effectively eliminate diffuse tumor cells (DTCs) and activate intraperitoneal immunity.
An alginate-based thermogenetic CXCL12 releaser was prepared. The thermogenetic CXCL12 gene-engineered cells were loaded onto a porous magnetic scaffold, and the release of CXCL12 chemokines was activated by an alternating magnetic field, thereby activating anti-DTC immunity.
It achieved controllable release of CXCL12 chemokine, effectively recruited DTCs, inhibited peritoneal metastasis, activated peritoneal immunity, and improved treatment efficacy.
Smart Images

Figure CN118976106B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of biomedical technology, and particularly relates to an alginate-based thermogenetics CXCL12 releaser and a preparation method and application thereof. BACKGROUND
[0002] Peritoneal metastasis is a clinical symptom of gastric cancer, and is accompanied by a high risk of death. Its characteristics include the production of a large amount of malignant ascites, abdominal pain, adhesive intestinal obstruction, nausea and vomiting, and the like. More than 50% of patients will observe this condition at the time of death. Gastric cancer cells (referred to as disseminated tumor cells, DTCs) tend to metastasize to ascites due to anatomical features and cell mutations. Therefore, the removal of DTCs in the peritoneum can prevent metastasis. Although conventional intraperitoneal chemotherapy and primary cell reduction surgery are clinically accepted treatments for peritoneal metastasis, chemotherapy resistance and severe side effects still hinder their widespread clinical application.
[0003] In recent years, intraperitoneal immunotherapy (IPIT) has been considered as a promising strategy to improve the immune cold environment and generate effective immunity due to the unique chamber environment and rich immune cells in the peritoneal cavity. However, IPIT still faces major challenges in terms of immune escape caused by DTC dormancy and time-consuming adoptive cell therapy. Various immune cells and chemokines (CXCL12, CCL2) are involved in the dormancy and recruitment of DTCs, and accelerate the development and accurate positioning of cancer. Therefore, it is of great significance to design a material to promote the controlled release of chemokines in vivo and induce downstream anti-DTC immunity. SUMMARY
[0004] The present application aims to overcome the problems in the prior art and provides an alginate-based thermogenetics CXCL12 releaser and a preparation method and application thereof.
[0005] In order to achieve the above-mentioned application purposes, the present application provides the following technical solutions:
[0006] The present application provides a preparation method of an alginate-based thermogenetics CXCL12 releaser, comprising the following steps:
[0007] (1) mixing a first biopolymer material solution, a first magnetic particle solution and a crosslinking agent to perform crosslinking, to obtain a porous magnetic scaffold;
[0008] or mixing a second biopolymer material solution and a second magnetic particle solution to perform heating, and then sequentially performing self-assembly and freeze-drying after the heating is completed, to obtain a porous magnetic scaffold;
[0009] (2) adding thermogenetics CXCL12 genetically engineered cells to the surface of the porous magnetic scaffold, and performing co-incubation, to obtain the alginate-based thermogenetics CXCL12 releaser.
[0010] Preferably, the first biomacromolecule in the first biomacromolecule solution in step (1) comprises sodium alginate, oxidized hyaluronic acid, chitosan or silk fibroin.
[0011] The first magnetic particles in the first magnetic particle solution comprise iron cobalt graphite nanocapsules, ferrite particles, neodymium iron boron particles or alloy particles containing iron, cobalt and nickel; the mass concentration of the first magnetic particle solution is 8-12 mg / mL.
[0012] Preferably, when the first biomacromolecule is sodium alginate, the method for preparing the porous magnetic scaffold comprises the following steps:
[0013] The sodium alginate solution, the first magnetic particle solution and the first crosslinking agent are mixed to perform first crosslinking, and after the first crosslinking is completed, freeze-drying is performed to obtain an intermediate substance; the intermediate substance and the second crosslinking agent are mixed to perform second crosslinking to obtain the porous magnetic scaffold.
[0014] The mass fraction of the sodium alginate solution is 1.5-2.5%; the first crosslinking agent is a calcium gluconate solution, and the mass fraction of the calcium gluconate solution is 0.5-1.0%; the second crosslinking agent is a calcium chloride solution, and the concentration of the calcium chloride solution is 0.5-1.5 mol / L; the volume ratio of the sodium alginate solution, the first magnetic particle solution and the calcium gluconate solution is 1-3:0.5-1.5:0.5-1.5.
[0015] The temperature of the first crosslinking is 20-30°C, and the time of the first crosslinking is 10-15 min; the temperature of the freeze-drying is -15--25°C, and the time of the freeze-drying is 22-26 h; the temperature of the second crosslinking is 20-30°C, and the time of the second crosslinking is 1.5-2.5 h.
[0016] Preferably, when the first biomacromolecule is oxidized hyaluronic acid, the method for preparing the porous magnetic scaffold comprises the following steps:
[0017] The oxidized hyaluronic acid solution, the first magnetic particle solution and the crosslinking agent are mixed to perform crosslinking, and after the crosslinking is completed, freeze-drying is performed to obtain the porous magnetic scaffold.
[0018] The mass fraction of the oxidized hyaluronic acid solution is 3-7%; the crosslinking agent is branched polyethyleneimine; the volume ratio of the oxidized hyaluronic acid solution and the first magnetic particle solution is 0.5-1.5:0.5-1.5; the volume ratio of the oxidized hyaluronic acid solution and the branched polyethyleneimine is 0.5-1.5:0.5-1.5.
[0019] The cross-linking temperature is 20-30℃, and the cross-linking time is 3-7 min; the freeze-drying temperature is -15--25℃, and the freeze-drying time is 22-26 h.
[0020] As a preferred embodiment, when the first biological macromolecule is chitosan, the method for preparing the porous magnetic scaffold comprises the following steps:
[0021] The acetic acid solution of chitosan, the first magnetic particle solution and the cross-linking agent are mixed, cross-linking is performed, and after the cross-linking is completed, self-assembly and freeze-drying are sequentially performed to obtain the porous magnetic scaffold;
[0022] The mass fraction of chitosan in the acetic acid solution of chitosan is 5-7%; the cross-linking agent is a glutaraldehyde solution, and the mass fraction of the glutaraldehyde solution is 2-4%; the volume ratio of the acetic acid solution of chitosan, the first magnetic particle solution and the glutaraldehyde solution is 0.5-1.5: 0.5-1.5: 0.5-1.5;
[0023] The cross-linking temperature is 50-60℃, and the cross-linking time is 25-35 min; the self-assembly temperature is 20-30℃, and the self-assembly time is 46-50 h; the freeze-drying temperature is -15--25℃, and the freeze-drying time is 22-26 h.
[0024] As a preferred embodiment, when the first biological macromolecule is chitosan, the method for preparing the porous magnetic scaffold comprises the following steps:
[0025] The acetic acid solution of chitosan, the first magnetic particle solution and the cross-linking agent are mixed, cross-linking is performed, and after the cross-linking is completed, self-assembly and freeze-drying are sequentially performed to obtain the porous magnetic scaffold;
[0026] The mass fraction of chitosan in the acetic acid solution of chitosan is 5-7%; the cross-linking agent is a glutaraldehyde solution, and the mass fraction of the glutaraldehyde solution is 2-4%; the volume ratio of the acetic acid solution of chitosan, the first magnetic particle solution and the glutaraldehyde solution is 0.5-1.5: 0.5-1.5: 0.5-1.5;
[0027] The freeze-drying temperature is -15--25℃, and the freeze-drying time is 22-26 h; the cross-linking temperature is 20-30℃, and the cross-linking time is 1.5-2.5 h.
[0028] As a preferred embodiment, the second biological macromolecule in the second biological macromolecule solution in step (1) comprises agarose or collagen; when the second biological macromolecule is agarose, the mass fraction of the second biological macromolecule solution is 1.5-2.5%; when the second biological macromolecule is collagen, the mass fraction of the second biological macromolecule solution is 8-12%;
[0029] The second magnetic particle solution contains iron-cobalt graphite nanocapsules, ferrite particles, neodymium iron boron particles, or alloy particles containing iron, cobalt, and nickel; the mass concentration of the second magnetic particle solution is 8–12 mg / mL.
[0030] The volume ratio of the second biopolymer solution to the second magnetic particle solution is 0.5–1.5:0.5–1.5;
[0031] The heating temperature in step (1) is 70-100℃ and the time is 0.5-1.5 min; the self-assembly temperature is 20-30℃ and the time is 25-35 min; the freeze-drying temperature is -15--25℃ and the time is 22-26 h.
[0032] Preferably, the ratio of the number of thermogenetically engineered CXCL12 cells to the volume of the porous magnetic scaffold in step (2) is 0.8 × 10⁻⁶. 5 ~1.2×10 5 Item: 80~120mm 3 ;
[0033] The co-incubation temperature is 35–40°C, and the co-incubation time is 5–15 minutes.
[0034] The present invention also provides an alginate-based thermogenetic CXCL12 releaser prepared by the aforementioned preparation method.
[0035] The present invention also provides the application of the alginate-based thermogenetic CXCL12 releaser in the preparation of antitumor immunotherapeutic drugs or drugs that inhibit peritoneal metastasis.
[0036] The beneficial effects of this invention are:
[0037] This invention utilizes transgenic and freeze-drying technologies to prepare an alginate-based thermogenetic CXCL12 releaser (ATCG) based on an optimized alternating magnetic field (AMF). The preparation is convenient and simple, and it can be mass-produced. The ATCG consists of a porous magnetic scaffold (IMS) loaded with engineered cells. The engineered cells are stably transfected with pHSP70-CXCL12 thermogenetic elements by lentivirus. The porous magnetic scaffold is composed of a biopolymer material encapsulating magnetic particles, forming a main framework structure with an isotropic porous structure. The ATCG prepared by this invention can controllably release CXCL12 chemokine for DTC recruitment and activate intraperitoneal immunity against DTC after magnetothermal ablation, thereby inhibiting DTC intraperitoneal metastasis. Attached Figure Description
[0038] Figure 1The basic structural characterization diagram of IMS containing GFP engineered cells in Example 1 is shown (Scaffold / Cell, Before washing, After washing, Cell loading ratio). Figure 1 In the image, a is a laser confocal microscopy characterization of IMS containing GFP engineered cells, b is a fluorescence imaging comparison of IMS containing GFP engineered cells and P-IMS containing GFP engineered cells, c is a comparison of cell loading rates of IMS and P-IMS, d is a scanning electron microscopy characterization of IMS containing GFP engineered cells, and e is an elemental scanning characterization of IMS containing GFP engineered cells.
[0039] Figure 2 The magnetocaloric effect characterization diagrams of IMS and ALG in Example 1 are shown (Temperature, Time). Figure 2 In the image, a is a comparison of infrared thermal imaging of IMS and ALG; b is a schematic diagram of the magnetocaloric conversion capability of IMS under different alternating magnetic field strengths.
[0040] Figure 3 These are characterization diagrams of the thermal response capabilities of different cells in Example 1 and Example 2; Figure 3 In the example, 'a' represents GES-1. pHSP70-GFP Fluorescence characterization image after thermal stimulation, b is NIH-3T3 pHSP70-GFP Fluorescence characterization image after thermal stimulation, c represents GES-1. pHSP70 -hCXCL12 Western blot characterization of CXCL12 protein after heat stimulation, d represents NIH-3T3. pHSP70-mCXCL12 Western blot characterization of CXCL12 protein after heat stimulation;
[0041] Figure 4 Characterization of CXCL12 release capacity after magnetothermal treatment with ATCG-1 (Concentration of hCXCL12, CXCL12 Relative Expression, Time). Figure 4 In the diagram, a is the ELISA data characterization of CXCL12 protein secretion by ATCG-1 after magnetothermal stimulation, b is the qPCR data characterization of CXCL12 gene expression by ATCG-1 after magnetothermal stimulation, c is the schematic diagram of CXCL12 protein secretion kinetics by ATCG-1 after magnetothermal stimulation, and d is the schematic diagram of CXCL12 gene expression kinetics by ATCG-1 after magnetothermal stimulation.
[0042] Figure 5Figure for evaluation of DTC chemotactic ability of ATCG-1 (Transmigreted cell—chemotactic cell, Radiance—fluorescence intensity); Figure 5 Figure a is a graph showing the chemotactic ability of ATCG-1 to MGC-803 and MFC cells after magnetic heating stimulation, b is a graph showing the chemotactic ability of ATCG-1 to MGC-803 cells after magnetic heating stimulation, c is a graph showing the chemotactic ability of ATCG-1 to MFC cells after magnetic heating stimulation, d is a graph showing the fluorescence enzyme imaging of DTC recruitment in the abdominal cavity of mice after magnetic heating stimulation of ATCG-1, and e is a graph showing the fluorescence quantification of DTC recruitment in the abdominal cavity of mice after magnetic heating stimulation of ATCG-1. mCxcr4 Figure a is a graph showing the chemotactic ability of ATCG-1 to MGC-803 and MFC cells after magnetic heating stimulation, b is a graph showing the chemotactic ability of ATCG-1 to MGC-803 cells after magnetic heating stimulation, c is a graph showing the chemotactic ability of ATCG-1 to MFC cells after magnetic heating stimulation, d is a graph showing the fluorescence enzyme imaging of DTC recruitment in the abdominal cavity of mice after magnetic heating stimulation of ATCG-1, and e is a graph showing the fluorescence quantification of DTC recruitment in the abdominal cavity of mice after magnetic heating stimulation of ATCG-1. mCxcr4 Figure a is a graph showing the chemotactic ability of ATCG-1 to MGC-803 and MFC cells after magnetic heating stimulation, b is a graph showing the chemotactic ability of ATCG-1 to MGC-803 cells after magnetic heating stimulation, c is a graph showing the chemotactic ability of ATCG-1 to MFC cells after magnetic heating stimulation, d is a graph showing the fluorescence enzyme imaging of DTC recruitment in the abdominal cavity of mice after magnetic heating stimulation of ATCG-1, and e is a graph showing the fluorescence quantification of DTC recruitment in the abdominal cavity of mice after magnetic heating stimulation of ATCG-1.
[0043] Figure 6 Figure for evaluation of therapeutic effect of ATCG-2 in a peritoneal metastasis mouse model (Number of metastatic—number of metastases, Precent—percentage); Figure 6 Figure a is a graph showing the CT three-dimensional imaging of a peritoneal metastasis mouse model treated with ATCG-2, b is a graph showing the number of peritoneal metastases of a peritoneal metastasis mouse model treated with ATCG-2, and c is a graph showing the T cells CD4 and CD8 of a peritoneal metastasis mouse model treated with ATCG-2. DETAILED DESCRIPTION
[0044] The present application provides a preparation method of alginate-based thermogenic CXCL12 releaser, comprising the following steps:
[0045] (1) mixing a first biological macromolecular material solution, a first magnetic particle solution and a crosslinking agent to perform crosslinking, to obtain a porous magnetic scaffold;
[0046] or mixing a second biological macromolecular material solution and a second magnetic particle solution to perform heating, and then sequentially performing self-assembly and freeze-drying after the heating is completed, to obtain a porous magnetic scaffold;
[0047] (2) adding a thermogenic CXCL12 gene engineering cell to the surface of the porous magnetic scaffold, and performing co-incubation, to obtain the alginate-based thermogenic CXCL12 releaser.
[0048] In the present application, the first biological macromolecule in the first biological macromolecular material solution of step (1) preferably includes sodium alginate, oxidized hyaluronic acid, chitosan or silk fibroin.
[0049] In the present application, the first magnetic particles in the first magnetic particle solution preferably comprise iron-cobalt graphite nanocapsules, ferrite particles, neodymium-iron-boron particles, or alloy particles containing iron, cobalt, and nickel, and the solvent in the first magnetic particle solution is water; the mass concentration of the first magnetic particle solution is preferably 8-12 mg / mL, further preferably 9-11 mg / mL, and more preferably 10-10.5 mg / mL.
[0050] In the present application, the preparation method of the iron-cobalt graphite nanocapsules refers to patent CN115679472A (Magnetic Heat Fiber and Its Preparation Method and Application); the ferrite particles preferably comprise a compound containing oxygen and iron elements, and further preferably comprise ferroferric oxide or ferrous ferric oxide; the preparation method of the neodymium-iron-boron particles refers to the literature Electronic Structure of NdFeCoB Oxide Magnetic Particles Studied by DFT Calculations and XPS-PMC (nih.gov); and the preparation method of the iron-cobalt-nickel alloy refers to the literature Magnetic Graphitic Nanocapsules: Fabrication, Classification, and Theranostic Applications | Chemical & Biomedical Imaging (acs.org).
[0051] In the present application, when the first biological macromolecular material is sodium alginate, the method for preparing the porous magnetic scaffold preferably comprises the following steps:
[0052] The sodium alginate solution, the first magnetic particle solution, and the first crosslinking agent are mixed for first crosslinking, and after the first crosslinking is completed, freeze-drying is performed to obtain an intermediate substance; the intermediate substance and the second crosslinking agent are mixed for second crosslinking to obtain the porous magnetic scaffold.
[0053] In the present application, the solvent in the sodium alginate solution is water, the mass fraction of the sodium alginate solution is preferably 1.5-2.5%, further preferably 1.7-2.3%, and more preferably 2-2.1%; the first crosslinking agent is preferably a calcium gluconate solution, the solvent in the calcium gluconate solution is water, the mass fraction of the calcium gluconate solution is preferably 0.5-1.0%, further preferably 0.6-0.9%, and more preferably 0.7-0.8%; the second crosslinking agent is preferably a calcium chloride solution, the solvent in the calcium chloride solution is water, the concentration of the calcium chloride solution is preferably 0.5-1.5 mol / L, further preferably 0.7-1.3 mol / L, and more preferably 0.8-1.0 mol / L; the volume ratio of the sodium alginate solution, the first magnetic particle solution and the calcium gluconate solution is preferably 1-3:0.5-1.5:0.5-1.5, further preferably 1.5-2.5:0.7-1.3:0.7-1.3, and more preferably 2-2.3:1-1.2:1-1.2; the amount of the calcium chloride solution is not specifically limited in the present application, as long as it can ensure that the first biopolymer material is fully crosslinked.
[0054] In the present application, the temperature of the first crosslinking is preferably 20-30°C, further preferably 22-28°C, and more preferably 25-26°C; the time of the first crosslinking is preferably 10-15 min, further preferably 11-14 min, and more preferably 12-13 min; the temperature of the freeze-drying is preferably -15--25°C, further preferably -17--23°C, and more preferably -20--22°C; the time of the freeze-drying is preferably 22-26 h, further preferably 23-25 h, and more preferably 23.5-24 h; the temperature of the second crosslinking is preferably 20-30°C, further preferably 22-28°C, and more preferably 25-26°C; the time of the second crosslinking is preferably 1.5-2.5 h, further preferably 1.7-2.3 h, and more preferably 1.9-2 h.
[0055] In the present application, after the second crosslinking is completed, the obtained sample is eluted with water, so as to fully elute the un-crosslinked Ca 2+ to obtain the porous magnetic scaffold, which is stored at 4°C.
[0056] In the present application, when the first biopolymer material is oxidized hyaluronic acid, the method for preparing the porous magnetic scaffold preferably comprises the following steps:
[0057] The oxidized hyaluronic acid solution, the first magnetic particle solution and the crosslinking agent are mixed for crosslinking, and after the crosslinking is completed, freeze-drying is performed to obtain the porous magnetic scaffold.
[0058] In the present application, the method for preparing the oxidized hyaluronic acid preferably comprises the following steps:
[0059] The sodium periodate solution and the hyaluronic acid solution are mixed, stirred at room temperature in the dark for 1-3 hours, further preferably 1.5-2.5 hours, more preferably 2 hours, then the ethylene glycol solution is added, and stirring is continued at room temperature in the dark for 1-3 hours, further preferably 1.5-2.5 hours, more preferably 2 hours, after which the mixture is transferred to a dialysis bag with a molecular weight cut-off of 3 kDa, dialysis is carried out with water for 2-4 days, further preferably 2.5-3.5 days, more preferably 3 days, after which the dialysis is completed, the solution is subjected to freeze-drying using conventional techniques in the art, and the oxidized hyaluronic acid is obtained.
[0060] In the present application, the concentration of the sodium periodate solution is preferably 0.3-0.7 mol / L, further preferably 0.4-0.6 mol / L, more preferably 0.5 mol / L; the mass fraction of the hyaluronic acid solution is preferably 0.5-1.5%, further preferably 0.7-1.3%, more preferably 0.8-1.0%; the volume ratio of the sodium periodate solution to the hyaluronic acid solution is preferably 3-7:80-120, further preferably 4-6:90-110, more preferably 5:100.
[0061] In the present application, the solvent in the oxidized hyaluronic acid solution is water, the mass fraction of the oxidized hyaluronic acid solution is preferably 3-7%, further preferably 4-6%, more preferably 5-5.5%; the crosslinking agent is preferably branched polyethyleneimine; the volume ratio of the oxidized hyaluronic acid solution to the first magnetic particle solution is preferably 0.5-1.5:0.5-1.5, further preferably 0.7-1.3:0.7-1.3, more preferably 1-1.2:1-1.2; the volume ratio of the oxidized hyaluronic acid solution to the branched polyethyleneimine is preferably 0.5-1.5:0.5-1.5, further preferably 0.7-1.3:0.7-1.3, more preferably 1-1.2:1-1.2.
[0062] In the present application, the temperature for crosslinking is preferably 20-30°C, further preferably 22-28°C, more preferably 25-26°C; the time for crosslinking is preferably 3-7 min, further preferably 4-6 min, more preferably 4.5-5 min; the temperature for freeze-drying is preferably -15 to -25°C, further preferably -17 to -23°C, more preferably -20 to -22°C; the time for freeze-drying is preferably 22-26 h, further preferably 23-25 h, more preferably 23.5-24 h; after freeze-drying, the porous magnetic scaffold is obtained and stored at 4°C.
[0063] In the present application, when the first biopolymer material is chitosan, the method for preparing the porous magnetic scaffold preferably comprises the following steps:
[0064] The porous magnetic scaffold is prepared by mixing the chitosan acetic acid solution, the first magnetic particle solution and the crosslinking agent, crosslinking, self-assembling and freeze-drying in sequence.
[0065] In the present application, the mass fraction of chitosan in the chitosan acetic acid solution is preferably 5-7%, further preferably 5.5-6.5%, and more preferably 6-6.2%; the crosslinking agent is preferably glutaraldehyde solution, the solvent of the glutaraldehyde solution is water, the mass fraction of the glutaraldehyde solution is preferably 2-4%, further preferably 2.5-3.5%, and more preferably 3-3.2%; and the volume ratio of the chitosan acetic acid solution, the first magnetic particle solution and the glutaraldehyde solution is preferably 0.5-1.5: 0.5-1.5: 0.5-1.5, further preferably 0.7-1.3: 0.7-1.3: 0.7-1.3, and more preferably 1-1.2: 1-1.2: 1-1.2.
[0066] In the present application, the crosslinking temperature is preferably 50-60℃, further preferably 52-58℃, and more preferably 55-56℃; the crosslinking time is preferably 25-35min, further preferably 27-33min, and more preferably 28-30min; the self-assembling temperature is preferably 20-30℃, further preferably 22-28℃, and more preferably 25-26℃; the self-assembling time is preferably 46-50h, further preferably 47-49h, and more preferably 47.5-48h; the freeze-drying temperature is preferably -15--25℃, further preferably -17--23℃, and more preferably -20--22℃; the freeze-drying time is preferably 22-26h, further preferably 23-25h, and more preferably 23.5-24h; and after the freeze-drying, the porous magnetic scaffold is obtained and stored at 4℃.
[0067] In the present application, when the first biological macromolecular material is silk fibroin, the method for preparing the porous magnetic scaffold preferably comprises the following steps:
[0068] The silk fibroin solution and the first magnetic particle solution are mixed and freeze-dried to obtain an intermediate substance; the intermediate substance and the crosslinking agent are mixed and crosslinked to obtain the porous magnetic scaffold.
[0069] In the present application, the solvent in the silk fibroin solution is water, the mass fraction of the silk fibroin solution is preferably 8-12%, further preferably 9-11%, and more preferably 10-10.5%; the volume ratio of the silk fibroin solution to the first magnetic particle solution is preferably 0.5-1.5:0.5-1.5, further preferably 0.7-1.3:0.7-1.3, and more preferably 1-1.2:1-1.2; the crosslinking agent is preferably methanol; and the volume ratio of the silk fibroin solution to methanol is preferably 0.5-1.5:2.5-3.5, further preferably 0.7-1.3:2.7-3.3, and more preferably 1-1.2:3-3.2.
[0070] In the present application, the temperature for freeze-drying is preferably -15 to -25℃, further preferably -17 to -23℃, and more preferably -20 to -22℃; the time for freeze-drying is preferably 22-26h, further preferably 23-25h, and more preferably 23.5-24h; the temperature for crosslinking is preferably 20-30℃, further preferably -17 to -23℃, and more preferably -20 to -22℃; and the time for crosslinking is preferably 1.5-2.5h, further preferably 1.7-2.3h, and more preferably 1.9-2h.
[0071] In the present application, after the crosslinking is completed, the obtained sample is eluted with water to obtain a porous magnetic scaffold, which is stored at 4℃.
[0072] In the present application, the second biomacromolecule in the second biomacromolecule solution in step (1) preferably includes agarose or collagen, and the solvent in the second biomacromolecule solution is water; when the second biomacromolecule is agarose, the mass fraction of the second biomacromolecule solution is preferably 1.5-2.5%, further preferably 1.7-2.3%, and more preferably 2-2.1%; and when the second biomacromolecule is collagen, the mass fraction of the second biomacromolecule solution is preferably 8-12%, further preferably 9-11%, and more preferably 10-10.5%.
[0073] In the present application, the second magnetic particles in the second magnetic particle solution preferably include iron-cobalt graphite nanocapsules, ferrite particles, neodymium-iron-boron particles, or alloy particles containing iron, cobalt, and nickel, the source of the second magnetic particles is the same as that of the first magnetic particles, and the solvent in the second magnetic particle solution is water; the mass concentration of the second magnetic particle solution is preferably 8-12mg / mL, further preferably 9-11mg / mL, and more preferably 10-10.5mg / mL.
[0074] In the present application, the volume ratio of the second biomacromolecule solution and the second magnetic particle solution is preferably 0.5-1.5:0.5-1.5, further preferably 0.7-1.3:0.7-1.3, and more preferably 1-1.2:1-1.2.
[0075] In the present application, the heating temperature in step (1) is preferably 70-100℃, further preferably 80-90℃, and more preferably 85-87℃; the time is preferably 0.5-1.5min, further preferably 0.7-1.3min, and more preferably 0.8-1min; the self-assembly temperature is preferably 20-30℃, further preferably 22-28℃, and more preferably 25-26℃; the time is preferably 25-35min, further preferably 27-33min, and more preferably 28-30min; the freeze-drying temperature is preferably -15--25℃, further preferably -17--23℃, and more preferably -20--22℃; and the time is preferably 22-26h, further preferably 23-25h, and more preferably 23.5-24h. After the freeze-drying, the porous magnetic scaffold is obtained and stored at 4℃.
[0076] In the present application, the preparation method of the thermogenic CXCL12 gene engineered cell in step (2) preferably comprises the following steps:
[0077] The central DNA plasmid (the central DNA plasmid is constructed with a promoter (marked as pHSP70) and a thermogenic CXCL12 gene), a packaging plasmid pMD2.G and a packaging plasmid psPAX2 are transformed into 293T cells, and the lentivirus in the culture solution is collected after 3 days of transfection. Then, the lentivirus is co-incubated with GES-1 or NIH-3T3 for 3 days, and then puromycin is added for screening for 7 days. Finally, the obtained cells that survive are the thermogenic CXCL12 gene engineered cells.
[0078] In the present application, the thermo genetics CXCL12 gene sequence is obtained from the ncbi database, when the lentivirus is co-incubated with GES-1, the thermo genetics CXCL12 gene is hCXCL12; when the lentivirus is co-incubated with NIH-3T3, the thermo genetics CXCL12 gene is mCXCL12; the preparation method of the central DNA plasmid is the seamless adapter technology, which is a conventional process in the art; the reference literatures are Complete Chemical Synthesis, Assembly, and Cloning of a Mycoplasma genitalium Genome | Science and Enzymatic assembly of DNA molecules up to several hundred kilobases | Nature Methods, and can also be purchased from GeneArt Seamless Cloning and Gibson Assembly |Thermo Fisher Scientific-CN; the packaging plasmid pMD2.G and the packaging plasmid psPAX2 are purchased from Addgene (the purchase website of the packaging plasmid pMD2.G is https: / / www.addgene.org / 12259 / , and the purchase website of the packaging plasmid psPAX2 is https: / / www.addgene.org / 12260 / ); the 293T cell is purchased from ATCC (the purchase website is https: / / www.atcc.org / products / crl-3216); the GES-1 is purchased from ATCC; the NIH-3T3 is purchased from Procell (the purchase website is https: / / www.procell.com.cn / view / 8947.html).
[0079] In the present application, the hCXCL12 gene sequence (SEQ ID NO. 1) is:
[0080] ATGGACGCCAAGGTCGTCGCCGTGCTGGCCCTGGTGCTGGCCGCGCTCTGCATCAGTGACGGTAAACCAGTCAGCCTGAGCTACCGATGCCCCTGCCGGTTCTTCGAGAGCCACATCGCCAGAGCCAACGTCAAGCATCTGAAAATCCTCAACACTCCAAACTGTGCCCTTCAGATTGTTGCACGGCTGAAGAACAACAACAGACAAGTGTGCATTGACCCGAAATTAAAGTGGATCCAAGAGTACCTGGAGAAAGCTTTAAACAAGAGGCTCAAGATG.
[0081] In the present application, the mCXCL12 gene sequence (SEQ ID NO. 2) is:
[0082] ATGAACGCCAAGGTCGTGGTCGTGCTGGTCCTCGTGCTGACCGCGCTCTGCCTCAGCGACGGGAAGCCCGTCAGCCTGAGCTACAGATGCCCATGCCGATTCTTCGAAAGCCATGTTGCCAGAGCCAACGTCAAGCATCTCAAAATTCTCAACACTCCAAACTGTGCCCTTCAGATTGTAGCCCGGCTGAAGAACAACAACAGACAAGTGTGCATTGACCCGAAGCTAAAGTGGATTCAGGAGTACCTGGAGAAAGCTTTAAACAAGAGGTTCAAGATG.
[0083] In the present application, the collection of lentivirus in the culture solution is completed by using the conventional technical means in the art, specifically, the genes on the central DNA plasmid, the packaging plasmid pMD2.G and the packaging plasmid psPAX2 will start to express after being transformed into 293T cells, and the pMD2.G and psPAX2 will start to express the protein shell of the lentivirus, which will be assembled with the central DNA plasmid, and then the new generation of lentivirus will kill the host cells, and the lentivirus will be released outside the cells, and then the lentivirus is collected by filtration and concentration; the temperature for co-incubation of the lentivirus and GES-1 or NIH-3T3 is preferably 35-40℃, further preferably 36-39℃, and more preferably 37-38℃.
[0084] In the present application, the ratio of the number of the thermo-genetic CXCL12 gene engineered cells in step (2) to the volume of the porous magnetic scaffold is preferably 0.8x105 ~1.2x10 5 mm 3 , further preferably 0.9x10 5 ~1.1x10 5 mm 3 , more preferably 1x10 5 mm 3 .
[0085] In the present application, in step (2), the thermogenic CXCL12 genetically engineered cells are added to the surface of the porous magnetic stent, specifically, the thermogenic CXCL12 genetically engineered cells are added dropwise to the plane of the porous magnetic stent (the porous magnetic stent is in a cylindrical shape, and the plane of the porous magnetic stent is the upper or lower bottom surface of the cylinder).
[0086] In the present application, the temperature of the co-incubation is preferably 35-40℃, further preferably 36-39℃, more preferably 37-38℃; the time of the co-incubation is preferably 5-15min, further preferably 7-13min, more preferably 8-10min.
[0087] The present application also provides the alginate-based thermogenic CXCL12 releaser prepared by the preparation method.
[0088] The present application also provides the use of the alginate-based thermogenic CXCL12 releaser in the preparation of an anti-tumor immune drug or a drug for inhibiting peritoneal metastasis.
[0089] The technical solutions provided by the present application will be described in detail below in conjunction with the examples, but they should not be understood as limiting the scope of protection of the present application.
[0090] Example 1
[0091] A 2% by mass sodium alginate solution, a 10 mg / mL iron-cobalt graphite nanocapsule solution, and a 0.8% by mass calcium gluconate solution (the volume ratio of the sodium alginate solution, the iron-cobalt graphite nanocapsule solution, and the calcium gluconate solution is 2:1:1) are mixed, crosslinked at 25℃ for 12 min, and then frozen and dried at -20℃ for 24 h. Then, an excess amount of a 1.0 mol / L calcium chloride solution is added, and crosslinked at 25℃ for 2 h. After the crosslinking is completed, the obtained sample is eluted with water to sufficiently elute the un-crosslinked Ca 2+ , to obtain a porous magnetic stent (labeled as IMS);
[0092] The central DNA plasmid (pHSP70 and the thermogenetic hCXCL12 gene are constructed on the central DNA plasmid), the packaging plasmid pMD2.G and the packaging plasmid psPAX2 are transformed into 293T cells, and the lentivirus in the culture solution is collected after transfection for 3 days, and then the lentivirus is co-incubated with GES-1 at 37°C for 3 days, and then puromycin is added for screening for 7 days, and finally the obtained cells that survive are thermogenetic CXCL12 genetically engineered cells (labeled as GES-1 pHSP70-hCXCL12 );
[0093] 10 5 GES-1 pHSP70-hCXCL12 are added to the surface of IMS with a volume of 100mm 3 , and co-incubated at 37°C for 10 min to obtain the alginate-based thermogenetic CXCL12 releaser (labeled as ATCG-1).
[0094] The central DNA plasmid (pHSP70 and GFP are constructed on the central DNA plasmid, and GFP is green fluorescent protein), the packaging plasmid pMD2.G and the packaging plasmid psPAX2 are transformed into 293T cells, and the lentivirus in the culture solution is collected after transfection for 3 days, and then the lentivirus is co-incubated with GES-1 at 37°C for 3 days, and then puromycin is added for screening for 7 days, and finally the obtained cells that survive are GFP genetically engineered cells (labeled as GES-1 pHSP70-GFP ); 10 5 GFP genetically engineered cells are added to the surface of IMS prepared in this embodiment with a volume of 100mm 3 , and co-incubated at 37°C for 10 min to obtain IMS containing GFP genetically engineered cells; at the same time, the IMS prepared in this embodiment is pressed with a 10g weight for 3 days to obtain a magnetic-thermal non-porous scaffold (labeled as P-IMS); 10 5 GFP genetically engineered cells are added to the surface of IMS prepared in this embodiment with a volume of 100mm 3The P-IMS was co-incubated with the GFP engineered cells on the surface of the P-IMS at 37°C for 10 min to obtain the P-IMS containing the GFP engineered cells. The IMS containing the GFP engineered cells was placed under a laser confocal microscope for characterization, and the IMS containing the GFP engineered cells and the P-IMS containing the GFP engineered cells were photographed by a fluorescence imaging system. After the photographing, the IMS containing the GFP engineered cells and the P-IMS containing the GFP engineered cells were washed with DPBS for 3 times, and then photographed again by the fluorescence imaging system. The cell loading rate of the IMS and the P-IMS was quantified by the signal intensity of the GFP. Finally, the IMS containing the GFP engineered cells was fixed on the conductive glue, and the conductivity was improved after gold spraying for 90 s. The surface microstructure of the IMS containing the GFP engineered cells was observed by a scanning electron microscope (TESCAN) at an acceleration voltage of 20 kV, and element scanning analysis was performed by an X-ray energy dispersive spectrometer. The basic structure characterization diagram of the IMS containing the GFP engineered cells in Example 1 was obtained as shown in FIG. 1. Figure 1 Figure 1 In FIG. 1, a is the laser confocal microscope characterization diagram of the IMS containing the GFP engineered cells, b is the fluorescence imaging comparison diagram of the IMS containing the GFP engineered cells and the P-IMS containing the GFP engineered cells, c is the cell loading rate comparison diagram of the IMS and the P-IMS, d is the scanning electron microscope characterization diagram of the IMS containing the GFP engineered cells, and e is the element scanning characterization diagram of the IMS containing the GFP engineered cells. Figure 1 As can be seen from FIG. 1, a large number of engineered cells exist in the IMS containing the GFP engineered cells, and these cells are effectively maintained in the void structure of the IMS. The IMS containing the GFP engineered cells can effectively load the cells in the scaffold due to the existence of the porous structure. The cell loading rate of the IMS can reach 82.2±16.6%, which is 13.05 times that of the P-IMS. In the IMS containing the GFP engineered cells, cells can be seen in the scaffold, and carbon, iron and cobalt elements exist in the scaffold. In summary, a large number of engineered cells and carbon, iron and cobalt elements exist in the IMS containing the GFP engineered cells, which indicates the successful preparation of the IMS containing the GFP engineered cells.
[0095] A sodium alginate solution with a mass fraction of 2% and a calcium gluconate solution with a mass fraction of 0.8% (the volume ratio of the sodium alginate solution to the calcium gluconate solution was 2:1) were mixed, cross-linked at 25°C for 12 min, and then freeze-dried at -20°C for 24 h. Then, an excessive calcium chloride solution with a concentration of 1.0 mol / L was added, cross-linked at 25°C for 2 h, and then washed with water to elute the un-cross-linked Ca 2+ A scaffold without magnetocaloric material doping was obtained (labeled ALG). IMS and ALG were exposed to coils with a diameter of 60 mm, and the entire heating process was monitored using an infrared thermal imager (FOTRIC 365) at a frequency of 340 kHz and a magnetic field strength of 60% (corresponding to an alternating magnetic field of 27 kA / m). Furthermore, to optimize the heating effect of IMS, the magnetocaloric conversion capacity of IMS was monitored under different alternating magnetic field strengths (40%–60% magnetic field strength, corresponding to alternating magnetic fields of 18–27 kA / m). The magnetocaloric effect characterization diagrams of IMS and ALG in Example 1 were obtained, as shown below. Figure 2 As shown (Temperature—temperature, Time—time); Figure 2 In the image, a) is a comparison of infrared thermal imaging of IMS and ALG; b) is a schematic diagram of the magnetocaloric conversion capability of IMS under different alternating magnetic field intensities (60% refers to an alternating magnetic field of 27 kA / m, 50% refers to an alternating magnetic field of 22.5 kA / m, 45% refers to an alternating magnetic field of 20.25 kA / m, and 40% refers to an alternating magnetic field of 18 kA / m). From Figure 2 As can be seen, compared to ALG, IMS exhibits a significant heating effect under an alternating magnetic field. The heating effect of IMS can be effectively adjusted by regulating the strength of the alternating magnetic field. Higher magnetic field strength results in a faster heating rate. Measurements show that the heating rate of IMS can reach 0.1–0.3℃ / s. Under an alternating magnetic field of 22.5 kA / m, it can reach approximately 45℃, and under 27 kA / m, it can reach approximately 55℃. 45℃ can be used for the thermal activation of CXCL12 gene-engineered cells in thermogenetics, while 55℃ can be used for the release of TAAs (tumor-associated antigens) from DTCs and for peritoneal immune activation. These data demonstrate that IMS possesses a significant magnetocaloric response capability, and the magnetocaloric heating effect can be adjusted by regulating the alternating magnetic field strength, exhibiting good magnetocaloric effect and controllability.
[0096] Example 2
[0097] Keeping all other conditions for preparing ATCG-1 unchanged in Example 1, the thermogenetic hCXCL12 gene was replaced with the thermogenetic mCXCL12 gene, and GES-1 was replaced with NIH-3T3, resulting in NIH-3T3. pHSP70-mCXCL12 ;
[0098] 10 5 NIH-3T3 pHSP70-mCXCL12 Add to a volume of 100mm 3 The alginate-based thermogenetic CXCL12 releaser (labeled ATCG-2) was obtained by incubating the surface of the IMS at 37°C for 10 min.
[0099] The central DNA plasmid (pHSP70 and GFP are constructed on the central DNA plasmid, and GFP is green fluorescent protein), packaging plasmid pMD2.G and packaging plasmid psPAX2 are transformed into 293T cells, and the culture solution is collected after transfection for 3 days, and then the lentivirus is co-incubated with NIH-3T3 at 37℃ for 3 days, and then puromycin is added for screening for 7 days, and the finally surviving cells are NIH-3T3 pHSP70-GFP GES-1 pHSP70-GFP prepared in Example 1 pHSP70-GFP NIH-3T3 pHSP70-GFP prepared in this example pHSP70-GFP for visualization of the engineered cells, GES-1 pHSP70 -hCXCL12 and NIH-3T3 pHSP70-mCXCL12 prepared in this example pHSP70-hCXCL12 for characterization of protein secretion of the thermogenetics CXCL12 engineered cells, GES-1 pHSP70-mCXCL12 and NIH-3T3 pHSP70-GFP prepared in this example pHSP70-GFP protein secretion ability of CXCL12 after 12 hours of stimulation at 45℃; the characterization figures of the heat response ability of different cells in Example 1 and Example 2 are shown in Figure 3 ; Figure 3 , a is GES-1 pHSP70-hCXCL12 , b is NIH-3T3 pHSP70 , c is GES-1 -mCXCL12 , d is NIH-3T3 pHSP70-GFP pHSP70-GFP , GES-1 pHSP70-GFP +heat is GES-1 pHSP70-GFP after heat stimulation, BF is the abbreviation of Bright Field, which means bright field; in b, 3T3 is a single murine cell NIH-3T3, 3T3 pHSP70-GFP prepared in Example 2 pHSP70-GFP , 3T3 pHSP70-GFP +heat is NIH-3T3 pHSP70-GFP; c, Control is the control group, i.e. single human cell GES-1 without any operation, pHSP70-hCXCL12 is GES-1 prepared in Example 1 pHSP70-hCXCL12 , pHSP70-hCXCL12+heat is GES-1 after heat stimulation pHSP70-hCXCL12 , GAPDH is the internal reference gene; d, Control is the control group, i.e. single mouse cell NIH-3T3 without any operation, pHSP70-mCXCL12 is NIH-3T3 prepared in Example 2 pHSP70-mCXCL12 , pHSP70-mCXCL12+heat is NIH-3T3 after heat stimulation pHSP70-mCXCL12 , GAPDH is the internal reference gene). It can be seen from Figure 3 that GES-1 pHSP70-GFP and NIH-3T3 pHSP70-GFP have significant GFP expression under heat stimulation, GES-1 pHSP70-hCXCL12 and NIH-3T3 pHSP70-mCXCL12 successfully express and secrete CXCL12, which indicates that the cells effectively promote the expression of CXCL12 chemotactic factor under heat stimulation. The above data show that the thermo-genetic genetically engineered cells have obvious heat response ability, and can effectively promote the expression of GFP and CXCL12 under 45℃ stimulation.
[0100] ATCG-1 prepared in Example 1 is exposed in a 60mm diameter coil, and is subjected to magnetic heat treatment under a frequency of 340kHz and an alternating magnetic field of 22.5kA / m for 10min. After the treatment, the ATCG-1 is placed in a 37℃, 5% CO2 incubator (CO2 in the culture medium accounts for 5% of the mass fraction of air) for 12h. The culture medium is collected for ELISA (enzyme-linked immunosorbent assay) to detect the concentration of CXCL12. In addition, the cells in the scaffold are collected to extract RNA, and qPCR (real-time fluorescence quantification) is used to detect the expression level of CXCL12 gene, to obtain the characterization diagram of the CXCL12 release ability of ATCG-1 after magnetic heat treatment, as shown in Figure 4 (Concentration of hCXCL12—hCXCL12 concentration, CXCL12 Relative Expression—CXCL12 expression level, Time—time); Figure 4Fig. 1 shows the characterization of ATCG-1 in promoting CXCL12 protein secretion and gene expression. a is the characterization graph of CXCL12 protein secretion ELISA data of ATCG-1 after magnetic-thermal stimulation, b is the characterization graph of CXCL12 gene expression qPCR data of ATCG-1 after magnetic-thermal stimulation, c is the schematic diagram of CXCL12 protein secretion kinetics of ATCG-1 after magnetic-thermal stimulation, and d is the schematic diagram of CXCL12 gene expression kinetics of ATCG-1 after magnetic-thermal stimulation. In a, 1, 2, 3 and 5 in the abscissa are control groups, and 4 is the experimental group. Specifically, 1 is 10 GES-1 added to the surface of IMS with a volume of 100 mm3, incubated at 37°C for 10 min, and the IMS containing GES-1 is obtained without magnetic-thermal treatment; 2 is 10 GES-1 added to the surface of IMS with a volume of 100 mm3, incubated at 37°C for 10 min, and the IMS containing GES-1 is obtained, and the IMS containing GES-1 is subjected to magnetic-thermal treatment by the same method as described above; 3 is ATCG-1 prepared in Example 1 without magnetic-thermal treatment; 4 is the experimental group as described above, i.e., ATCG-1 prepared in Example 1 is subjected to magnetic-thermal treatment; and 5 is the addition of hCXCL12 protein inhibitor on the basis of magnetic-thermal treatment of ATCG-1 prepared in Example 1. The abscissa in b has the same meaning as in a. In c, ATCG-1+AMF is ATCG-1 prepared in Example 1 subjected to magnetic-thermal treatment, and ATCG-1 is ATCG-1 prepared in Example 1 without magnetic-thermal treatment. d is the same as c. It can be seen from the above data that the concentration of CXCL12 protein secretion of ATCG-1 can reach 1.73 ± 0.11 ng / mL at 12 h after thermal stimulation, which is 34.6 times that of the control group (1), and the CXCL12 gene expression level is 601.09 times that of the control group (1). In addition, the inhibitor treatment basically does not affect the gene expression and protein secretion of CXCL12 of ATCG-1. The protein concentration of ATCG-1 reaches a peak at 24 h after magnetic-thermal stimulation, the gene expression reaches a peak at 8 h after thermal stimulation, and the protein secretion and gene expression can be reversibly restored to the level before stimulation at 48 h. The above data show that ATCG-1 has obvious thermal response ability, and under magnetic-thermal stimulation, it can effectively promote the protein secretion and gene expression of CXCL12, and can be reversibly restored to the level before stimulation at 48 h. 5 3 5 3 Figure 4
[0101] ATCG-1 prepared in Example 1 was co-incubated with human gastric cancer cells MGC-803 in a Transwell in vitro, and was heat stimulated for 10 min under an alternating magnetic field of 22.5 kA / m. After heat stimulation, the Transwell was placed for 3 days, taken out, washed with DPBS for 3 times, dyed with a 0.1% (mass fraction) crystal violet aqueous solution for 5 min, and the upper layer cells of the Transwell were gently wiped off with a cotton swab. Then, the cells were observed under an optical microscope, and the number of cells was counted by using ImageJ. The above conditions were controlled to be unchanged, ATCG-1 prepared in Example 1 was replaced by ATCG-2 prepared in Example 2, and human gastric cancer cells MGC-803 were replaced by murine gastric cancer cells MFC mCxcr4 . Finally, the number of cells was counted by using ImageJ. On the other hand, an experimental peritoneal metastasis model was constructed in 8-week-old female nude mice. 10 5 human gastric cancer cells MGC-803 were transplanted into the peritoneal cavity of the nude mice. After 3 days, ATCG-1 was transplanted into the peritoneal cavity of the nude mice. The nude mice were exposed to an alternating magnetic field of 22.5 kA / m at a frequency of 340 kHz in a 60-mm-diameter coil for 10 min of magnetic heat treatment. One day later, the nude mice were again exposed to the same conditions for 10 min of magnetic heat treatment. On the 7th day, ATCG-1 was taken out of the peritoneal cavity, and ATCG-1 was imaged by using a fluorescence imaging system (7 parallel experiments were performed). Then, the fluorescence intensity was quantified by using software (the average value was taken), and the DTC chemotaxis ability evaluation diagram of ATCG-1 was obtained, as shown in FIG. 6 (Transmigreted cell—chemotactic cells, Radiance—fluorescence intensity). Figure 5 Figure 5 In FIG. 6, a is a Transwell staining diagram of ATCG-1 after magnetic heat stimulation on MGC-803 and MFC mCxcr4 cells, b is a chemotaxis statistical diagram of ATCG-1 after magnetic heat stimulation on MGC-803 cells, c is a chemotaxis statistical diagram of ATCG-1 after magnetic heat stimulation on MFC mCxcr4 cells, d is a fluorescence imaging diagram of ATCG-1 after magnetic heat stimulation in the peritoneal cavity of mice to recruit DTC, and e is a fluorescence quantitative statistical diagram of ATCG-1 after magnetic heat stimulation in the peritoneal cavity of mice to recruit DTC. In a, 1 is that 10 5 GES-1 were added to the surface of IMS with a volume of 100 mm 3 , and were co-incubated for 10 min at 37°C to obtain IMS containing GES-1 without heat stimulation; 2 is that 10 5 GES-1 were added to the surface of IMS with a volume of 100 mm 3 On the surface of IMS, co-incubated at 37°C for 10 min to obtain IMS containing GES-1. The IMS containing GES-1 was then heat-stimulated using the same method as described above; 3 is ATCG-1 prepared in Example 1, without heat stimulation; 4 is ATCG-1 prepared in Example 1, heat-stimulated; 5 is ATCG-1 prepared in Example 1, heat-stimulated with hCXCL12 protein inhibitor; 6 is 10... 5 One NIH-3T3 was added to a volume of 100 mm². 3 On the surface of IMS, it was co-incubated at 37°C for 10 min to obtain IMS containing NIH-3T3 without heat stimulation; 7 is to place 10 5 One NIH-3T3 was added to a volume of 100 mm². 3 On the surface of the IMS, it was incubated at 37°C for 10 min to obtain IMS containing NIH-3T3. The IMS containing NIH-3T3 was then heat-stimulated using the same method as described above; 8 is ATCG-2 prepared in Example 2, without heat stimulation; 9 is ATCG-2 prepared in Example 2 that has been heat-stimulated; 10 is ATCG-2 prepared in Example 2 with the addition of hCXCL12 protein inhibitor; the meanings of the horizontal axes in b and c are the same as the corresponding labels in a; in d, GES-1 represents 10 5 One GES-1 was added to a volume of 100 mm². 3 On the surface of the IMS, co-incubation at 37°C for 10 min yielded an IMS group containing GES-1; GES-1 CXCL12 The ATCG-1 group prepared in Example 1; GES-1 CXCL12 +AMF is a magnetocaloric treatment group based on ATCG-1 prepared in Example 1; e is the same as d, and the ordinate in e is 1*10. 09 That is, 1*10 9 5*10 08 That is, 5*10 8 .from Figure 5 It can be seen that, in the in vitro Transwell co-culture system, ATCG-1 and ATCG-2, after 3 days of heat stimulation, inhibited the growth of human gastric cancer cells MGC-803 and mouse gastric cancer cells MFC. mCxcr4ATCG-1 exhibits significant chemotactic activity, with quantified chemotactic cell activity reaching 5.56–7.53 times that of the control groups (1 and 6). Furthermore, it significantly inhibits DTC chemotaxis after inhibitor treatment. After 7 days of in vivo magnetothermal stimulation, ATCG-1 significantly recruits MGC-803 cells and induces intraperitoneal DTC colonization on the ATCG-1 scaffold, with quantified fluorescence intensity showing an effect 14.05 times greater than the control group (GES-1). These data indicate that ATCG possesses significant chemotactic and recruitment capabilities for gastric cancer cells both in vitro and in vivo, and induces tumor cell colonization on the scaffold.
[0102] 10 3 days in advance 5 MFC, a mouse-derived gastric cancer cell line. mCxcr4 An experimental peritoneal transfer model with a healthy immune system was established by injecting ATCG-2 into the peritoneal cavity of mice. Subsequently, after transplanting ATCG-2 into the peritoneal cavity of mice, on days 1 and 3, the mice were exposed to a 60 mm diameter coil, an alternating magnetic field at a frequency of 340 kHz and an alternating magnetic field of 22.5 kA / m (which can raise the temperature to about 45 °C) for 10 min of magnetothermal treatment. This induced ATCG-2 to secrete the chemokine CXCL12 to recruit DTCs in the peritoneal cavity. On days 5 and 7, the mice were exposed to a 60 mm diameter coil, an alternating magnetic field at a frequency of 340 kHz and an alternating magnetic field of 27 kA / m (which can raise the temperature to about 55 °C) for 10 min of magnetothermal treatment. This induced ATCG-2 to generate high-temperature environment-damaged DTCs and release TAA. On day 14, mice were imaged using an IVIS-CT system, and peritoneal fluid was collected. Flow cytometry was used to analyze CD4-positive and CD8-positive T cells to obtain an evaluation chart of the therapeutic effect of ATCG-2 in the peritoneal metastasis mouse model. Figure 6 As shown (Number of metastatic—transfer number, Precent—percentage); Figure 6 In the diagram, a is a 3D CT image of a mouse model with peritoneal metastasis after treatment with ATCG-2; b is a statistical graph of the number of peritoneal metastases after treatment with ATCG-2 in the same mouse model; and c is a statistical graph of CD4 and CD8 T cells in the peritoneal cavity after treatment with ATCG-2 in the same mouse model. In a, Control indicates that only 10... 5 MFC, a mouse-derived gastric cancer cell line. mCxcr4 Injected intraperitoneally into mice, no treatment was given in the 3T3 group; 3T3 was injected with 10 5 One NIH-3T3 was added to a volume of 100 mm². 3 On the surface of the IMS, co-incubation at 37°C for 10 min yielded IMS containing NIH-3T3, and MFC was then added. mCxcr4After injection into the abdominal cavity of mice, the IMS containing NIH-3T3 is transplanted into the abdominal cavity group of mice; 3T3 12 For the MFC mCxcr4 After injection into the abdominal cavity of mice, the ATCG-2 is transplanted into the abdominal cavity group of mice; 3T3 12 45AMFFor the MFC mCxcr4 After injection into the abdominal cavity of mice, the ATCG-2 is transplanted into the abdominal cavity of mice, and the mice are exposed to a 60mm diameter coil, a frequency of 340kHz, an alternating magnetic field of 22.5kA / m on the 1st day and the 3rd day, and a magnetic heat treatment of 10min, to induce the secretion of chemokine CXCL12 of ATCG-2 to recruit DTC in the abdominal cavity group; 3T3 12 55AMFFor the MFC mCxcr4 After injection into the abdominal cavity of mice, the ATCG-2 is transplanted into the abdominal cavity of mice, and the mice are exposed to a 60mm diameter coil, a frequency of 340kHz, an alternating magnetic field of 27kA / m on the 5th day and the 7th day, and a magnetic heat treatment of 10min, to induce the high-temperature environmental injury of DTC and the release of TAA group; 3T3 12 45AMF55AMFFor the MFC described in the initial description above; the meanings of the labels in b and c are the same as in a. Figure 6 As can be seen from the above, after the treatment of ATCG-2, the IVIS-CT imaging result shows that ATCG-2 can effectively reduce the number of abdominal metastasis, and the quantitative result shows that the number of abdominal metastasis can be reduced by 6.09 times; the number of CD4 positive cells in the abdominal cavity changes little, while the CD8 positive T cells in the ATCG-2 treatment group are significantly increased by 1.8 times. The above data shows that ATCG-2 can effectively weaken the peritoneal metastasis and effectively activate the immune level in the abdominal cavity, realizing the intraperitoneal immunotherapy for DTC.
[0103] As can be seen from the above examples, the present application provides an alginate-based thermal genetics CXCL12 releaser (ATCG) based on optimized alternating magnetic field (AMF), which is prepared by using transgenic and freeze-drying technology, is convenient and simple to prepare, and can be produced on a large scale. The ATCG is composed of a porous magnetic scaffold (IMS) loaded with engineering cells, the engineering cells are stably transfected with the thermal genetics element of pHSP70-CXCL12 by a lentivirus, and the porous magnetic scaffold is composed of a main frame structure wrapped with magnetic particles and has an isotropic porous structure. The ATCG prepared by the present application can controllably release the CXCL12 chemotactic factor for DTC recruitment, and activate the anti-DTC abdominal cavity immunity after magnetic heat ablation, thereby inhibiting the abdominal cavity metastasis of DTC.
[0104] The above merely describes the preferred embodiments of the present application, and it should be pointed out that, for those skilled in the art, several improvements and refinements can be made without departing from the principles of the present application, and these improvements and refinements should also be considered as falling within the protection scope of the present application.
Claims
1. A method for the preparation of an alginate-based thermal epigenetic CXCL12 releaser, characterized by, The preparation method comprises the following steps: (1) mixing a first biopolymer material solution, a first magnetic particle solution and a crosslinking agent to perform crosslinking, to obtain a porous magnetic scaffold; (2) adding a thermogenetics CXCL12 genetically engineered cell to the surface of the porous magnetic scaffold to perform co-incubation, to obtain the alginate-based thermogenetics CXCL12 releaser; When the first biopolymer material is sodium alginate, the preparation method of the porous magnetic scaffold comprises the following steps: mixing a sodium alginate solution, a first magnetic particle solution and a first crosslinking agent to perform first crosslinking, and performing freeze-drying after the first crosslinking is completed, to obtain an intermediate substance; mixing the intermediate substance and a second crosslinking agent to perform second crosslinking, to obtain the porous magnetic scaffold; the mass fraction of the sodium alginate solution is 1.5-2.5%; the first crosslinking agent is a calcium gluconate solution, and the mass fraction of the calcium gluconate solution is 0.5-1.0%; the second crosslinking agent is a calcium chloride solution, and the concentration of the calcium chloride solution is 0.5-1.5 mol / L; the volume ratio of the sodium alginate solution, the first magnetic particle solution and the calcium gluconate solution is 1-3:0.5-1.5:0.5-1.5; the first magnetic particle in the first magnetic particle solution comprises iron-cobalt graphite nanocapsules, and the mass concentration of the first magnetic particle solution is 8-12 mg / mL; the preparation method of the thermogenetics CXCL12 genetically engineered cell in step (2) comprises the following steps: transforming a central DNA plasmid constructed with an HSP70 promoter and a thermogenetics CXCL12 gene, a packaging plasmid pMD2.G and a packaging plasmid psPAX2 into 293T cells, collecting the lentivirus in the culture solution after 3 days of transfection, then co-incubating the lentivirus with GES-1 or NIH-3T3 for 3 days, adding puromycin for screening for 7 days after the co-incubation is completed, and finally obtaining the cells that survive after the screening as the thermogenetics CXCL12 genetically engineered cell.
2. The method for preparing alginate-based thermal-genetic CXCL12 releasers according to claim 1, characterized in that, the temperature of the first crosslinking is 20-30℃, and the time of the first crosslinking is 10-15 min; the temperature of the freeze-drying is -15--25℃, and the time of the freeze-drying is 22-26 h; the temperature of the second crosslinking is 20-30℃, and the time of the second crosslinking is 1.5-2.5 h.
3. The method for preparing the alginate-based thermogenetic CXCL12 releaser as described in claim 1, characterized in that, The ratio of the number of the thermo-genetics CXCL12 gene engineering cells in step (2) to the volume of the porous magnetic stent is 0.8x10 5 ~1.2x10 5 mm 3 ; the temperature of the co-incubation is 35-40℃, and the time of the co-incubation is 5-15 min.
4. The alginate-based thermogenetics CXCL12 releaser prepared by the preparation method in any one of claims 1-3.
5. The alginate-based thermogenetics CXCL12 releaser in claim 4 in the preparation of a drug for inhibiting peritoneal metastasis of gastric cancer.