Method for measuring human galectin-3 protein level and application thereof

Abstract

The present application provides antibodies or antigen-binding portions thereof that bind to human galectin-3, as well as antibody combination products. The present application also provides kits for detecting the level of galectin-3 in a sample from a human subject and their uses.

Description

Technical Field

[0001] This application generally relates to the field of biological detection, and more specifically, it provides antibodies or antigen-binding moieties thereof for binding to human galactolectin-3, as well as antibody combination products. This application also provides a kit for detecting levels of galactolectin-3 in samples from human subjects and its use therein. Background Technology

[0002] Galectins (Gal) are a class of animal lectins superfamily, widely distributed in various animals. Since their first isolation in 1976, 15 types of Gal have been discovered to date, named Gal-1 to Gal-15 according to their discovery time. Based on their structural differences and the number of conserved sugar recognition domains in their polypeptide chains, they are divided into three categories: (1) Proto-galectins (galectin-1, -2, -5, -7, -10, -11, -13, -14 and -15) contain one CRD; (2) Tandem repeat galectins (galectin-4, -6, -8, -9 and -12) consist of two CRDs separated by a single polypeptide linked by a linker region; (3) Chimeric galectins (Galectin-3) contain one CRD and are linked to an extended non-lectin N-terminal domain. Although they differ in structure, they share common characteristics: they possess similar complementary region (CRD) consisting of 135 amino acids and an affinity for β-galactosides.

[0003] Galectin-3 is the only chimeric member of the Galectin family and one of the most studied members. The human Galectin-3 gene is located on chromosome 14q21-22, with a total length of about 17kb, containing 250 amino acid residues, a molecular weight of about 29.31KD, and 6 exons and 5 introns. Human Galectin-3 has 3 domains: (1) the NH2- (amino) terminus of amino acids 1-12, which determines cell localization and is also essential for the highly conserved ser6 residue to participate in the anti-apoptotic activity of Galectin-3; (2) a collagen repeat sequence rich in glycine, tyrosine, and proline, which functions as a substrate for matrix metalloproteinases (MMPs); and (3) a globular carbohydrate binding site (CRD) with a COOH- (carboxyl) terminus.

[0004] A schematic diagram of the Galectin-3 protein structure is shown below. Figure 1 As shown.

[0005] Galectin-3 possesses a collagen-like domain, a structure also found in matrix metalloproteinases (MMPs). This structural similarity makes Galectin-3 a substrate for MMPs, readily cleaved by them, particularly by MMP-2 or MMP-9. MMP-2 or MMP-9 cleaves Galectin-3, generating a 22kD sugar recognition domain and a 9kD amino acid terminal fragment. This cleaved Galectin-3 enhances angiogenesis and plays a more significant role in tumor metastasis and invasion. The closer Galectin-3 is to stromal cancer cells, the greater its invasiveness. Literature reports that in breast cancer research, cleaved Galectin-3 activates PKC or induces GTPase, upregulates the pFAK pathway, enhances endothelial cell chemotaxis, promotes endothelial cell migration and chemotaxis, thereby promoting angiogenesis. Tumor-associated factor mucin 1, acting as a ligand for Galectin-3, increases Galectin-3's adhesion to tumors, indirectly contributing to tumor cell invasion.

[0006] Matrix metalloproteinases (MMPs) are endopeptidases that play a crucial role in the degradation of the extracellular matrix (ECM). Dysfunction of MMPs can lead to diastolic or systolic dysfunction of the heart, resulting in heart failure. Galectin-3 and MMPs work together to influence various physiological and pathological processes in the human body. Numerous studies have shown a positive correlation between the expression of galactolectin 3 and matrix metalloproteinases 1, 2, and 9 in various malignant tumors such as breast cancer and lung cancer, indicating their joint involvement in tumor development. The combined action of Galectin-3 and MMP-9 can promote the metastasis of various tumors. The main mechanism is that Galectin-3, as a substrate of MMP-9, is cleaved by MMP-9. Galectin-3, after being cleaved by MMP-9, activates the pFAK pathway, promoting chemotaxis and migration of vascular endothelial cells, thereby promoting angiogenesis. Following vascular injury, both MMP-9 and Galectin-3 levels increase at the site of injury.

[0007] Galectin-3 is widely expressed in human tissues, including various types of immune cells (macrophages, monocytes, dendritic cells, eosinophils, mast cells, natural killer cells, activated T and B cells), epithelial cells, endothelial cells, and sensory neurons. Galectin-3 is primarily located in the cytoplasm and shuttles into the nucleus. It is also secreted onto the cell surface and into biological fluids. Different locations of Galectin-3 contribute to its various functions. In the cytoplasm, Galectin-3 is crucial for cell survival due to its interactions with certain survival-related proteins, including B-cell lymphoma-2 (Bcl-2) and activated guanine nucleoside (GTP)-bound K-Ras. In the nucleus, Galectin-3 promotes mRNA pre-splicing and regulates gene transcription, while extracellular Galectin-3 regulates intercellular interactions, including those between epithelial cells and the extracellular matrix. Therefore, it is involved in cell differentiation, inflammation, fibrosis, and host defense. Therefore, Galectin-3 is crucial in numerous biological activities, including cell growth, apoptosis, mRNA pre-splicing, differentiation, transformation, angiogenesis, inflammation, fibrosis, and host defense. Galectin-3 participates in the pathogenesis of cardiovascular remodeling, as well as various autoimmune and inflammatory processes. Galectin-3 is closely related to the occurrence and development of many diseases and is a potential diagnostic biomarker and therapeutic target.

[0008] The levels of Galectin-3 in bodily fluids such as blood or serum can reflect a person's disease status, such as chronic heart failure. Therefore, accurate quantification of Galectin-3 can be used to identify or predict diseases, assess disease severity, stage or predict disease outcomes, or monitor drug efficacy for clinical or research needs. Current detection methods struggle to accurately quantify Galectin-3 and distinguish it from other galactolectins or their protein fragments because Galectin-3 shares high sequence similarity with 14 other mammalian galactolectins, particularly in its conserved carbohydrate recognition domain (CRD). The CRD region of Galectin-3 can bind lactose, glycoproteins, laminin, etc. Another important factor is that Galectin-3 is a substrate of MMPs and can be cleaved by them; cleaved Galectin-3 exhibits enhanced activity. Therefore, there is a need to develop a detection method that can specifically and accurately measure Galectin-3 levels and distinguish between full-length Galectin-3 protein and Galectin-3 protein fragments cleaved by proteases, unaffected by CRD region binding to lactose, glycoproteins, laminin, etc.

[0009] Most current antibodies, methods, and kits for detecting Galectin-3 protein do not clearly specify the range of Galectin-3 protein sites targeted. Some methods or kits even use polyclonal antibodies, making it impossible to determine whether the result indicates the full-length or total Galectin-3 protein content. Using polyclonal antibodies can sometimes result in a higher-than-expected Galectin-3 protein content. Currently, apart from this invention, no other antibody, method, or kit has eliminated the influence of galactose, lactose, laminin, glycoproteins, ligands, etc., in the sample on the detected Galectin-3 protein content. Detection results that do not exclude the influence of galactose, lactose, laminin, glycoproteins, ligands, etc., in the sample are therefore somewhat controversial. Summary of the Invention

[0010] In a first aspect, this application provides an antibody or its antigen-binding portion thereof, the antibody being capable of binding human Galectin-3, and the binding epitope being located in the N-terminal amino acid sequence region of human Galectin-3 as shown in SEQ ID NO:1.

[0011] In some embodiments, the antibody comprises HCDR1 shown in SEQ ID NO:3, HCDR2 shown in SEQ ID NO:4, HCDR3 shown in SEQ ID NO:5, LCDR1 shown in SEQ ID NO:6, LCDR2 shown in SEQ ID NO:7, and LCDR3 shown in SEQ ID NO:8, wherein the antibody heavy chain variable region sequence is shown in SEQ ID NO:27, and the light chain variable region sequence is shown in SEQ ID NO:28.

[0012] In some embodiments, the antibody comprises HCDR1 shown in SEQ ID NO:9, HCDR2 shown in SEQ ID NO:10, HCDR3 shown in SEQ ID NO:11, LCDR1 shown in SEQ ID NO:12, LCDR2 shown in SEQ ID NO:13, and LCDR3 shown in SEQ ID NO:14, wherein the antibody heavy chain variable region sequence is shown in SEQ ID NO:29, and the light chain variable region sequence is shown in SEQ ID NO:30.

[0013] Secondly, this application provides an antibody or its antigen-binding portion thereof, the antibody being capable of binding to human Galectin-3, and the binding epitope being located in the N-terminal amino acid sequence region 63-250 of human Galectin-3 as shown in SEQ ID NO:2.

[0014] In some embodiments, the antibody comprises HCDR1 shown in SEQ ID NO:15, HCDR2 shown in SEQ ID NO:16, HCDR3 shown in SEQ ID NO:17, LCDR1 shown in SEQ ID NO:18, LCDR2 shown in SEQ ID NO:19, and LCDR3 shown in SEQ ID NO:20, the antibody heavy chain variable region sequence is shown in SEQ ID NO:31, and the light chain variable region sequence is shown in SEQ ID NO:32.

[0015] In some embodiments, the antibody comprises HCDR1 shown in SEQ ID NO:21, HCDR2 shown in SEQ ID NO:22, HCDR3 shown in SEQ ID NO:23, LCDR1 shown in SEQ ID NO:24, LCDR2 shown in SEQ ID NO:25, and LCDR3 shown in SEQ ID NO:26, wherein the antibody heavy chain variable region sequence is shown in SEQ ID NO:33, and the light chain variable region sequence is shown in SEQ ID NO:34.

[0016] Thirdly, this application provides an antibody combination product comprising a first antibody and a second antibody, wherein the first antibody and the second antibody are selected from the antibodies described in the first and second aspects or their antigen-binding portions.

[0017] In some embodiments, the first antibody is selected from the antibodies described in the first aspect or their antigen-binding portions, and the second antibody is selected from the antibodies described in the second aspect or their antigen-binding portions.

[0018] In some embodiments, the first antibody is selected from the antibody described in the second aspect or its antigen-binding portion, and the second antibody is selected from the antibody described in the first aspect or its antigen-binding portion.

[0019] In some embodiments, both the first antibody and the second antibody are selected from the antibodies described in the first aspect or their antigen-binding portions.

[0020] In some implementations, both the first antibody and the second antibody are selected from the antibodies or their antigen-binding portions described in the second aspect.

[0021] In some implementations, the first antibody is labeled with a detectable marker.

[0022] In some implementations, the second antibody is labeled with a detectable marker.

[0023] In some implementations, the detectable marker is selected from enzymes, cofactors, fluorescent substances, luminescent substances, latex particles, gold particles, bioluminescent substances, and radioactive substances.

[0024] Fourthly, this application provides a kit for detecting the level of galactolectin-3 in samples from human subjects, comprising the antibodies or antigen-binding portions thereof described in the first and / or second aspects, or the antibody combination product described in the third aspect.

[0025] In some embodiments, the level of galactolectin-3 is the level of full-length human Galectin-3 protein or the level of total human Galectin-3 protein.

[0026] In some embodiments, the level of galactolectin-3 is the level of the full-length human Galectin-3 protein.

[0027] In some embodiments, the level of galactolectin-3 is the level of total human Galectin-3 protein.

[0028] In some embodiments, the kit uses a double-antibody sandwich assay to detect galactoglobulin-3 levels; the double-antibody sandwich assay is selected from ELISA, colloidal gold, immunochromatography, surface-enhanced Raman scattering immunochromatography, chemiluminescence, microfluidics, and single-molecule immunoassay arrays. In some embodiments, the kit is an ELISA detection kit, a colloidal gold detection kit, an immunochromatographic detection kit, a surface-enhanced Raman scattering immunochromatographic detection kit, a chemiluminescence detection kit, a microfluidic detection kit, or a single-molecule immunoassay array detection kit.

[0029] Fifthly, this application provides the use of the antibodies or antigen-binding portions thereof described in the first and / or second aspects, or the antibody combination products described in the third aspect, in the preparation of a kit for detecting the level of galactolectin-3 in biological samples.

[0030] Sixthly, this application provides the use of the antibody or its antigen-binding portion as described in the first and / or second aspects, or the antibody combination product as described in the third aspect, in the preparation of a kit for diagnosing or assisting in the diagnosis of a disease, wherein the disease is selected from cardiovascular diseases, tumors, rheumatic immune diseases, kidney diseases, respiratory diseases, digestive diseases, or infectious diseases.

[0031] In some implementations, the cardiovascular disease is heart failure, coronary artery disease, or atrial fibrillation.

[0032] In some implementations, the tumor is thyroid cancer, breast cancer, ovarian cancer, gastric cancer, esophageal cancer, non-small cell lung cancer, colon adenocarcinoma, or endometrial cancer.

[0033] In some implementations, the rheumatic immune disease is rheumatoid arthritis.

[0034] In some implementations, the kidney disease is chronic kidney disease.

[0035] In some implementations, the respiratory disease is bronchial asthma, chronic obstructive pulmonary disease, or primary Sjögren's syndrome.

[0036] In some implementations, the digestive system disease is ulcerative colitis or cirrhosis.

[0037] In some implementations, the infectious disease is sepsis.

[0038] Seventhly, this application provides a method for detecting the level of human Galectin-3, the method comprising,

[0039] The first or second antibody in the antibody combination product described in the third aspect is labeled with a detectable marker;

[0040] The level of human Galectin-3 was detected using a double-antibody sandwich method;

[0041] The double-antibody sandwich method is selected from ELISA, colloidal gold, immunochromatography, surface-enhanced Raman scattering immunochromatography, chemiluminescence, microfluidics, and single-molecule immunoassay arrays.

[0042] In some implementations, the antibody or its antigen-binding portion described in the first aspect is labeled with a detectable marker.

[0043] In some implementations, the antibody or its antigen-binding portion described in the second aspect is labeled with a detectable marker.

[0044] In some embodiments, the level of human Galectin-3 is the level of full-length human Galectin-3 protein or the level of total human Galectin-3 protein.

[0045] In some implementations, the level of human Galectin-3 is the level of the full-length human Galectin-3 protein.

[0046] In some implementations, the level of said human Galectin-3 is the level of total human Galectin-3 protein.

[0047] In some implementations, the total human Galectin-3 protein level is the sum of the full-length human Galectin-3 protein and the Galectin-3 protein fragmented by proteases. Therefore, the total human Galectin-3 protein level is the sum of the full-length human Galectin-3 protein and the N-terminal amino acid fragment from amino acid position 63 to 250, or the total human Galectin-3 protein level is the sum of the full-length human Galectin-3 protein and the N-terminal amino acid fragment from amino acid position 1 to 62.

[0048] In some implementations, the total human Galectin-3 protein level is the sum of the full-length human Galectin-3 protein and the N-terminal amino acid fragment from position 63 to 250 of human Galectin-3.

[0049] In some implementations, the total human Galectin-3 protein level is the sum of the full-length human Galectin-3 protein and the N-terminal amino acid fragments of human Galectin-3 from amino acid position 1 to 62.

[0050] In some implementations, the human Galectin-3 protein level is measured using a double-antibody sandwich method. One of the epitope antibodies in the range of amino acids 1-62 of the N-terminal protein of human Galectin-3 and the epitope antibodies in the range of amino acids 63-250 of the human Galectin-3 protein is used as the capture antibody, and the other antibody is used as the detection antibody.

[0051] In some implementations, in the double-antibody sandwich method, antibodies against different epitopes within the range of amino acids 1-62 at the N-terminus of human Galectin-3 protein are used as capture or detection antibodies.

[0052] In some implementations, in the double-antibody sandwich method, antibodies against different epitopes within the amino acid range of human Galectin-3 protein from amino acid position 63 to 250 are used as capture or detection antibodies.

[0053] In some embodiments, the antibody or its antigen-binding portion described in the first or second aspect binds to human Galectin-3 protein, and the binding is unaffected by whether galactose, lactose, laminin, other glycoproteins, or ligands bind to human Galectin-3 protein.

[0054] In some implementations, the double-antibody sandwich method includes, but is not limited to, ELISA, colloidal gold, immunochromatography, surface-enhanced Raman scattering immunochromatography, chemiluminescence, microfluidics, or single-molecule immunoassay arrays.

[0055] In some implementation schemes, the level of total human Galectin-3 protein can be detected using sandwich, direct, or indirect methods.

[0056] Eighthly, this application provides a method for diagnosing or assisting in the diagnosis of a disease, the method comprising,

[0057] The first or second antibody in the antibody combination product of claim 5 is labeled with a detectable marker;

[0058] The level of human Galectin-3 was detected using a double-antibody sandwich method, wherein the level of human Galectin-3 was the level of full-length human Galectin-3 protein or the level of total human Galectin-3 protein.

[0059] The double-antibody sandwich method mentioned above is selected from ELISA, colloidal gold, immunochromatography, surface-enhanced Raman scattering immunochromatography, chemiluminescence, microfluidics, and single-molecule immunoassay arrays.

[0060] The diseases mentioned are selected from cardiovascular diseases, tumors, rheumatic immune diseases, kidney diseases, respiratory diseases, digestive diseases, or infectious diseases.

[0061] In some implementations, the cardiovascular disease is heart failure, coronary artery disease, or atrial fibrillation.

[0062] In some implementations, the tumor is thyroid cancer, breast cancer, ovarian cancer, gastric cancer, esophageal cancer, non-small cell lung cancer, colon adenocarcinoma, or endometrial cancer.

[0063] In some implementations, the rheumatic immune disease is rheumatoid arthritis.

[0064] In some implementations, the kidney disease is chronic kidney disease.

[0065] In some implementations, the respiratory disease is bronchial asthma, chronic obstructive pulmonary disease, or primary Sjögren's syndrome.

[0066] In some implementations, the digestive system disease is ulcerative colitis or cirrhosis.

[0067] In some implementations, the infectious disease is sepsis.

[0068] In some embodiments, the level of human Galectin-3 is the level of full-length human Galectin-3 protein or the level of total human Galectin-3 protein.

[0069] In some implementations, the level of human Galectin-3 is the level of the full-length human Galectin-3 protein.

[0070] In some implementations, the level of human Galectin-3 is the level of total human Galectin-3 protein.

[0071] In some implementations, the total human Galectin-3 protein level is the sum of the full-length human Galectin-3 protein and the Galectin-3 protein fragmented by proteases.

[0072] In some implementations, the total human Galectin-3 protein level is the sum of the full-length human Galectin-3 protein and the N-terminal amino acid fragment from position 63 to 250 of human Galectin-3.

[0073] In some implementations, the total human Galectin-3 protein level is the sum of the full-length human Galectin-3 protein and the N-terminal amino acid fragments of human Galectin-3 from amino acid position 1 to 62. Attached Figure Description

[0074] Figure 1 This is a schematic diagram of the Galectin-3 protein structure.

[0075] Figure 2 The Galectin-3 monoclonal antibody is affected by laminin.

[0076] Figure 3 ELISA standard curve for detecting full-length Galectin-3 protein using the antibody combination UV4E4-E15F10.

[0077] Figure 4 ELISA standard curve for detecting Galectin-3 total protein using antibody combination Q1E2-E15F10.

[0078] Figure 5 ELISA standard curve for detecting Galectin-3 total protein using the antibody combination UV4E4–Y7E12.

[0079] Figure 6 This is a schematic diagram of the structure of the colloidal gold detection strip for Galectin-3 protein.

[0080] Figure 7 Standard curve for detecting full-length Galectin-3 protein using the UV4E4-E15F10 colloidal gold method with antibody combination.

[0081] Figure 8 Standard curve for the detection of Galectin-3 total protein using the colloidal gold method with antibody combination Q1E2-E15F10.

[0082] Figure 9Standard curve for detecting Galectin-3 total protein using the colloidal gold method with the antibody combination UV4E4–Y7E12.

[0083] Figure 10 This is a schematic diagram of the structure of the immunochromatographic strip for detecting Galectin-3 protein.

[0084] Figure 11 Standard curve for detecting full-length Galectin-3 protein using the UV4E4-E15F10 antibody combination immunochromatographic assay.

[0085] Figure 12 A standard curve for the immunochromatographic assay of total Galectin-3 protein using antibody combination Q1E2-E15F10 was prepared.

[0086] Figure 13 Standard curve for detecting Galectin-3 total protein by immunochromatography using the antibody combination UV4E4–Y7E12. Detailed Implementation

[0087] This invention provides a method for determining the level of full-length human Galectin-3 protein, a method for determining the level of total human Galectin-3 protein (including full-length human Galectin-3 protein and Galectin-3 protein fragmented by protease), an antibody and its antigen-binding fragment that can specifically bind to human Galectin-3 in the detection method, a method for using these antibodies and their antigen-binding fragments, and a kit containing said antibody and its antigen-binding fragment.

[0088] The term “CDR” as used in this article refers to the complementarity-determining region within the variable region sequence of an immunoglobulin. Three CDRs exist in each of the heavy and light chain variable regions, designated CDR1, CDR2, and CDR3 for the heavy and light chain variable regions, respectively. The term “CDR set” refers to a group of three CDRs appearing in a single variable region capable of binding the antigen. The exact boundaries of these CDRs have been defined according to different systems. The system described by Kabat (Kabat et al. (1971) Ann. NY Acad. Sci. 190:382-391; Kabat et al. (1987) Sequences of Proteins of Immunological Interest, 4th ed. US Govt. Printing Off. No. 165-492; Kabat et al. (1991) Sequences of Proteins of Immunological Interest, 5th ed. NIH Publication No. 91-3242) provides not only a definitive residue numbering system applicable to any antibody variable region but also precise residue boundaries defining the three CDRs. These CDRs can be referred to as Kabat CDRs. The amino acid residues in the CDR region are more variable (e.g., hypervariable) than other amino acid residues in the variable regions of the antibody's heavy and light chains. Chothia et al. (Chothia and Lesk (1987) J. Mol. Biol. 196:901-917; Chothia et al. (1989) Nature 342:877-883) found that certain sub-regions within the Kabat CDR take almost identical peptide backbone conformations, despite significant diversity at the amino acid sequence level. These sub-regions are designated as L1 (LCDR1), L2 (LCDR2), and L3 (LCDR3) or H1 (HCDR1), H2 (HCDR2), and H3 (HCDR3), where "L" and "H" designate the light and heavy chain regions, respectively. These regions can be referred to as Chothia CDRs, which have boundaries that overlap with the Kabat CDRs. Other boundaries defining CDRs overlapping with the Kabat CDR have been described by Padlan (1995) FASEB J.9:133-139 and MacCallum (1996) J.Mol.Biol.262(5):732-45. Other CDR boundary definitions may not strictly follow one of the systems described herein, but still overlap with the Kabat CDR. Antibodies or their antigen-binding portions described herein may utilize CDRs defined according to any of these systems.

[0089] Galactoglobulin-3

[0090] Galectin-3 (GenBank accession numbers: NC_000014.9 (gene) and NP_002297.2 (protein)) is one of 15 mammalian β-galactosyl-binding lectins or "galactose agglutinins" that specifically bind to galactose. Galectin-3 is also referred to in the literature as LGALS3, MAC-2 antigen, sugar-binding protein (CBP)-35, laminin-binding protein, galactose-specific lectin 3, mL-34, L-29, hL-31, εBP, and IgE-binding protein.

[0091] Galectin-3 is the only member of the chimeric Gal group and possesses a collagen-like domain, a structure also found in matrix metalloproteinases (MMPs). This structural similarity makes Galectin-3 a substrate for MMPs, readily cleaved by them, particularly by MMP-2 or MMP-9. MMP-2 or MMP-9 cleaves Galectin-3 at the Ala62-Tyr63 site, generating a 22kD fragment with an intact CRD and a 9kD polypeptide that forms the N-terminus of Galectin-3. The 22kD fragment of the cleaved Galectin-3 exhibits high affinity for carbohydrate ligands, enhancing angiogenesis and facilitating its role in tumor metastasis and invasion. The closer Galectin-3 is to stromal cancer cells, the greater its invasiveness.

[0092] Matrix metalloproteinases (MMps) are endopeptidases that play a crucial role in the degradation of the extracellular matrix. Dysfunction of these endopeptidases can lead to diastolic or systolic dysfunction of the heart, resulting in heart failure. Galectin-3 and MMps work together in various physiological and pathological processes in the human body. Numerous studies have shown a positive correlation between the expression of galactoglobulin-3 and matrix metalloproteinases 1, 2, and 9 in various malignant tumors such as breast cancer and lung cancer, indicating their joint involvement in the development of tumor diseases.

[0093] This invention discloses a method for determining the level of full-length human Galectin-3 protein. It discovers that by targeting the protein fragments at both ends of the human Galectin-3 protease cleavage site, namely Met1-Ala62 and Tyr63-Ile250, the content of full-length Galectin-3 protein in a sample can be accurately determined. Using the antibodies disclosed herein, combined with immunoassays known in the art, such as ELISA, immunochromatography, immunofluorescence, and chemiluminescence, the content of full-length Galectin-3 protein in a sample can be reliably and reproducibly detected.

[0094] The present invention discloses a method for determining the total protein level of human Galectin-3. By targeting the N-terminal fragment Met1-Ala62 or the Galectin-3 protein fragment with CRD structure Tyr63-Ile250 produced after the human Galectin-3 protein is degraded by enzymes, the content of total Galectin-3 protein in the sample can be determined more accurately. By using the antibodies disclosed herein, combined with immunoassays known in the art, such as ELISA, immunochromatography, immunofluorescence, chemiluminescence, immunoturbidimetry, immunohistochemistry, and Western blotting, the total Galectin-3 protein content in a sample (including full-length human Galectin-3 protein and Galectin-3 protein cleaved into fragments by proteases; for example, the total human Galectin-3 protein level is the sum of the full-length human Galectin-3 protein and the N-terminal amino acid fragments from amino acids 63 to 250 of human Galectin-3; for example, the total human Galectin-3 protein level is the sum of the full-length human Galectin-3 protein and the N-terminal amino acid fragments from amino acids 1 to 62 of human Galectin-3) can be assessed more accurately for the severity and stage of heart failure, cancer, inflammation, etc.

[0095] The method for determining the full-length human Galectin-3 protein level in this invention, when used in combination with the method for determining the total human Galectin-3 protein level, can also analyze the levels of full-length Galectin-3 protein in samples, Galectin-3 protein fragments with CRD structures produced after enzyme degradation, the relationship with matrix metalloproteinases, and their association with diseases such as heart failure, cancer, and inflammation.

[0096] Biological functions of Galectin-3

[0097] Galectin-3 has a variety of biological functions. It can bind to a variety of ligands on the cell surface and extracellular matrix, and plays an important role in a series of physiological and pathological processes, including apoptosis, adhesion, proliferation, migration, inflammatory response, immune response and fibrosis.

[0098] 1. Promotes inflammatory response

[0099] Gatectin-3 is a pro-inflammatory cytokine involved in acute, chronic, and allergic inflammatory processes, serving as a potent inflammatory signal. In acute inflammation, it stimulates neutrophil activation and adhesion, while in chronic inflammation, it stimulates the activation of monocytes / macrophages and fibroblasts. Its pro-inflammatory effects are also manifested in inducing the release of inflammatory mediators from mast cells and in promoting chemotaxis of monocytes / macrophages, thus enhancing macrophage migration, mediator release, and the effects of pro-inflammatory factors. This differs from the traditional understanding of macrophage activation induced by interferon. Gatectin-3 can activate reduced coenzyme II, stimulate the production of superoxide dismutase in neutrophils, mediate lipopolysaccharide-induced interleukin IL-4 production, and promote monocyte chemotaxis. IL-4 can act on macrophages to stimulate Galectin-3 expression and secretion, while selectively activating other macrophage phenotypes. IL-4 activation of macrophages can be inhibited by disulfide, a C-H bond inhibitor of extracellular Galectin-3. Therefore, when there is excessive secretion of extracellular Galectin-3, antibodies may negatively impact macrophages through disulfide feedback, reducing macrophage overactivation. This suggests that Galectin-3 is a regulatory molecule at different stages of the process from acute inflammation to chronic inflammatory fibrosis.

[0100] 2. Promotes fibrosis

[0101] Various neuroendocrine hormones in the body can activate macrophages, which then secrete Galectin-3, directly inducing the activation of fibroblasts and the deposition of type I collagen in the extracellular matrix. When tissue damage occurs, Galectin-3 is secreted into the extracellular space, activating cyclin D1, causing the proliferation of cytoskeletal proteins and type I collagen α-i chains in the extracellular matrix, thereby activating quiescent fibroblasts and leading to myocyte fibrosis. Irreversible interactions of type I collagen become the main mitogens, stimulating myofibroblast proliferation and collagen synthesis through lectin-carbohydrate interactions. The extracellular matrix is ​​a complex, interconnected, three-dimensional network structure, mainly composed of collagen and fibronectin. Type I and type III collagen play important roles in maintaining the normal structure of the heart, conducting myocardial energy, and maintaining the coordination of myocardial contraction and relaxation. Type I collagen is a rigid, fibrous protein, while type III collagen is an elastic protein. Studies have shown that Galectin-3 is involved in the fibrosis process of the liver, blood vessels, kidneys, lungs, and heart.

[0102] 3. Regulates immune response

[0103] Galectin-3 primarily participates in non-specific immunity and is expressed in various immune cells, including dendritic cells, natural killer cells, activated T cells, and B cells. In activated primitive T cells, it promotes the growth of type 1 helper T cells, restricts the differentiation of type 2 helper T cells and regulatory T cells, and mediates the immune response. Galectin-3 is also used in disease diagnosis.

[0104] 1. Application of Galectin-3 in the diagnosis of cardiovascular diseases

[0105] 1.1 Galectin-3 and Heart Failure

[0106] Heart failure (HF) is the end-stage and leading cause of death from various cardiovascular diseases, and is a complex clinical syndrome. With the increasing aging population and modern treatments extending the survival of heart disease patients, the incidence of HF is gradually increasing. Galectin-3 is expressed before the onset of heart failure, making it very useful for predicting and preventing disease progression. In the United States, Galectin-3 has been approved as a prognostic indicator for heart failure patients and is already in clinical use. Studies have found that patients with acute heart failure and high Galectin-3 levels have a higher incidence of adverse cardiovascular events within 30 days. Furthermore, Galectin-3 levels may be positively correlated with mortality in heart failure patients, and its prognostic value is greater for patients with normal left ventricular ejection fraction (LVEF) than for those with decreased LVEF. Doubling Galectin-3 levels are significantly associated with hospitalization and mortality rates in heart failure patients. Studies have found that regardless of clinical symptoms, signs, and laboratory test results, a Galectin-3 level >25.9 ng / mL is a precursor to rapid progression of heart failure, hospitalization, and death.

[0107] Galectin-3 levels are strongly associated with myocardial fibrosis, and its concentration is directly proportional to the degree of fibrosis. Galectin-3 promotes myocardial fibrosis and participates in processes such as myocardial inflammatory changes and ventricular remodeling. Studies have found that Galectin-3 levels are associated with mortality in patients with acute and chronic heart failure, and can be used to assess the prognosis of patients with chronic heart failure and predict new-onset heart failure. Galectin-3 can serve as an indicator of heart failure progression and prognosis; the degree of elevation can indicate the extent of heart failure progression, allowing for early intervention to prevent disease deterioration and reduce long-term mortality.

[0108] 1.2 Galectin-3 and Coronary Artery Disease

[0109] Coronary artery disease (CHD), also known as coronary atherosclerotic heart disease, is a heart condition caused by atherosclerotic lesions in the coronary arteries, leading to narrowing or blockage of the blood vessels and resulting in myocardial ischemia, hypoxia, or necrosis. Studies have found that compared to healthy individuals, CHD patients have significantly higher plasma levels of Galectin-3, MMP-9, and MMP-3, which are correlated with the severity of the disease. The mechanisms by which Galectin-3 induces atherosclerosis include: ① participating in the oxidative transformation, proliferation, migration, and matrix secretion of vascular smooth muscle cells by oxidizing low-density lipoprotein, increasing the ability of vascular endothelial cells and macrophages to take up lipids, and accelerating the formation of atherosclerotic plaques; ② chemotaxis of monocytes, causing macrophage aggregation and accelerating the formation of foam cells; ③ stimulating the production of superoxide by neutrophils, enhancing oxidative stress. CHD patients with high Galectin-3 levels have a higher cardiovascular mortality rate. Galectin-3 is an independent risk factor for cardiovascular death and all-cause mortality in the general population. Serum MMP-9, MMP-3, and Galectin-3 testing in CHD patients can help assess their condition and provide timely treatment, which can improve prognosis and reduce the occurrence of major adverse cardiovascular events (MACE).

[0110] 1.3 Galectin-3 and Fibrosis

[0111] Atrial fibrillation (AF) is a common tachyarrhythmia, and studies have shown that its presence is significantly associated with increased cardiovascular disease morbidity and mortality. The exact mechanism of AF is not fully understood, but current consensus suggests that inflammation and fibrosis lead to atrial electrical and structural remodeling, resulting in AF. Galectin-3, a molecule involved in inflammation and fibrosis, has been shown to promote cardiac macrophage infiltration and stimulate myofibroblast proliferation, thereby inducing atrial fibrosis and playing a role in AF development. Elevated plasma Galectin-3 levels increase the risk of AF. Furthermore, Galectin-3 is also associated with AF recurrence. Galectin-3 plays a crucial role in the occurrence and progression of AF and is expected to become a biochemical biomarker for assessing AF condition.

[0112] 2. Application of Galectin-3 in tumor diagnosis

[0113] Galectin-3 participates in angiogenesis, increasing tumor cell aggregation and adhesion to vascular endothelial cells, thus promoting tumor metastasis. It is closely related to tumor occurrence and development and has a strong correlation with the development of various cancers, such as lung cancer, breast cancer, thyroid cancer, and pancreatic cancer. Many studies have shown that Galectin-3 can serve as an indicator for predicting cancer diagnosis and prognosis.

[0114] 2.1 Galectin-3 and Thyroid Cancer

[0115] Thyroid cancer is the most common tumor of the endocrine system. Galectin-3 is not expressed in normal thyroid tissue, and is expressed in small amounts in benign thyroid tumors, but its expression rate is high in malignant thyroid cancer. Galectin-3 is positively correlated with the malignancy of thyroid cancer. Papillary thyroid carcinoma (PTC) is one of the more common malignant tumors of the endocrine system, accounting for approximately 65% ​​of primary thyroid malignancies. Galectin-3 is expressed in papillary thyroid carcinoma (PTC) and is significantly associated with its development and progression. Galectin-3 can be used as an indicator for indeterminate cytological examinations in thyroid cancer and has been clinically validated and used in multiple countries and regions.

[0116] 2.2 Galectin-3 and Breast Cancer

[0117] Breast cancer is a phenomenon in which mammary epithelial cells proliferate uncontrollably under the influence of various carcinogenic factors. Studies have found that Galectin-3 uptake is extremely important in cell diffusion, and it can regulate the adhesion and spread of cancer cells during the progression of breast cancer; this regulatory role is very powerful. Inhibiting Galectin-3 expression in papillary thyroid carcinoma carcinoma lines reduced the proliferation rate of tumor cells. In a nude mouse breast cancer model, blocking Galectin-3 expression decreased tumor cell proliferation.

[0118] 2.3 Galectin-3 and Ovarian Cancer

[0119] Ovarian cancer is a malignant tumor of the ovary, which refers to a malignant tumor that grows on the ovary. 90% to 95% of these are primary ovarian cancers, and the remaining 5% to 10% are cancers that have metastasized to the ovary from primary cancers in other parts of the body. Because early ovarian cancer lacks symptoms, and even if there are symptoms, they are not specific, and the role of screening is limited, early diagnosis is difficult. 60% to 70% of cases are already in the late stage when they are diagnosed, and the treatment of late-stage cases is not good. Galectin-3 is highly expressed in ovarian cancer and is associated with progression-free survival (PFS) of patients [3]. Compared with normal ovarian tissue, Galectin-3 is highly expressed in epithelial ovarian cancer tissue and is associated with clinical stage. The later the stage, the higher the expression level of Galectin-3. There is also a difference in Galectin-3 expression between early (stage I-II) and late (stage III-IV) patients. It is speculated that Galectin-3 may be involved in the occurrence and development of ovarian cancer and may be used as an indicator to judge the degree of benignity or malignancy of ovarian epithelial tumors in clinical practice. It may help predict the occurrence, development, treatment effect and prognosis of ovarian tumors.

[0120] 2.4 Galectin-3 and Gastric Cancer

[0121] Gastric cancer is the most common malignant tumor of the digestive tract. The average expression level of Galectin-3 mRNA in gastric cancer, peritoneal metastasis and lymph node metastasis is significantly higher than that in non-cancerous mucosa. In malignant gastric cancer, the expression of Galectin-3 is positively correlated with its differentiation degree and tumor metastasis.

[0122] 2.5 Galectin-3 and other cancers

[0123] In esophageal cancer, overexpression of Galectin-3 significantly enhances the proliferation and invasion of cancer cells, and markedly inhibits apoptosis. Galectin-3 is widely expressed in non-small cell lung cancer (NSCLC) tissues and is correlated with stage. High expression of Galectin-3 is significantly associated with the occurrence, development, invasion, and poor differentiation progression of colon adenocarcinoma. Galectin-3 expression is also closely related to endometrial diseases such as endometriosis and endometrial cancer.

[0124] 3. Galectin-3 and rheumatic immune diseases

[0125] Rheumatoid arthritis (RA) is an autoimmune disease characterized by immune dysfunction and dysregulation of various cytokines, leading to inflammation that invades cartilage and causes bone damage. Galectin-3 is closely associated with RA. Studies have shown that in addition to chronic infiltration of inflammatory cells, fibroblasts also play an important role in RA. Excessive accumulation of fibroblasts in the synovial tissue can damage joint structure. Research indicates that Galectin-3 significantly induces CCL2, CCL3, CCL5, and TNF-α in the synovial tissue, demonstrating that Galectin-3 can promote the secretion of pro-inflammatory cytokines by fibroblasts and has an inducing and stimulating effect in the pathogenesis of RA.

[0126] 4. Galectin-3 and Kidney Disease

[0127] Chronic kidney disease (CKD) has become a global public health problem with high morbidity and mortality rates. One of the characteristics of CKD is chronic renal fibrosis. The end result is the excessive deposition of large amounts of extracellular matrix, including sugars and proteins or proteoglycans. Macrophages are the main regulators of renal fibrosis. They can stimulate the production of activating factors, activating a large number of extracellular matrix-secreting fibroblasts. Some fibroblasts can secrete cytokines, further inducing the formation and deposition of extracellular matrix in the kidneys. Galectin-3 plays a role in fibrosis related to macrophages. Macrophages are divided into M1 and M2 types. M1 type is a major component of inflammation and immune damage; M2 type plays an important role in promoting angiogenesis, cell proliferation, and extracellular matrix remodeling. Galectin-3 can chemotactically attract monocyte-macrophage infiltration, selectively activate M2 type macrophages, and then secrete a variety of cytokines, producing a large number of fibroblasts and causing fibrosis. In summary, Galectin-3 is closely related to renal fibrosis. For CKD, some studies have also demonstrated that Galectin-3 can reduce renal tubular cell apoptosis and kidney damage, thereby delaying the progression of CKD. Galectin-3 may play an important role in the early stages and development of CKD.

[0128] 5. Galectin-3 and respiratory diseases

[0129] Numerous studies have shown a close association between Galectin-3 and respiratory diseases, particularly bronchial asthma. Bronchial asthma is a chronic inflammatory disease of the airways involving multiple cells and cellular components (including mast cells, eosinophils, and T lymphocytes), typically characterized by reversible airflow limitation. Galectin-3 plays a crucial role in eosinophil recruitment and airway hyperresponsiveness in vivo. As a cell surface adhesion molecule, Galectin-3 facilitates the rolling and adhesion of eosinophils to endothelial cells, promoting eosinophil aggregation and transport, thereby releasing inflammatory factors and inducing asthma attacks. Zuberi et al. induced asthma attacks in mice using ovalbumin and found that Galectin-3 gene-deficient mice showed lower eosinophil expression levels than wild-type mice without the gene knockout. Furthermore, Galectin-3 may control asthma attacks by regulating Th1 and Th2 cells. López et al. treated an asthma rat model using the Galectin-3 gene method, resulting in reduced eosinophil counts and decreased airway hyperresponsiveness. This provides a new approach for the clinical treatment of refractory asthma.

[0130] Chronic obstructive pulmonary disease (COPD) is a common, preventable, and treatable disease characterized by persistent airflow limitation. This airflow limitation progressively develops and is associated with an enhanced chronic inflammatory response of the airways and lungs to toxic particles or gases. Studies have found significantly elevated serum Galectin-3 levels in COPD patients compared to healthy individuals. In severe COPD patients, elevated serum and lung tissue Galectin-3 levels are associated with increased endothelial damage and worsening airway obstruction. In addition to inflammation of the lungs themselves, COPD patients typically exhibit a systemic inflammatory state. Acute exacerbations of COPD increase the disease's mortality rate; serum Galectin-3 levels are significantly higher during acute exacerbations than during remission, making Galectin-3 a valuable indicator for predicting acute COPD exacerbations.

[0131] Primary Sjögren's syndrome (PPS) is primarily characterized by suppressed T-cell function, leading to massive antibody production by B cells and inducing tissue damage, with the lungs being the most commonly affected, resulting in pulmonary interstitial fibrosis. Galectin-3 can regulate fibroblast activation and is associated with PPS and the resulting pulmonary interstitial fibrosis. The expression level of Galectin-3 in PPS patients is significantly higher than that in normal controls, and the expression level is even more prominent in those with concurrent pulmonary interstitial fibrosis. It is speculated that Galectin-3 may be involved in the immune-inflammatory damage and the development of pulmonary interstitial fibrosis in PPS.

[0132] 6. Galectin-3 and Digestive System Diseases

[0133] Ulcerative colitis (UC) is a chronic, nonspecific inflammatory disease primarily affecting the colonic mucosa, and apoptosis plays a crucial role in its pathogenesis. Bcl-2 is a gene that inhibits apoptosis. Galectin-3 is structurally similar to the Bcl-2 gene, containing four amino acid sequences identical to those in Bcl-2, and these sequences are precisely the key amino acid sequences for inhibiting apoptosis. It is hypothesized that activation of Galectin-3 can also inhibit apoptosis. Normal colonic mucosal epithelial cells strongly express Galectin-3, but its expression is significantly reduced in UC patients, and this expression is negatively correlated with the severity of UC lesions. Bcl-2 is also expressed in normal colonic mucosal epithelium, but unlike Galectin-3, the Bcl-2 gene expression is increased in UC patients, presumably due to reactive proliferation in response to cell damage, an increase in inflammatory cells, and a slowed apoptosis. However, both suggest that Galectin-3 may play an important role in UC patients.

[0134] Liver cirrhosis is diffuse liver damage caused by long-term or repeated exposure to one or more etiologies. Galectin-3 is involved in many physiological and pathological processes in the body, including cell growth, cell adhesion, inflammatory responses, immune regulation, tumor transformation and metastasis, and apoptosis. As mentioned earlier, Galectin-3 can participate in the formation of fibrosis in organs such as the kidneys, lungs, and liver. Experiments have also confirmed that Galectin-3 can promote the proliferation of hepatic stellate cells through the MEK1 / 2-ERK1 / 2 signaling pathway, thereby promoting the formation of liver cirrhosis. Compared to wild-type Galectin-3 gene knockout mice, although the same risk factors exist in Galectin-3 gene knockout mice, the liver damage in wild-type mice is much more severe.

[0135] 7. Galectin-3 and infectious diseases

[0136] Sepsis is a disease caused by uncontrolled inflammatory response, essentially a systemic inflammatory response syndrome. Galectin-3 plays an important role in many aspects of the inflammatory response, participating in macrophage-mediated bacterial phagocytosis and phagosome maturation, promoting bacterial internalization by activating actin polymerization, and influencing phagolysosome fusion and bacterial killing by regulating the expression of vesicle transport regulatory proteins and lysosomal enzymes. Research is currently underway to explore the role and mechanism of Galectin-3 in the interaction between macrophages and pathogenic microorganisms, providing new theoretical basis for further improving sepsis treatment.

[0137] In summary, Galectin-3 is widely expressed in human tissues, including various types of immune cells, epithelial cells, endothelial cells, and sensory neurons, and is distributed in the cytoplasm, nucleus, cell surface, and body fluids. Galectin-3 plays an important role in a series of physiological and pathological processes, including apoptosis, adhesion, proliferation, migration, inflammatory response, immune response, and fibrosis. In cardiovascular diseases, Galectin-3 has been shown to serve as an indicator of heart failure progression and prognosis. In cancer diagnosis and treatment, Galectin-3 has also been shown to potentially serve as a clinical indicator of tumor malignancy, helping to predict tumor occurrence, development, treatment effectiveness, and prognosis. Furthermore, Galectin-3 is also associated with rheumatoid arthritis, kidney and lung fibrosis, and inflammatory responses.

[0138] Antibody and its antigen-binding fragment

[0139] This invention provides an antibody and its antigen-binding fragment that bind to human Galectin-3 protein. The binding sites of the provided antibody and its antigen-binding fragment are within the range of amino acids 1-62 of the N-terminus of human Galectin-3 protein. The provided antibody and its antigen-binding fragment do not compete with galactose, lactose, laminin, other glycoproteins, or ligands for binding to human Galectin-3 protein; that is, the binding of the provided antibody and its antigen-binding fragment to human Galectin-3 protein is not affected by whether galactose, lactose, laminin, other glycoproteins, or ligands bind to human Galectin-3 protein.

[0140] The N-terminal fragment of the human Galectin-3 protein described in this article, after enzymatic degradation, contains a 62-amino acid sequence from amino acids 1 to 62, as follows: MADNFSLHDA LSGSGNPNPQ GWPGAWGNQP AGAGGYPGAS YPGAYPGQAP PGAYPGQAPPGA. (SEQ ID NO.1)

[0141] This invention also provides an antibody and its antigen-binding fragment that bind to human Galectin-3 protein. The provided antibody and its antigen-binding fragment bind to different epitopes of the Galectin-3 protein fragment containing the complete CRD after enzymatic degradation of the human Galectin-3 protein. The provided antibody and its antigen-binding fragment bind to the human Galectin-3 protein fragment or different epitopes of the human Galectin-3 protein. The provided antibody and its antigen-binding fragment do not compete with galactose, lactose, laminin, other glycoproteins, or ligands for binding to the human Galectin-3 protein fragment or human Galectin-3 protein; that is, the binding of the provided antibody and its antigen-binding fragment to the human Galectin-3 protein fragment or human Galectin-3 protein is unaffected by whether galactose, lactose, laminin, other glycoproteins, or ligands bind to the human Galectin-3 protein fragment or human Galectin-3 protein.

[0142] In this article, competitive binding refers to the binding of one antibody or antibody fragment to an antigen reducing the binding of a second antibody or antibody fragment to the same antigen. Alternatively, the binding of one antibody or antibody fragment to an antigen may reduce the binding of galactose, lactose, laminin, other glycoproteins, or ligands to the same antigen.

[0143] The Galectin-3 protein fragment containing the complete CRD, which was degraded by the enzyme in this article, contains the 188-amino acid sequence of human Galectin-3 from amino acids 63 to 250, as follows: YPGAPGAY PGAPAPGVYP GPPSGPGAYP SSGQPSATGAYPATGPYGAP AGPLIVPYNL PLPGGVVPRM LITILGTVKP NANRIALDFQ RGNDVAFHFN PRFNENNRRVIVCNTKLDNN WGREERQSVF PFESGKPFKIQVLVEPDHFK VAVNDAHLLQ YNHRVKKLNEISKLGISGDIDLTSASYTMI. (SEQ ID NO.2)

[0144] In some implementations, the antibody is a monoclonal antibody, and the antigen-binding fragment is derived from the monoclonal antibody. The monoclonal antibody can be prepared using techniques widely used in the art (including hybridoma, recombinant antibody, phage display, single B cell technology, or combinations thereof).

[0145] Anti-human Galectin-3 monoclonal antibodies can be prepared using any known technique, including hybridoma technology. In hybridoma technology, mice, rats, hamsters, chickens, rabbits, or other suitable laboratory animals are immunized with an immunogen to stimulate lymphocytes that express antibodies that specifically bind to the immunogen.

[0146] Immunizing agents typically consist of an adjuvant and an antigen. The adjuvant is usually Freund's adjuvant or other suitable adjuvants. The antigen used in this invention is the full-length recombinant human Galectin-3 protein, or a recombinant protein of amino acids 1-62 of the N-terminal protein of human Galectin-3, or any part of a polypeptide of amino acids 1-62 of the N-terminal protein of human Galectin-3, or a recombinant protein of amino acids 63-250 of human Galectin-3, or any part of a polypeptide of amino acids 63-250 of human Galectin-3. The polypeptide needs to be coupled to a carrier protein, which can be KLH (Keyhole Limpet Hemocyanin), BSA (Bovine Serum Albumin), or OVA (Ovalbumin). Animals can be immunized using various methods, with or without adjuvant. The immunizing agent can be administered once or multiple times, and the immunization site can be subcutaneous, intramuscular, intraperitoneal, or intravenous injection.

[0147] Hybridomas are obtained by fusing lymphocytes with immortalized cell lines using fusion agents such as polyethylene glycol or electrofusion apparatus. Immortalized cell lines are typically mouse or rat myeloma cell lines. If SP2 / 0 cells, which lack hypoxanthine-guanine-phosphoribotransferase and cannot synthesize DNA via the salvage pathway, are used, selection culture is performed using HAT medium; only fused hybridoma cells survive and proliferate. Hybridoma cells are then screened using enzyme-linked immunosorbent assay (ELISA) with screening antigens.

[0148] In some implementations, the screening antigen is one of the following: full-length Galectin-3 protein, or a recombinant protein of amino acids 1-62 of the N-terminal protein of human Galectin-3, or any portion of a polypeptide of amino acids 1-62 of the N-terminal protein of human Galectin-3, or a recombinant protein of amino acids 63-250 of human Galectin-3, or any portion of a polypeptide of amino acids 63-250 of human Galectin-3, lactose, laminin, etc., or several of these. The screening method is indirect ELISA, double-antibody sandwich ELISA, or competitive ELISA, etc.

[0149] In some embodiments, the antibodies or fragments described herein comprise the heavy and / or light chains (or fragments thereof) of antibodies produced by hybridomas of the present invention. In some embodiments, the antibodies or fragments described herein comprise variable regions (or fragments thereof) of the heavy and / or light chains of antibodies produced by hybridomas of the present invention. As is known in the art, the specificity of an antibody to a given antigen is mediated by the variable regions of the heavy and light chains. Specifically, the specificity of an antibody to a given antigen is primarily determined by short sequences within the variable regions of the heavy and light chains, referred to as complementarity-determining regions or CDRs. In some embodiments, the antibodies or fragments described herein contain one or more (e.g., one, two, three, four, five, or six) CDRs of the heavy and / or light chains of antibodies produced by hybridomas of the present invention. In some embodiments, the antibodies or fragments described herein comprise each CDR of the heavy chain of antibodies produced by hybridomas of the present invention. In some embodiments, the antibodies or fragments described herein comprise each CDR of the light chain of antibodies produced by hybridomas of the present invention. In some embodiments, the antibodies or fragments described herein comprise each CDR of antibodies produced by hybridomas of the present invention (all heavy and light chain CDRs).

[0150] The "variable region" or "variable domain" of an antibody refers to the amino-terminal domain of either the heavy or light chain. The variable domain of the heavy chain can be called "VH," and the variable domain of the light chain can be called "VL." These domains are typically the most variable parts of the antibody and contain antigen-binding sites. The variable region (VL or VH) of the light or heavy chain consists of a framework region broken by three hypervariable regions called "complementarity-determining regions" or "CDRs." The framework region of the antibody, that is, the framework region of the combination of the light and heavy chains, plays a role in positioning and aligning the CDRs, which are primarily responsible for binding to the antigen.

[0151] When used in this document, the terms "backbone," "framework," or "FR" refer to regions outside those defined as CDRs of the antibody variable domain. Each antibody variable domain framework can be further subdivided into adjacent regions separated by CDRs (FR1, FR2, FR3, and FR4). Typically, the variable regions VL / VH of the heavy and light chains are obtained by linking the following numbered CDRs with FRs in the following combination: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4.

[0152] In some embodiments, the antibodies or fragments described herein are chimeric because they contain at least one human constant region. For example, the constant region of an antibody generated from a hybridoma of the present invention may be replaced with a human constant region. Compared to non-chimeric antibodies, chimeric antibodies generally have lower immunogenicity in humans, and therefore may offer therapeutic advantages in certain situations. In some embodiments, the chimeric antibodies described herein contain an IgG1 constant region. Various human constant regions are known to those skilled in the art. Methods for preparing chimeric antibodies are known in the art.

[0153] In some embodiments, the antibodies or fragments described herein are humanized because they contain at least one human frame region. For example, one or more (e.g., one, two, three, four, five, or six) frame regions of antibodies produced by hybridomas of the present invention may be replaced with one or more (e.g., one, two, three, four, five, or six) human frame regions. Compared to non-humanized antibodies, humanized antibodies generally have lower immunogenicity to humans, and therefore may offer therapeutic advantages in certain situations. Various human frame regions are known to those skilled in the art. Methods for preparing humanized antibodies are known in the art.

[0154] In some embodiments, the antigen-binding fragment is derived from an intact antibody molecule, such as a monoclonal antibody. The antibody may have an F(ab')2 fragment generated at the carboxyl terminus of its hinge region, or a Fab fragment generated at the amino terminus of its hinge region. In some embodiments, the antigen-binding fragment is a Fab fragment, an F(ab')2 fragment, an scFv fragment, a linear antibody, a multispecific antibody fragment such as a bispecific, trispecific, or multispecific antibody (e.g., a disodium, trisodium, or tetrasodium), a microantibody, a chelated recombinant antibody, an intracellular antibody, a nanobody, a small modular immunopharmaceutical (SMIP), a binding domain immunoglobulin fusion protein, a camelified antibody, or an antibody containing VHH. Preparation methods are known in the art.

[0155] In some embodiments, the antibody or antigen-binding antibody fragment described herein, compared to the heavy and / or light chains of the hybridoma-generated antibodies of the present invention, contains one or more substituted, deleted, or inserted amino acids. Substitution, deletion, or insertion can be introduced into the nucleic acid molecule encoding the heavy and / or light chains of the hybridoma-generated antibodies of the present invention using conventional techniques such as site-directed mutagenesis or PCR-mediated mutagenesis. In some embodiments, conserved amino acid substitutions are performed at one or more sites. "Conserved amino acid substitution" is a case where one amino acid residue is replaced by an amino acid residue having a similar side chain. The families of amino acids with similar side chains are defined in the prior art, including basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), β-side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).

[0156] Monoclonal antibodies can also be produced using recombinant DNA methods known in the field, and monoclonal antibodies can also be produced using phage display libraries known in the field.

[0157] Methods of using antibodies and their antigen-binding fragments

[0158] Methods for determining Galectin-3 protein levels in human body fluid samples

[0159] This invention provides a method for determining the level of Galectin-3 protein in human body fluid samples. The method involves using a sandwich method to detect the content of full-length Galectin-3 protein in the sample, or using a sandwich method to detect the content of total Galectin-3 protein in the sample. In some embodiments, the body fluid sample may be blood, serum, plasma, urine, cerebrospinal fluid, ascites, bile, gastric juice, saliva, sweat, tissue exudate, tissue cell lysate, etc.

[0160] In some embodiments, the sandwich method for detecting the full-length Galectin-3 protein content in a sample uses at least two (e.g., two, three, or four) antibodies or antibody fragments described in this invention to determine the level of full-length human Galectin-3 protein in the sample. In some embodiments, the sandwich method for detecting the full-length Galectin-3 protein content in a sample uses an epitope antibody targeting amino acids 1-62 of the N-terminal protein of human Galectin-3 as a capture antibody and an epitope antibody targeting amino acids 63-250 of the human Galectin-3 protein as a detection antibody. In some embodiments, the sandwich method for detecting the full-length Galectin-3 protein content in a sample uses an epitope antibody targeting amino acids 63-250 of the human Galectin-3 protein as a capture antibody and an epitope antibody targeting amino acids 1-62 of the N-terminal protein of human Galectin-3 as a detection antibody.

[0161] In some embodiments, the sandwich method for detecting the total Galectin-3 protein content in a sample uses at least two (e.g., two, three, or four) antibodies or antibody fragments described in this invention to determine the level of total human Galectin-3 protein in the sample. In some embodiments, the sandwich method for detecting the total Galectin-3 protein content in a sample uses antibodies targeting different epitopes within the amino acid range of human Galectin-3 protein (amino acids 1-62) as both capture and detection antibodies. In some embodiments, the sandwich method for detecting the total Galectin-3 protein content in a sample uses antibodies targeting different epitopes within the amino acid range of human Galectin-3 protein (amino acids 63-250) as both capture and detection antibodies.

[0162] In some embodiments, the capture conjugate contacts the sample to be detected and binds to the Galectin-3 protein or a fragment thereof, and then contacts and binds to the detection antibody. In this embodiment, the capture conjugate and the detection antibody bind to different binding epitopes on the Galectin-3 protein or the Galectin-3 protein fragment, respectively, regardless of whether the Galectin-3 protein fragment or the Galectin-3 protein binds to galactose, lactose, laminin, other glycoproteins, or ligands.

[0163] This document describes a method for separating Galectin-3 protein or Galectin-3 protein fragments from a mixture of samples being tested. In some embodiments, the capture conjugate moiety may be a Galectin-3 monoclonal antibody, but is not limited to this; it may also be a Galectin-3 polyclonal antibody, a laminin, lactose, or other molecules that can bind to Galectin-3 protein or Galectin-3 protein fragments. The capture conjugate moiety may be covalently or non-covalently attached to microplates, membranes, magnetic particles, latex particles, test tubes, troughs, chips, or other reactors or supports.

[0164] This article describes antibody detection, which refers to antibodies and their antigen-binding fragments that can be labeled with detectable markers, including but not limited to various enzymes, prosthetic groups, fluorescent substances, luminescent substances, latex particles, gold particles, bioluminescent substances, and radioactive substances. In some embodiments, suitable enzymes include horseradish peroxidase, alkaline phosphatase, β-galactosidase, acetylcholinesterase, malate dehydrogenase, staphylococcal nuclease, δ-V-steroid isomerase, yeast alcohol dehydrogenase, α-glycerophosphate dehydrogenase, triose phosphate isomerase, asparaginase, glucose oxidase, ribonuclease, urease, glucose-6-phosphate dehydrogenase, and glucosyl amylase; in some embodiments, suitable prosthetic group complexes include streptavidin, biotinybin, and biotin; in some embodiments, Suitable fluorescent substances include umbelliferone, luciferin, luciferin isothiochloride, rhodamine, dichlorotriazine aminoluciferin, dansyl chloride, quantum dots or phycoerythrin, phycocyanin, allophycocyanin, phthalaldehyde, and fluorescein; in some embodiments, luminescent substances include luminol, AMPPD, etc.; in some embodiments, bioluminescent substances include luciferase, luciferin, and jellyfish luminescent protein; in some embodiments, suitable radioactive substances include 125I, 131I, 35S, 14C, or 3H.

[0165] In some implementations, the sandwich method employs enzyme-linked immunosorbent assay (ELISA), a technique that uses labeled antibodies (e.g., enzyme-linked) to detect and measure the concentration of antigens. In a sandwich ELISA, a capture material (such as an antibody) is attached to a solid phase (i.e., a microplate) and contacted with a biological sample containing the antigen. The solid phase is then washed to remove unbound antigens and other substances. A labeled antibody (e.g., an enzyme-linked antibody) is then attached to the antigen already bound to the capture antibody, forming a capture antibody-antigen-labeled antibody sandwich. The enzyme that can be attached to the antibody can be horseradish peroxidase, alkaline phosphatase, β-galactosidase, acetylcholinesterase, malate dehydrogenase, staphylococcal nuclease, δ-V-steroid isomerase, yeast alcohol dehydrogenase, α-glycerol phosphate dehydrogenase, triose phosphate isomerase, asparaginase, glucose oxidase, ribonuclease, urease, glucose-6-phosphate dehydrogenase, or glucosyl amylase. The enzyme-linked antibody reacts with the substrate to produce a measurable colorimetric product. The concentration of Galectin-3 in the sample can be estimated by comparing the measured value with the Galectin-3 standard curve.

[0166] In some implementations, the sandwich method employs immunochromatography. The principle of immunochromatography is to first immobilize specific antibodies onto a specific zone of a nitrocellulose membrane. When one end of the dried nitrocellulose membrane is immersed in a sample (urine or serum), capillary action causes the sample to move forward along the membrane. When it reaches the area immobilized with the antibody, the corresponding antigen in the sample specifically binds to the antibody. Immunogold staining or enzyme staining can make this area display a specific color, thus achieving specific immunodiagnosis. In some implementations, in addition to colloidal gold, immunochromatography can also use colored microspheres, fluorescent microspheres, time-resolved fluorescent microspheres, quantum dot fluorescent microspheres, aggregation-induced emission microspheres, upconversion emission microspheres, magnetic microparticles, surface-enhanced Raman scattering materials, and other nanoparticles. The functional groups or charges on the surface of the nanoparticles connect with the detection antibody through chemical bonds or physical adsorption, forming an antibody-nanoparticle complex (chemical bonding is mainly mediated by carbodiimide functional groups, and physical adsorption is mainly through charge interaction). Antibody nanoparticle complexes are sprayed onto glass fiber or polyester membranes and dried to prepare release pads; nitrocellulose membranes are coated with T-line (detection line) to capture antibodies and C-line (control line) to capture proteins; glass cellulose membranes are soaked in a treatment solution (e.g., 5% trehalose + 0.5% PVP-K30 + 0.5% BSA + 0.5% Tween20 + 0.05M / L Tris-HCl) to prepare sample pads; absorbent pads (cotton or plant fiber filter paper) are also prepared. After assembling the sample pads in the order of absorbent pad - NC membrane - release pad (some processes do not include this) - sample pad using a support (PVC board), the sample is cut into strips, mounted, and tested. The sample first contacts the antibody-nanoparticle complex. In the presence of Galectin-3, a Galectin-3-antibody-nanoparticle complex is formed. Under chromatographic forces, the complex passes through the NC membrane to the T-line, where it forms a capture antibody-Galectin-3-antibody-nanoparticle complex with the T-line capture antibody, thus immobilizing it on the NC membrane. The content of Galectin-3 protein can be calculated by interpreting the signal of nanoparticles using instruments. The content of Galectin-3 protein is directly proportional to the signal of nanoparticles.

[0167] In some implementations, the sandwich method employs a chemiluminescence immunoassay (CLIA). Some example kits include a magnetic separation reagent, a first reagent, a second reagent, and Galecin-3 protein calibrators. The magnetic separation reagent consists of magnetic beads / nanoparticles with surface-modified groups or charged components that link to antibodies via chemical bonds or physical adsorption, forming an antibody-nanoparticle complex (chemical bonding is primarily mediated by carbodiimide functional groups, while physical adsorption is mainly through charge interaction). The first reagent contains antibodies labeled with biotin, horseradish peroxidase, alkaline phosphatase, ruthenium terpyridine, or N-hydroxysuccinimide biotin ester. The second reagent contains streptavidin labeled with horseradish peroxidase, alkaline phosphatase, or ruthenium terpyridine. The sample reacts with the antibody-magnetic bead nanoparticle complex. In the presence of Galectin-3, a Galectin-3-antibody-magnetic bead nanoparticle complex is formed. The first reagent is added to react and form a labeled antibody-Galectin-3-antibody AAA-magnetic bead nanoparticle complex. The second reagent is added, and then a corresponding luminescent substrate such as luminol or AMPPD is added. The luminescence signal is read, and the content of Galectin-3 protein can be calculated. The content of Galectin-3 protein is directly proportional to the luminescence signal.

[0168] In some implementations, the sandwich method employs a microfluidic chip-based detection approach. Galectin3 antibody is coated onto the chip's reaction chamber as a stationary phase, and another Galectin3 antibody is coated onto fluorescent microspheres. These immunomicrospheres are pre-dried and immobilized within the microfluidic chip. When a sample is added to the microfluidic chip's sample inlet, the sample flows into the microchannels via a pump. The Galectin3 analyte in the sample reacts sequentially with the antibody coated on the fluorescent microspheres and the capture antibody on the chip. This method uses the microfluidic chip as a carrier, with the immunoassay reaction occurring within the microfluidic reactor inside the chip. A single chip is used for a single-person test, and the prepared reagent kit is used for detection. After manual sample addition, the instrument controls the liquid flow of the analyte within the microfluidic chip, regulates the immunoassay reaction, and performs a post-reaction cleaning step. The instrument collects fluorescence signals and calculates the specific reaction value.

[0169] In some implementations, the sandwich method employs a single-molecule immunoassay array (Simoa). This implementation utilizes the principle of the double-antibody sandwich method in enzyme-linked immunosorbent assay (ELISA) and combines it with Simoa (Single Molecular Array) single-molecule immunoassay array analysis technology. This allows for the capture of single molecules in microwells the size of a flyby, enabling the digital reading of individual magnetic bead signals and converting the digital signals into the concentration of the analyte molecule, significantly improving detection sensitivity. The implementation includes magnetic beads coated with capture antibodies, a Galectin-3 detection antibody conjugated with a first label, a β-galactosidase conjugated with a second label, an enzyme-reaction luminescent substrate, and a Galectin-3 standard. The capture antibody in the magnetic beads specifically binds to the Galectin-3 antigen, the first label in the Galectin-3 detection antibody conjugated with the first label is linked to the second label in the β-galactosidase conjugated with the second label, and the Galectin-3 detection antibody specifically binds to the Galectin-3 antigen. The first marker in the CCL1 detection antibody conjugated with the first marker is biotin or a biotin derivative, including biotin-tetraethylene glycol-N-hydroxysuccinimide ester. The second marker for the β-galactosidase conjugated with the second marker is streptavidin. In some embodiments, the method for preparing the capture antibody-coated magnetic beads includes: liquid displacement treatment of the capture antibody with magnetic bead conjugation buffer, activation of the magnetic beads, conjugation of the displaced capture antibody with the activated magnetic beads, washing the conjugation product with washing solution, blocking with blocking buffer, and washing again with washing solution to obtain the capture antibody-coated magnetic beads. In some embodiments, the activation conditions in the magnetic bead activation step are: activation temperature 2-8℃, activation time 20-40 min. In some embodiments, the activation reagent in the magnetic bead activation step includes EDC solution with a concentration of 0.1-0.5 mg / mL. In some embodiments, the conjugation conditions in the conjugation step are: conjugation temperature 2-8℃, conjugation time 1.5-2.5 h. In some implementations, the concentration of activated magnetic beads in the coupling step is 1.3 × 10⁻⁶. 9 -1.5×10 9 The concentration of the capture antibody after replacement is 0.1-0.3 mg / mL. In some embodiments, the preparation method of the biotinylated detection antibody includes: liquid replacement treatment of the detection antibody with biotinylation reaction buffer, then linking the replacement detection antibody with biotin, and purifying the resulting product to obtain the biotinylated detection antibody. The molar ratio of detection antibody to biotin is 1:30-1:50. In some embodiments, the detection method further includes streptavidin-β-galactosidase solution and fluorescent substrate solution, wherein the fluorescent substrate includes halogen-β-D-galactoside.

[0170] Methods for determining Galectin-3 levels in human tissue samples

[0171] This invention provides a method for determining the total Galectin-3 protein level in human tissue or cell samples. In some embodiments, the sample may be normal human tissue or cells, diseased tissue or cells, tumor tissue or cells, diseased and adjacent tissue or cells, or organ tissues or cells from cardiovascular diseases, various cancers, rheumatoid arthritis, fibrosis, etc. The method employs known detection methods in the fields of immunohistochemistry or Western blotting to detect the level and distribution of Galectin-3 in the sample.

[0172] application

[0173] This invention provides methods for determining the levels of full-length human Galectin-3 protein and total human Galectin-3 protein, enabling more accurate determination of the content of full-length or total Galectin-3 protein in a sample. By using the antibodies disclosed herein, combined with immunoassays known in the art, such as ELISA, immunochromatography, and chemiluminescence, the content of full-length or total Galectin-3 protein (including full-length human Galectin-3 protein and Galectin-3 protein fragments cleaved by proteases) in a sample can be reliably and reproducibly detected. The combined use of the methods for determining the levels of full-length and total human Galectin-3 protein provides by this invention allows for accurate determination of the levels of full-length human Galectin-3 protein and the levels of Galectin-3 protein fragments with CRD structures generated after enzymatic degradation in an analytical sample. The method described in this invention provides a powerful tool for studying the relationship between the full-length Galectin-3 protein, the Galectin-3 protein fragment with CRD structure generated after enzymatic degradation, and MMPs. It also provides a powerful tool for studying the association between the full-length Galectin-3 protein, the Galectin-3 protein fragment with CRD structure generated after enzymatic degradation, and diseases such as heart failure, cancer, and inflammation. Furthermore, it provides a powerful tool for studying the biological functions of Galectin-3 and its mechanism of action in related diseases.

[0174] The method for determining the full-length or total Galectin-3 protein level in human bodily fluid samples provided by this invention can be used to detect subjects at risk of developing heart disease (HF) or to identify subjects with HF. The method can monitor changes in Galectin-3 levels in patients or other subjects identified as having a risk of developing HF. Subjects at risk of HF can have their Galectin-3 levels monitored over a period of time, such as weekly, monthly, quarterly, twice a year, once a year, or once every two years. Galectin-3 levels can serve as a diagnostic marker to determine the presence, stage, or severity of HF in a subject, or to predict prognosis by comparing Galectin-3 level data in subject samples over a period of time, in conjunction with data correlated with the severity or stage of HF. The method described in this invention can be combined with other methods commonly used in the art for diagnosis and / or prognosis prediction (e.g., echocardiography using Doppler analysis, radionuclide ventricular imaging, magnetic resonance imaging (MRI), complete blood cell count, urine analysis, serum electrolytes, glycohemoglobin and blood lipids, kidney and liver function tests, thyroid function tests, chest X-ray, 12-lead electrocardiography, blood tests for biomarkers such as BNP, etc.).

[0175] The method for determining the full-length or total Galectin-3 protein level in human body fluid samples provided by this invention can also be combined with other indicators to detect the occurrence, progression, and prognosis of cardiovascular diseases such as coronary heart disease and fibrillation.

[0176] The method for determining the full-length or total Galectin-3 protein level in human body fluid samples provided by this invention can also be used for cancer monitoring. Galectin-3 participates in angiogenesis, increases tumor cell aggregation and adhesion to vascular endothelial cells to promote tumor metastasis, and is closely related to tumor occurrence and development. It is highly correlated with the occurrence and development of various tumors, such as, but not limited to, lung cancer, thyroid cancer, breast cancer, ovarian cancer, endometrial cancer, pancreatic cancer, gastric cancer, esophageal cancer, and colon cancer. Many studies have shown that Galectin-3 can serve as an indicator for predicting the diagnosis and prognosis of cancer, especially thyroid cancer. Galectin-3 is not expressed in normal thyroid tissue, is expressed in small amounts in benign thyroid tumors, but has a high expression rate in malignant thyroid cancer, and is positively correlated with the malignancy of thyroid cancer. Galectin-3 can be used as an indicator for indeterminate cytological examination of thyroid cancer and has been clinically validated and used in many countries and regions.

[0177] The method for determining the total Galectin-3 protein level in human tissue or cell samples provided by this invention can be used to study the localization, qualitative analysis, and relative quantification of Galectin-3 levels in various human cells, normal tissues, diseased tissues, tumors, lesions, and adjacent tissues. It can also detect the content and intracellular / extracellular localization of Galectin-3. The method described in this invention can be used for the diagnosis and differential diagnosis of malignant tumors, determining the primary site of metastatic malignant tumors, further pathological classification of certain types of tumors, diagnosis of soft tissue tumors, and providing clinical options for treatment.

[0178] Other applications: The method for determining the total Galectin-3 protein level in human body fluid samples or the method for determining the total Galectin-3 protein level in human tissue or cell samples provided by this invention can also be used for the detection, diagnosis, or mechanism research of diseases related to the function of Galectin-3 in promoting tissue fibroblasts and the secretion of pro-inflammatory cytokines, such as rheumatoid arthritis, chronic kidney disease, bronchial asthma, chronic obstructive pulmonary disease, primary Sjögren's syndrome, ulcerative colitis, cirrhosis, fibrosis of organs such as the kidneys, lungs, and liver, and sepsis.

[0179] Reagent test kit

[0180] This invention provides a kit for determining the full-length human Galectin-3 protein level, and also provides a kit for determining the total human Galectin-3 protein level. The kit can be used to predict the risk level of HF, diagnose HF, determine the severity of HF, or predict the prognosis of HF patients. It can also be used to predict or diagnose thyroid cancer or other related cancers, and to predict or assist in the diagnosis of other diseases related to Galectin-3 levels. The kit can also be used in research related to Galectin-3 levels. The kit includes one or more antibodies or antigen-binding fragments thereof for quantitatively detecting Galectin-3 levels in a sample. The antibodies or antigen-binding fragments thereof are specific to Galectin-3 protein fragments or Galectin-3 protein. The capture-binding moiety provided in the kit is pre-attached to a solid surface, such as, but not limited to, plastic or glass containers, microspheres, or membranes. The kit may also include a container for mixing the sample with the binding moiety. Such containers are suitable for use with detection instruments capable of detecting the signal generated by the detection binding moiety. The kit may also include one or more reagents (e.g., different antibodies) for measuring the level of a second biomarker indicating the same disease.

[0181] The kit of the present invention may additionally include one or more of the following: (1) instructions for using the kit to determine human Galectin-3 protein levels; (2) a solid phase (e.g., an ELISA plate or reagent strip) on which any such antibody is fixed; and (3) a regulatory-approved label or insert indicating diagnostic, prognostic or therapeutic use or any combination thereof.

[0182] Most current antibodies, methods, and kits for detecting Galectin-3 protein do not clearly specify the range of Galectin-3 protein sites targeted. Some methods or kits even use polyclonal antibodies, making it impossible to determine whether the result indicates the full-length or total Galectin-3 protein content. Using polyclonal antibodies can sometimes result in a higher-than-expected Galectin-3 protein content. Currently, apart from this invention, no other antibody, method, or kit has eliminated the influence of galactose, lactose, laminin, glycoproteins, ligands, etc., in the sample on the detected Galectin-3 protein content. Detection results that do not exclude the influence of galactose, lactose, laminin, glycoproteins, ligands, etc., in the sample are therefore somewhat controversial.

[0183] This invention provides methods for determining the levels of full-length human Galectin-3 protein and total human Galectin-3 protein, enabling more accurate determination of the content of full-length or total Galectin-3 protein in a sample. By using the antibodies disclosed herein, combined with immunoassays known in the art, such as ELISA, immunochromatography, and chemiluminescence, the content of full-length or total Galectin-3 protein (including full-length human Galectin-3 protein and Galectin-3 protein fragments cleaved by proteases) in a sample can be reliably and reproducibly detected. The combined use of the methods for determining the levels of full-length and total human Galectin-3 protein provides by this invention allows for accurate determination of the levels of full-length human Galectin-3 protein and the levels of Galectin-3 protein fragments with CRD structures generated after enzymatic degradation in an analytical sample. The method described in this invention provides a powerful tool for studying the relationship between the full-length Galectin-3 protein, the Galectin-3 protein fragment with CRD structure generated after enzymatic degradation, and MMPs. It also provides a powerful tool for studying the association between the full-length Galectin-3 protein, the Galectin-3 protein fragment with CRD structure generated after enzymatic degradation, and diseases such as heart failure, cancer, and inflammation. Furthermore, it provides a powerful tool for studying the biological functions of Galectin-3 and its mechanism of action in related diseases.

[0184] The method for determining the full-length or total Galectin-3 protein level in human bodily fluid samples provided by this invention can be used to detect subjects at risk of developing heart disease (HF) or to identify subjects with HF. The method can monitor changes in Galectin-3 levels in patients or other subjects identified as having a risk of developing HF. Subjects at risk of HF can have their Galectin-3 levels monitored over a period of time, such as weekly, monthly, quarterly, twice a year, once a year, or once every two years. Galectin-3 levels can serve as a diagnostic marker to determine the presence, stage, or severity of HF in a subject, or to predict prognosis by comparing Galectin-3 level data in subject samples over a period of time, in conjunction with data correlated with the severity or stage of HF. The method described in this invention can be combined with other methods commonly used in the art for diagnosis and / or prognosis prediction (e.g., echocardiography using Doppler analysis, radionuclide ventricular imaging, magnetic resonance imaging (MRI), complete blood cell count, urine analysis, serum electrolytes, glycohemoglobin and blood lipids, kidney and liver function tests, thyroid function tests, chest X-ray, 12-lead electrocardiography, blood tests for biomarkers such as BNP, etc.).

[0185] The method for determining the full-length or total Galectin-3 protein level in human body fluid samples provided by this invention can also be combined with other indicators to detect the occurrence, progression, and prognosis of cardiovascular diseases such as coronary heart disease and fibrillation.

[0186] The method for determining the full-length or total Galectin-3 protein level in human body fluid samples provided by this invention can also be used for cancer monitoring. Galectin-3 participates in angiogenesis, increases tumor cell aggregation and adhesion to vascular endothelial cells to promote tumor metastasis, and is closely related to tumor occurrence and development. It is highly correlated with the occurrence and development of various tumors, such as, but not limited to, lung cancer, thyroid cancer, breast cancer, ovarian cancer, endometrial cancer, pancreatic cancer, gastric cancer, esophageal cancer, and colon cancer. Many studies have shown that Galectin-3 can serve as an indicator for predicting the diagnosis and prognosis of cancer, especially thyroid cancer. Galectin-3 is not expressed in normal thyroid tissue, is expressed in small amounts in benign thyroid tumors, but has a high expression rate in malignant thyroid cancer, and is positively correlated with the malignancy of thyroid cancer. Galectin-3 can be used as an indicator for indeterminate cytological examination of thyroid cancer and has been clinically validated and used in many countries and regions.

[0187] The method for determining the total Galectin-3 protein level in human tissue or cell samples provided by this invention can be used to study the localization, qualitative analysis, and relative quantification of Galectin-3 levels in various human cells, normal tissues, diseased tissues, tumors, lesions, and adjacent tissues. It can also detect the content and intracellular / extracellular localization of Galectin-3. The method described in this invention can be used for the diagnosis and differential diagnosis of malignant tumors, determining the primary site of metastatic malignant tumors, further pathological classification of certain types of tumors, diagnosis of soft tissue tumors, and providing clinical options for treatment.

[0188] Other applications: The method for determining the total Galectin-3 protein level in human body fluid samples or the method for determining the total Galectin-3 protein level in human tissue or cell samples provided by this invention can also be used for the detection, diagnosis, or mechanism research of diseases related to the function of Galectin-3 in promoting tissue fibroblasts and the secretion of pro-inflammatory cytokines, such as rheumatoid arthritis, chronic kidney disease, bronchial asthma, chronic obstructive pulmonary disease, primary Sjögren's syndrome, ulcerative colitis, cirrhosis, fibrosis of organs such as the kidneys, lungs, and liver, and sepsis.

[0189] In a first aspect, this application provides an antibody or its antigen-binding portion thereof, the antibody being capable of binding human Galectin-3, and the binding epitope being located in the N-terminal amino acid sequence region of human Galectin-3 as shown in SEQ ID NO:1.

[0190] In some embodiments, the antibody comprises HCDR1 shown in SEQ ID NO:3, HCDR2 shown in SEQ ID NO:4, HCDR3 shown in SEQ ID NO:5, LCDR1 shown in SEQ ID NO:6, LCDR2 shown in SEQ ID NO:7, and LCDR3 shown in SEQ ID NO:8, wherein the antibody heavy chain variable region sequence is shown in SEQ ID NO:27, and the light chain variable region sequence is shown in SEQ ID NO:28.

[0191] In some embodiments, the antibody comprises a heavy chain variable region sequence as shown in SEQ ID NO:27.

[0192] In some embodiments, the antibody comprises a light chain variable region sequence as shown in SEQ ID NO:28.

[0193] In some embodiments, the antibody comprises a heavy chain variable region sequence as shown in SEQ ID NO:27 and a light chain variable region sequence as shown in SEQ ID NO:28.

[0194] In some embodiments, the antibody comprises HCDR1 shown in SEQ ID NO:9, HCDR2 shown in SEQ ID NO:10, HCDR3 shown in SEQ ID NO:11, LCDR1 shown in SEQ ID NO:12, LCDR2 shown in SEQ ID NO:13, and LCDR3 shown in SEQ ID NO:14, wherein the antibody heavy chain variable region sequence is shown in SEQ ID NO:29, and the light chain variable region sequence is shown in SEQ ID NO:30.

[0195] In some embodiments, the antibody comprises a heavy chain variable region sequence as shown in SEQ ID NO:29.

[0196] In some embodiments, the antibody comprises a light chain variable region sequence as shown in SEQ ID NO:30.

[0197] In some embodiments, the antibody comprises a heavy chain variable region sequence as shown in SEQ ID NO:29 and a light chain variable region sequence as shown in SEQ ID NO:30.

[0198] Secondly, this application provides an antibody or its antigen-binding portion thereof, the antibody being capable of binding to human Galectin-3, and the binding epitope being located in the N-terminal amino acid sequence region 63-250 of human Galectin-3 as shown in SEQ ID NO:2.

[0199] In some embodiments, the antibody comprises HCDR1 shown in SEQ ID NO:15, HCDR2 shown in SEQ ID NO:16, HCDR3 shown in SEQ ID NO:17, LCDR1 shown in SEQ ID NO:18, LCDR2 shown in SEQ ID NO:19, and LCDR3 shown in SEQ ID NO:20, the antibody heavy chain variable region sequence is shown in SEQ ID NO:31, and the light chain variable region sequence is shown in SEQ ID NO:32.

[0200] In some embodiments, the antibody comprises a heavy chain variable region sequence as shown in SEQ ID NO:31.

[0201] In some embodiments, the antibody comprises a light chain variable region sequence as shown in SEQ ID NO:32.

[0202] In some embodiments, the antibody comprises a heavy chain variable region sequence as shown in SEQ ID NO:31 and a light chain variable region sequence as shown in SEQ ID NO:32.

[0203] In some embodiments, the antibody comprises HCDR1 shown in SEQ ID NO:21, HCDR2 shown in SEQ ID NO:22, HCDR3 shown in SEQ ID NO:23, LCDR1 shown in SEQ ID NO:24, LCDR2 shown in SEQ ID NO:25, and LCDR3 shown in SEQ ID NO:26, wherein the antibody heavy chain variable region sequence is shown in SEQ ID NO:33, and the light chain variable region sequence is shown in SEQ ID NO:34.

[0204] In some embodiments, the antibody comprises a heavy chain variable region sequence as shown in SEQ ID NO:33.

[0205] In some embodiments, the antibody comprises a light chain variable region sequence as shown in SEQ ID NO:34.

[0206] In some embodiments, the antibody comprises a heavy chain variable region sequence as shown in SEQ ID NO:33 and a light chain variable region sequence as shown in SEQ ID NO:34.

[0207] In some implementations, SEQ ID NO:3 to 34 are derived from mice.

[0208] Thirdly, this application provides an antibody combination product comprising a first antibody and a second antibody, wherein the first antibody and the second antibody are selected from the antibodies described in the first and second aspects or their antigen-binding portions.

[0209] In some embodiments, the first antibody is selected from the antibodies described in the first aspect or their antigen-binding portions, and the second antibody is selected from the antibodies described in the second aspect or their antigen-binding portions.

[0210] In some embodiments, the first antibody is selected from the antibody described in the second aspect or its antigen-binding portion, and the second antibody is selected from the antibody described in the first aspect or its antigen-binding portion.

[0211] In some embodiments, both the first antibody and the second antibody are selected from the antibodies described in the first aspect or their antigen-binding portions.

[0212] In some implementations, both the first antibody and the second antibody are selected from the antibodies or their antigen-binding portions described in the second aspect.

[0213] In some implementations, the first antibody is labeled with a detectable marker.

[0214] In some implementations, the second antibody is labeled with a detectable marker.

[0215] In some implementations, the detectable marker is selected from enzymes, cofactors, fluorescent substances, luminescent substances, latex particles, gold particles, bioluminescent substances, and radioactive substances.

[0216] Fourthly, this application provides a kit for detecting the level of galactolectin-3 in samples from human subjects, comprising the antibodies or antigen-binding portions thereof described in the first and / or second aspects, or the antibody combination product described in the third aspect.

[0217] In some embodiments, the level of galactolectin-3 is the level of full-length human Galectin-3 protein or the level of total human Galectin-3 protein.

[0218] In some implementations, the total human Galectin-3 protein level is the sum of the full-length human Galectin-3 protein and the N-terminal amino acid fragment from position 63 to 250 of human Galectin-3.

[0219] In some implementations, the total human Galectin-3 protein level is the sum of the full-length human Galectin-3 protein and the N-terminal amino acid fragments of human Galectin-3 from amino acid position 1 to 62.

[0220] In some embodiments, the level of galactolectin-3 is the level of the full-length human Galectin-3 protein.

[0221] In some embodiments, the level of galactolectin-3 is the level of total human Galectin-3 protein.

[0222] In some implementations, the kit uses a double-antibody sandwich assay to detect the level of galactolectin-3; the double-antibody sandwich assay is selected from ELISA, colloidal gold, immunochromatography, surface-enhanced Raman scattering immunochromatography, chemiluminescence, microfluidics, and single-molecule immunoassay arrays.

[0223] In some implementations, the kit is an ELISA detection kit, a colloidal gold detection kit, an immunochromatographic detection kit, a surface-enhanced Raman scattering immunochromatographic detection kit, a chemiluminescence detection kit, a microfluidic detection kit, or a single-molecule immunoassay array detection kit.

[0224] Fifthly, this application provides the use of the antibodies or antigen-binding portions thereof described in the first and / or second aspects, or the antibody combination products described in the third aspect, in the preparation of a kit for detecting the level of galactolectin-3 in biological samples.

[0225] Sixthly, this application provides the use of the antibody or its antigen-binding portion as described in the first and / or second aspects, or the antibody combination product as described in the third aspect, in the preparation of a kit for diagnosing or assisting in the diagnosis of a disease, wherein the disease is selected from cardiovascular diseases, tumors, rheumatic immune diseases, kidney diseases, respiratory diseases, digestive diseases, or infectious diseases.

[0226] In some implementations, the cardiovascular disease is heart failure, coronary artery disease, or atrial fibrillation.

[0227] In some implementations, the tumor is thyroid cancer, breast cancer, ovarian cancer, gastric cancer, esophageal cancer, non-small cell lung cancer, colon adenocarcinoma, or endometrial cancer.

[0228] In some implementations, the rheumatic immune disease is rheumatoid arthritis.

[0229] In some implementations, the kidney disease is chronic kidney disease.

[0230] In some implementations, the respiratory disease is bronchial asthma, chronic obstructive pulmonary disease, or primary Sjögren's syndrome.

[0231] In some implementations, the digestive system disease is ulcerative colitis or cirrhosis.

[0232] In some implementations, the infectious disease is sepsis.

[0233] Seventhly, this application provides a method for detecting the level of human Galectin-3, the method comprising,

[0234] The first or second antibody in the antibody combination product described in the third aspect is labeled with a detectable marker;

[0235] The level of human Galectin-3 was detected using a double-antibody sandwich method;

[0236] The double-antibody sandwich method is selected from ELISA, colloidal gold, immunochromatography, surface-enhanced Raman scattering immunochromatography, chemiluminescence, microfluidics, and single-molecule immunoassay arrays.

[0237] In some implementations, the antibody or its antigen-binding portion described in the first aspect is labeled with a detectable marker.

[0238] In some implementations, the antibody or its antigen-binding portion described in the second aspect is labeled with a detectable marker.

[0239] In some embodiments, the level of human Galectin-3 is the level of full-length human Galectin-3 protein or the level of total human Galectin-3 protein.

[0240] In some implementations, the total human Galectin-3 protein level is the sum of the full-length human Galectin-3 protein and the N-terminal amino acid fragment from position 63 to 250 of human Galectin-3.

[0241] In some implementations, the total human Galectin-3 protein level is the sum of the full-length human Galectin-3 protein and the N-terminal amino acid fragments of human Galectin-3 from amino acid position 1 to 62.

[0242] In some implementations, the level of human Galectin-3 is the level of the full-length human Galectin-3 protein.

[0243] In some implementations, the level of said human Galectin-3 is the level of total human Galectin-3 protein.

[0244] In some implementations, the total human Galectin-3 protein level is the sum of the full-length human Galectin-3 protein and the Galectin-3 protein fragmented by proteases.

[0245] In some implementations, the human Galectin-3 protein level is measured using a double-antibody sandwich method. One of the epitope antibodies in the range of amino acids 1-62 of the N-terminal protein of human Galectin-3 and the epitope antibodies in the range of amino acids 63-250 of the human Galectin-3 protein is used as the capture antibody, and the other antibody is used as the detection antibody.

[0246] In some implementations, in the double-antibody sandwich method, antibodies against different epitopes within the range of amino acids 1-62 at the N-terminus of human Galectin-3 protein are used as capture or detection antibodies.

[0247] In some implementations, in the double-antibody sandwich method, antibodies against different epitopes within the amino acid range of human Galectin-3 protein from amino acid position 63 to 250 are used as capture or detection antibodies.

[0248] In some implementations, the level of human Galectin-3 protein is measured using immunohistochemistry, Western blotting, or immunoturbidimetry, the method utilizing an epitope antibody in the range of amino acids 1-62 of the N-terminal protein of human Galectin-3 or an epitope antibody in the range of amino acids 63-250 of the human Galectin-3 protein.

[0249] In some embodiments, the antibody or its antigen-binding portion described in the first or second aspect binds to human Galectin-3 protein, and the binding is unaffected by whether galactose, lactose, laminin, other glycoproteins, or ligands bind to human Galectin-3 protein.

[0250] In some implementations, the double-antibody sandwich method includes, but is not limited to, ELISA, colloidal gold, immunochromatography, surface-enhanced Raman scattering immunochromatography, chemiluminescence, microfluidics, or single-molecule immunoassay arrays.

[0251] In some implementation schemes, the level of total human Galectin-3 protein can be detected using sandwich, direct, or indirect methods.

[0252] Eighthly, this application provides a method for diagnosing or assisting in the diagnosis of a disease, the method comprising,

[0253] The first or second antibody in the antibody combination product of claim 5 is labeled with a detectable marker;

[0254] The level of human Galectin-3 was detected using a double-antibody sandwich method, wherein the level of human Galectin-3 was the level of full-length human Galectin-3 protein or the level of total human Galectin-3 protein.

[0255] The double-antibody sandwich method mentioned above is selected from ELISA, colloidal gold, immunochromatography, surface-enhanced Raman scattering immunochromatography, chemiluminescence, microfluidics, and single-molecule immunoassay arrays.

[0256] The diseases mentioned are selected from cardiovascular diseases, tumors, rheumatic immune diseases, kidney diseases, respiratory diseases, digestive diseases, or infectious diseases.

[0257] In some implementations, the cardiovascular disease is heart failure, coronary artery disease, or atrial fibrillation.

[0258] In some implementations, the tumor is thyroid cancer, breast cancer, ovarian cancer, gastric cancer, esophageal cancer, non-small cell lung cancer, colon adenocarcinoma, or endometrial cancer.

[0259] In some implementations, the rheumatic immune disease is rheumatoid arthritis.

[0260] In some implementations, the kidney disease is chronic kidney disease.

[0261] In some implementations, the respiratory disease is bronchial asthma, chronic obstructive pulmonary disease, or primary Sjögren's syndrome.

[0262] In some implementations, the digestive system disease is ulcerative colitis or cirrhosis.

[0263] In some implementations, the infectious disease is sepsis.

[0264] In some embodiments, the level of human Galectin-3 is the level of full-length human Galectin-3 protein or the level of total human Galectin-3 protein.

[0265] In some implementations, the total human Galectin-3 protein level is the sum of the full-length human Galectin-3 protein and the N-terminal amino acid fragment from position 63 to 250 of human Galectin-3.

[0266] In some implementations, the total human Galectin-3 protein level is the sum of the full-length human Galectin-3 protein and the N-terminal amino acid fragments of human Galectin-3 from amino acid position 1 to 62.

[0267] In some implementations, the level of human Galectin-3 is the level of the full-length human Galectin-3 protein.

[0268] In some implementations, the level of human Galectin-3 is the level of total human Galectin-3 protein.

[0269] In some implementations, the total human Galectin-3 protein level is the sum of the full-length human Galectin-3 protein and the Galectin-3 protein fragmented by proteases.

[0270] Example

[0271] The following description discloses only one or more embodiments of the present invention and should not be construed as limiting the scope of the present invention. Those skilled in the art will understand that implementing all or part of the processes of the above embodiments and making equivalent changes in accordance with the claims of the present invention are still within the scope of the invention.

[0272] Example 1: Preparation of Monoclonal Antibodies

[0273] This invention provides a method for preparing Galectin-3 monoclonal antibody, comprising the following steps:

[0274] 1. Balb / c mice were repeatedly immunized with recombinant full-length Galectin-3 protein. Spleen cells and lymph nodes were then fused with Sp2 / 0 myeloma cells. After multiple rounds of screening, monoclonal cell lines were obtained. Monoclonal antibody ascites was prepared and purified to finally obtain the Galectin-3 monoclonal antibody. The specific steps are as follows:

[0275] Female Balb / c mice aged 6-8 weeks were selected for immunization. For the first immunization, each mouse received a subcutaneous injection of 100 μg of Freund's fully adjuvanted emulsified recombinant Galectin-3 full-length protein at multiple sites. Subsequently, booster immunizations were administered every 14 days at a dose of 50 μg of incompletely adjuvanted emulsified recombinant Galectin-3 full-length protein. Two booster immunizations were given consecutively. Fourteen days after the third immunization, each mouse received an intraperitoneal injection of 50 μg of recombinant Galectin-3 full-length protein. Immunization was performed, and blood was collected from the orbital sinus three days later. Mice were then euthanized, and their spleens and lymph nodes were harvested to prepare cell suspensions. Cell counts were performed, and Sp2 / 0 mouse myeloma cells in good growth condition were collected at 1 / 10 to 1 / 2 of the spleen cell count. The two cell types were mixed and centrifuged at 1200 rpm for 10 min. After removing the supernatant, polyethylene glycol (PEG-1450) was added to fuse the two cells. An equal volume of feeder cells was also added, and the mixture was aliquoted into 96-well cell culture plates (200 μL / well) and incubated at 37°C in a 5% CO2 incubator. On day 7, the supernatant of hybridoma cells in the 96-well cell culture plates was examined using an indirect enzyme-linked immunosorbent assay (ELISA).

[0276] Positive hybridoma cells with high OD values ​​were cloned, and then subcloned using limiting dilution. The limitedly diluted cells were cultured in 96-well plates. On day 7, the clones were observed under a microscope, and the supernatant from wells containing single clones was selected for ELISA detection. The single clone with the highest OD value was then further limitedly diluted and inoculated into 96-well plates. Subcloning was repeated as described above until the positive well ratio was 100%, thus obtaining a single-clone cell line. After 3-5 subcloning cycles, the selected single-clone cell lines were expanded and cultured at 2 × 10⁻⁶ cells / well. 6 Cells / tubes were cryopreserved; monoclonal antibody ascites was prepared.

[0277] After screening, single-clonal cell lines containing epitopes of Galectin-3 within the range of amino acids 1-62 of the N-terminal protein were obtained, such as E15F10 and Q1E2.

[0278] Human Galectin-3 epitope monoclonal cell lines such as Y7E12 and UV4E4 are based on amino acid ranges from 63 to 250.

[0279] 2. The specific steps for preparing and purifying monoclonal antibody ascites fluid to finally obtain Galectin-3 monoclonal antibody are as follows:

[0280] Healthy Balb / c mice aged 6-8 weeks were selected and injected intraperitoneally with Freund's incomplete adjuvant at a dose of 500 μL per mouse. Seven days later, monoclonal cells (approximately 1.0 × 10⁻⁶) were injected intraperitoneally. 6Three healthy Balb / c mice were injected with each type of monoclonal cell line. Ascites fluid was collected 7-12 days later. The cells were centrifuged at 10,000 rpm for 10 minutes, the precipitate and upper lipid layer were discarded, and the supernatant was collected. The supernatant was purified by ammonium sulfate precipitation, and then further purified using a protein A / G agarose affinity chromatography column to obtain high-purity Galectin-3 monoclonal antibody.

[0281] 3. The effect of laminin on the binding of Galectin-3 monoclonal antibody to Galectin-3 protein, the specific steps are as follows:

[0282] Dilute laminin to a final concentration of 5 μg / mL with PBS coating buffer, add 50 μL / well to each well of the microplate, coat at 4°C for 12 hours, wash once with washing buffer and blot dry; add blocking buffer (PBS containing 1% BSA) 200 μL / well, block at 37°C for 2 hours, wash once; add a series of different concentrations of Galectin-3 monoclonal antibody 50 μL / well, and add 1 μg / mL Galectin... Incubate n-3 full-length antigen 50 μL / well at 37°C for 1 hour, then wash the plate 3 times and blot dry. Add HRP (horseradish peroxidase) labeled goat anti-mouse IgG 100 μL / well, incubate at 37°C for 30 minutes, then wash the plate 3 times and blot dry. Add 100 μL / well of TMB chromogenic buffer to each well, and after 10 minutes of chromogenic development, add 2M H2SO4 to terminate the reaction, 50 μL / well. Finally, read the OD value using a microplate reader at 450 nm wavelength.

[0283] Galectin-3 monoclonal antibody is affected by laminin, such as... Figure 2 As shown.

[0284] Although amino acids 1-62 are far from the CRD region, some antibodies with antigen-binding epitopes within the 1-62 amino acid range are still affected to varying degrees by laminin binding to Galectin-3 protein. Through screening, monoclonal antibodies with epitopes in the N-terminal range of Galectin-3 protein (amino acids 1-62) that are unaffected by laminin binding to Galectin-3 protein were obtained, such as E15F10 and Q1E2. Specifically, the antigen-binding epitope of antibody Q1E2 is in the range of amino acids 12-33, and that of antibody E15F10 is in the range of amino acids 36-62.

[0285] Monoclonal antibodies against human Galectin-3 epitopes in the amino acid range of 63-250, unaffected by laminin binding to Galectin-3 protein, include Y7E12 and UV4E4. The antigen-binding epitopes of these antibodies are concentrated in the amino acid range of 63-113. Antibodies with antigen-binding epitopes in the amino acid range of 114-250 are mostly affected by lactose or laminin.

[0286] 4. Monoclonal antibody gene sequence cloning and determination:

[0287] The heavy and light chain isotypes of monoclonal antibodies were identified using the Southern Biothech SBACOLOnotyping System-HRP kit, following the manufacturer's instructions. The heavy chain of all four antibodies was identified as IgG1, and the light chain as Kappa. Based on the antibody isotype results, the antibody gene sequences were cloned using a well-established technique. Hybridoma cells in good growth condition were collected, and total RNA was extracted from the hybridoma cells using Trizol (Thermo Fisher Scientific). The mRNA was then reverse transcribed into cDNA according to the Takara PrimeScript II Reverse Transcriptase manufacturer's instructions.

[0288] The specific reverse transcription procedure is as follows:

[0289] Prepare a 10 μL premix of template RNA / primer DNA, including 1 μL of 10 μM specific primers with the sequences: ATGGGTGCCAGTGTCTCTTAGGA (SEQ ID NO:35), GAAGCCTCCAAGACCTTAGAAGGGAA (SEQ ID NO:36), 4 μL of 2.5 mM dNTP mixture, and 5 μL of RNA (total less than 5 μg). After mixing, incubate at 65°C for 5 minutes and immediately place on ice.

[0290] Add 4 μL of 5×PrimeScript II buffer, 20 units of RNase inhibitor, and 1 μL of PrimeScript II RTase (200 units) to the premixed solution. Mix well and react at 42°C for 60 minutes, then at 70°C for 15 minutes. Cool on ice for later use.

[0291] Gene amplification using cDNA as a template: Design downstream primers for Lambda strand, Kappa strand, and heavy chain, as well as universal upstream primers:

[0292] F:AAGCAGTGGTATCAACGCAGA(SEQ ID NO:37)

[0293] Rκ:AACATTGATGTCTTTGGGGTAGAA (SEQ ID NO:38)

[0294] Rλ:AATCGTACACACCAGTGTGTGGG (SEQ ID NO:39)

[0295] RH:AGGGATCCAGAGTTCCAGGT(SEQ ID NO:40)

[0296] PCR was performed using the first strand of cDNA as a template in a 50 μL reaction volume.

[0297] PCR reaction system: template 3μl, dNTPs 1μL, forward and reverse primers (10μM) 2.5μL each, 5×PCR buffer 10μL, ddH2O 30.5μL, Taq enzyme (5μ / μL) 0.5μL.

[0298] The product was purified and recovered by agarose gel electrophoresis. After the product was subjected to an A-addition reaction with rTaq DNA polymerase, it was inserted into the pMD-18T vector and transformed into DH5α competent cells. After the cells grew, four clones of the heavy chain and light chain genes were taken and sequenced.

[0299] The E15F10 monoclonal antibody or its antigen-binding moiety comprises:

[0300] Heavy chain variable region HCDR1, as listed in SEQ ID NO.3;

[0301] Heavy chain variable region HCDR2, as listed in SEQ ID NO.4;

[0302] Heavy chain variable region HCDR3, as listed in SEQ ID NO.5;

[0303] As listed in SEQ ID NO.6, the light chain variable region LCDR1;

[0304] As listed in SEQ ID NO.7, the light chain variable region LCDR2;

[0305] As listed in SEQ ID NO.8, the light chain variable region LCDR3;

[0306] The heavy chain variable region sequence of the E15F10 monoclonal antibody is shown in SEQ ID NO:27, and the light chain variable region sequence is shown in SEQ ID NO:28.

[0307] The Q1E2 monoclonal antibody or its antigen-binding portion comprises:

[0308] Heavy chain variable region HCDR1, as listed in SEQ ID NO.9;

[0309] Heavy chain variable region HCDR2, as listed in SEQ ID NO.10;

[0310] Heavy chain variable region HCDR3, as listed in SEQ ID NO.11;

[0311] As listed in SEQ ID NO.12, the light chain variable region LCDR1;

[0312] As listed in SEQ ID NO.13, the light chain variable region LCDR2;

[0313] As listed in SEQ ID NO.14, the light chain variable region LCDR3;

[0314] The heavy chain variable region sequence of the Q1E2 monoclonal antibody is shown in SEQ ID NO:29, and the light chain variable region sequence is shown in SEQ ID NO:30.

[0315] The UV4E4 monoclonal antibody or its antigen-binding portion comprises:

[0316] Heavy chain variable region HCDR1, as listed in SEQ ID NO.15;

[0317] Heavy chain variable region HCDR2, as listed in SEQ ID NO.16;

[0318] Heavy chain variable region HCDR3, as listed in SEQ ID NO.17;

[0319] As listed in SEQ ID NO.18, the light chain variable region LCDR1;

[0320] As listed in SEQ ID NO.19, the light chain variable region LCDR2;

[0321] As listed in SEQ ID NO.20, the light chain variable region LCDR3;

[0322] The heavy chain variable region sequence of the UV4E4 monoclonal antibody is shown in SEQ ID NO:31, and the light chain variable region sequence is shown in SEQ ID NO:32.

[0323] The Y7E12 monoclonal antibody or its antigen-binding portion comprises:

[0324] Heavy chain variable region HCDR1, as listed in SEQ ID NO.21;

[0325] Heavy chain variable region HCDR2, as listed in SEQ ID NO.22;

[0326] Heavy chain variable region HCDR3, as listed in SEQ ID NO.23;

[0327] As listed in SEQ ID NO.24, the light chain variable region LCDR1;

[0328] As listed in SEQ ID NO.25, the light chain variable region LCDR2;

[0329] As listed in SEQ ID NO.26, the light chain variable region LCDR3;

[0330] The heavy chain variable region sequence of the Y7E12 monoclonal antibody is shown in SEQ ID NO:33, and the light chain variable region sequence is shown in SEQ ID NO:34.

[0331] Example 2: Application of Antibody in Galectin-3 Protein Sandwich ELISA Detection Kit

[0332] This invention provides an ELISA kit for detecting the full-length Galectin-3 protein in human fluid samples, employing a double-antibody sandwich assay. The combination of the Galectin-3 protein capture antibody and the Galectin-3 protein detection antibody can be configured in two ways: (1) using an epitope antibody from amino acids 1-62 of the N-terminal protein of Galectin-3 as the capture antibody and an epitope antibody from amino acids 63-250 of the Galectin-3 protein as the detection antibody; (2) using an epitope antibody from amino acids 63-250 of the Galectin-3 protein as the capture antibody and an epitope antibody from amino acids 1-62 of the N-terminal protein of Galectin-3 as the detection antibody. Either of these two methods can be chosen as the optimal method, for example, using UV4E4 as the capture antibody and E15F10 as the detection antibody.

[0333] This invention also provides an ELISA kit for detecting total Galectin-3 protein in human fluid samples, which employs a double-antibody sandwich assay. The Galectin-3 protein capture antibody and Galectin-3 protein detection antibody are antibodies against different epitopes within the N-terminal amino acid range of Galectin-3 protein (amino acids 1-62), selected through pairing to find the optimal combination, such as Q1E2 for the capture antibody and E15F10 for the detection antibody. Alternatively, the Galectin-3 protein capture antibody and Galectin-3 protein detection antibody are antibodies against different epitopes within the amino acid range of Galectin-3 protein (amino acids 63-250), selected through pairing to find the optimal combination, such as UV4E4 for the capture antibody and Y7E12 for the detection antibody.

[0334] In this embodiment, the ELISA detection kit for full-length Galectin-3 protein and the ELISA detection kit for total Galectin-3 protein are basically the same in terms of process, except for the different combinations of capture and labeling antibodies. The specific implementation steps are as follows:

[0335] An ELISA kit for detecting Galectin-3 protein in human fluid samples includes: Galectin-3 standard, human serum Galectin-3 positive control, reaction strips coated with Galectin-3 protein capture antibody, Galectin-3 protein detection antibody, biological sample diluent, washing buffer, and chromogenic solution.

[0336] 1. The following are the preparation methods for each reagent:

[0337] (1) Galectin-3 standard: Galectin-3 protein was dissolved in 0.01 mol / L PBS solution, pH 7.4, 0.1% BSA, and the final concentration of Galectin-3 was 1000 μg / mL. When used, it was diluted with standard preparation solution to seven gradients: 60 ng / mL, 40 ng / mL, 20 ng / mL, 10 ng / mL, 5 ng / mL, 1 ng / mL and 0.1 ng / mL.

[0338] (2) Galectin-3 positive control sample: human serum of known concentration.

[0339] (3) Biological sample diluent: serum diluent, immunochemistrytechnology product number 649.

[0340] (4) Standard dilution: 20% FBS diluted with PBS was used for the detection of human serum and plasma samples; cell culture medium was used for the detection of cell culture supernatant samples; and cell lysis buffer was used for the detection of cell lysis buffer samples.

[0341] (5) Antibody dilution solution: Dissolve BSA in PBS solution to prepare BSA with a mass concentration of 1%.

[0342] (6) Washing solution: PBST

[0343] (7) Galectin-3 antibody mixture: Galectin-3 detection antibody labeled with HRP, working concentration diluted 1:1000, prepared with antibody dilution solution before use and used immediately.

[0344] (8) Developing solution: TMB developing solution.

[0345] (9) ELISA plate: A white ELISA plate pre-embedded with Galectin-3 capture antibody and blocked, air-dried on a clean bench and then vacuum-sealed. When using, take it out of the sealed bag and put the remaining ELISA strip back into the sealed bag for storage at 4°C.

[0346] The Galectin-3 capture antibody coating solution was diluted to 4 μg / mL. The antibody coating solution was a 0.05M NaHCO3 / Na2CO3 buffer, pH 9.6, prepared by dissolving 1.46 g NaHCO3 and 0.75 g Na2CO3 in 500 mL ddH2O. After diluting the antibody, 60 μL of antibody was added to each well of the microplate, ensuring the antibody covered the entire bottom of the well. The plate was sealed with sealing film and placed in a 4°C refrigerator for 14-16 h. The microplate was then removed, and any remaining antibody coating solution was shaken dry and patted dry on absorbent paper. The plate was washed three times with washing buffer for 3 min each time. It was then blocked overnight with 10% FBS diluted in 200 μL PBS. After washing three times with washing buffer, the plate was removed and air-dried.

[0347] 2. The method for detecting Galectin-3 protein content in biological samples using an ELISA kit and a matching microplate reader is as follows:

[0348] (1) After placing the serum sample to be tested, the standard sample, and the positive control sample at room temperature for pre-temperature equilibration, dilute the serum sample by half with biological sample diluent (if the sample has a very high concentration, it can be diluted by one-quarter and one-eighth). Dilute the standard to seven gradients of 60ng / mL, 40ng / mL, 20ng / mL, 10ng / mL, 5ng / mL, 1ng / mL and 0.1ng / mL. Use the standard diluent directly as the negative control.

[0349] (2) Add 100 μL of biological sample diluent to the ELISA plate, and add the above samples to the microplate wells in sequence. Perform two replicates for each sample, with 50 μL per well. Incubate at 37°C for 3 h. Galectin-3 will bind to the capture antibody on the surface of the solid-phase carrier, i.e., the antibody pre-coated in the well.

[0350] (3) Prepare the antibody complex for detection using antibody dilution buffer. The dilution ratio of HRP-labeled Galectin-3 for detection is 1:1000. Remove the sample from the microplate and pat dry on absorbent paper. Wash the microplate three times with PBST. Add 80 μL of freshly prepared antibody complex to each well of the microplate. Incubate a second time at 37°C for 0.5 h. The Galectin-3 detection antibody can bind to the Galectin-3 protein that was captured by the antibody during the first incubation.

[0351] (4) Wash three times with PSBT to remove unbound enzyme-labeled secondary antibody, add colorimetric solution and read the OD450 value on the microplate reader after 10 min.

[0352] (5) The OD value is positively correlated with the Galectin-3 content in the sample. A standard curve is constructed with the standard concentration as the X-axis and the OD value as the Y-axis. For example... Figure 3 or Figure 4 or Figure 5 (Using Galectin-3 protein cleaved by MMP2 as a control) as shown.

[0353] (6) Calculate the concentration of Galectin-3 in the sample: If the coefficient of variation of the measured value and the labeled value of the positive control sample is less than 10%, it indicates that the measurement process is reliable. The concentration of human Galectin-3 protein in the measured sample can be calculated based on the standard curve obtained in the previous step.

[0354] Example 3: Application of Antibody in Galectin-3 Protein Colloidal Gold Assay Kit

[0355] This invention provides a colloidal gold detection kit for detecting full-length Galectin-3 protein in human fluid samples. The kit employs a double-antibody sandwich detection method. The combination of the Galectin-3 protein capture antibody and the Galectin-3 protein detection antibody can be configured in two ways: (1) using an epitope antibody from amino acids 1-62 of the N-terminal protein of Galectin-3 as the capture antibody and an epitope antibody from amino acids 63-250 of the Galectin-3 protein as the detection antibody; (2) using an epitope antibody from amino acids 63-250 of the Galectin-3 protein as the capture antibody and an epitope antibody from amino acids 1-62 of the N-terminal protein of Galectin-3 as the detection antibody. Either of these two methods can be chosen as the optimal method; for example, the capture antibody could be UV4E4 and the detection antibody could be E15F10.

[0356] This invention also provides a colloidal gold assay kit for detecting total Galectin-3 protein in human fluid samples, employing a double-antibody sandwich assay. The Galectin-3 protein capture antibody and Galectin-3 protein detection antibody are antibodies against different epitopes within the N-terminal amino acid range of Galectin-3 protein (amino acids 1-62), selected through pairing to find the optimal combination, such as Q1E2 for the capture antibody and E15F10 for the detection antibody. Alternatively, the Galectin-3 protein capture antibody and Galectin-3 protein detection antibody are antibodies against different epitopes within the amino acid range of Galectin-3 protein (amino acids 63-250), selected through pairing to find the optimal combination, such as UV4E4 for the capture antibody and Y7E12 for the detection antibody.

[0357] In this embodiment, the colloidal gold detection kit for full-length Galectin-3 protein and the colloidal gold detection kit for total Galectin-3 protein are essentially the same in terms of process, except for the different combinations of capture and labeled antibodies. The specific implementation steps are as follows:

[0358] 1. Preparation of gold-labeled antibodies:

[0359] (1) Colloidal gold labeling process (the following steps are performed according to the amount used to prepare 100 mL of gold-labeled antibody).

[0360] (2) Measure 100 mL of colloidal gold solution into a beaker, add a rotor and place it on a magnetic stirrer, set the speed to 200 rpm and stir, add 0.2 M K2CO3 solution until the solution pH is 8.2 ± 0.05.

[0361] (3) Keep stirring at 200 rpm, add 1 mg of Galectin-3 detection antibody, place on a shaker (set speed to 80 rpm) and label for 30 min.

[0362] (4) Keep stirring at 200 rpm, add 1 mL of 10% BSA solution, and seal for 10 min.

[0363] (5) Stop stirring, transfer the solution to a centrifuge tube, centrifuge at 15000 rpm and 4℃ for 10 min, discard the supernatant, add 100 mL of labeled washing buffer and mix well, centrifuge at 15000 rpm and 4℃ for 10 min. After centrifugation, remove the supernatant, and resuspend the precipitate in 6 mL of gold-labeled resuspension buffer (0.05 M / L Tris-HCl + 20% w / v trehalose + 0.5% w / v BSA + 0.5% w / v VS9 + 0.5% w / v PVP-k30). Store at 2-8℃.

[0364] 2. Preparation of the marking pad:

[0365] (1) Cutting glass fiber: Cut the glass cellulose membrane (30cm*25cm) to a cutting width of 0.9cm.

[0366] (2) Cut the labeling pad and gold-labeled antibody, set the spray volume of the gold sprayer to 4μL / cm, and perform the gold spraying operation. Then, place the labeling pad in a drying oven (37±1℃, humidity 10%-30%) and dry for 23-24 hours.

[0367] 3. Preparation of coated antibodies:

[0368] (1) Prepare NC film and PVC base plate for later use.

[0369] (2) Coating of the detection line: 1 mg / mL of capture antibody was added to the coating dilution buffer (0.01 M / L PBS + 3% W / V trehalose).

[0370] (3) Quality control line: Add 0.5 mg / mL of goat anti-mouse agent to the coating diluent.

[0371] (4) Clean the instrument, add the prepared detection line and control line solutions to pumps 1 and 2, set the streaking solution volume to 1 μL / cm, and perform the streaking operation. Place the NC membrane in a drying oven (temperature 50±1℃, humidity 10%-30%) and dry for 71-73 hours.

[0372] 4. Sample pad preparation:

[0373] Glass cellulose membranes (30cm*25cm) were cut to a width of 21mm. The instrument was set to a spray volume of 4μL / cm, a length of 300mm, and an interval of 6mm, repeated 3 times. Gold sputtering was performed using a sample pad treatment solution (0.05M / L Tris-HCl + 3% w / v trehalose + 0.5% w / v BSA + 0.5% w / v S9 + 0.5% w / v PVP-k30). The labeled pads were then placed in a drying oven (37±1℃, 10%-30% humidity) for 23-24 hours.

[0374] 5. Preparation of test strips:

[0375] Test strip preparation process (conducted in a dry environment, temperature: 18-28℃, humidity 10%-30%)

[0376] (1) Arrange the dried marking pad, PVC base plate with NC film, absorbent paper, and sample pad according to... Figure 6 Assemble as shown.

[0377] (2) Set the cutting width to 3.3mm, place the assembled gold standard plate on the cutting machine to cut it into strips. After cutting, collect the cut test strips into a test strip sealed box (humidity <30%) for storage.

[0378] (3) The test strips are packaged in a shell, with one test card and one bag of desiccant per bag for sealing.

[0379] 6. Test Sample:

[0380] The method for determining the content of full-length Galectin-3 protein or total Galectin-3 protein in biological samples using the above-mentioned colloidal gold reagent kit and matching instruments is as follows:

[0381] (1) After placing the serum sample to be tested, the standard sample, and the positive control sample at room temperature for pre-temperature equilibration, dilute the serum sample by half with biological sample diluent (if the sample has a very high concentration, it can be diluted by one-quarter and one-eighth); dilute the standard sample to eight gradients: 100 ng / mL, 50 ng / mL, 25 ng / mL, 10 ng / mL, 5 ng / mL, 2.5 ng / mL, 1 ng / mL, and 0.5 ng / mL; directly use the standard diluent as the negative control.

[0382] (2) Take out the dried and sealed reagent card and place it on a horizontal table. Use a pipette to add 70 μL of calibrator and sample to the sample well. After reacting for 15 minutes, insert the colloidal gold immunoassay analyzer to test and obtain the corresponding T / C value.

[0383] (3) The T / C value is positively correlated with the Galectin-3 content in the sample. A standard curve was constructed with the standard concentration as the X-axis and the T / C value as the Y-axis, such as... Figure 7 or Figure 8 or Figure 9 (Using Galectin-3 protein cleaved by MMP2 as a control) as shown.

[0384] (4) Calculate the concentration of Galectin-3 in the sample: If the coefficient of variation of the measured value and the labeled value of the positive control sample is less than 10%, it indicates that the measurement process is reliable. The concentration of human Galectin-3 in the measured sample can be calculated based on the standard curve obtained in the previous step.

[0385] Example 4: Application of Antibody in Galectin-3 Protein Immunochromatographic Detection Kit

[0386] This invention provides a protein fluorescence / quantum dot polystyrene microsphere detection kit for detecting full-length Galectin-3 protein in human fluid samples. The kit employs a double-antibody sandwich detection method. The combination of the Galectin-3 protein capture antibody and the Galectin-3 protein detection antibody can be configured in two ways: (1) using an epitope antibody from amino acids 1-62 of the N-terminal protein of Galectin-3 as the capture antibody and an epitope antibody from amino acids 63-250 of the Galectin-3 protein as the detection antibody; (2) using an epitope antibody from amino acids 63-250 of the Galectin-3 protein as the capture antibody and an epitope antibody from amino acids 1-62 of the N-terminal protein of Galectin-3 as the detection antibody. Either of these two methods can be selected, with the optimal method being, for example, using UV4E4 as the capture antibody and E15F10 as the detection antibody.

[0387] This invention also provides a protein fluorescence / quantum dot polystyrene microsphere detection kit for detecting total Galectin-3 protein in human fluid samples. This kit employs a double-antibody sandwich detection method. The Galectin-3 protein capture antibody and Galectin-3 protein detection antibody are antibodies against different epitopes within the N-terminal amino acid range of Galectin-3 protein (1-62 amino acids), selected through pairing to find the optimal combination, such as Q1E2 for the capture antibody and E15F10 for the detection antibody. Alternatively, the Galectin-3 protein capture antibody and Galectin-3 protein detection antibody are antibodies against different epitopes within the amino acid range of Galectin-3 protein (63-250 amino acids), selected through pairing to find the optimal combination, such as UV4E4 for the capture antibody and Y7E12 for the detection antibody.

[0388] In this embodiment, the polystyrene microsphere detection kit for full-length Galectin-3 protein using protein fluorescence / quantum dots and other methods is basically the same as the polystyrene microsphere detection kit for total Galectin-3 protein, except for the different combinations of capture and labeling antibodies. The specific implementation steps are as follows:

[0389] 1. Preparation of antibody-microsphere conjugates

[0390] (1) Raw materials / consumables:

[0391] 1) Fluorescent microspheres, time-resolved fluorescent microspheres, quantum dot microspheres, aggregation-induced emission (AIE) fluorescent microspheres, colored microspheres

[0392] 2) Antibodies and antigens (warm to room temperature before use).

[0393] 3) Activator EDC, Sulfo-NHS (EDC is packaged in small tubes in a dry environment with short opening time. After weighing, seal with sealing film and store at -20℃; Sulfo-NHS is stored at 4℃; warm to room temperature before use).

[0394] 4) Activation solution Buffer A (0.05M / L MES pH 6.0)

[0395] 5) Reaction solution Buffer B (0.05M / L MES, pH 6.5)

[0396] 6) Blocking buffer C (0.05M / L TRIS-HCl + 1% w / v BSA pH 8.0)

[0397] 7) Preservative Buffer D (0.05M / L TRIS-HCl + 1% w / v BSA + 10% w / v trehalose, pH 8.0)

[0398] 8) 1.5mL centrifuge tubes, 2mL centrifuge tubes, 30mL centrifuge tubes, 50mL centrifuge tubes.

[0399] (2) Marking process

[0400] Dilute 1% microspheres 10-fold or 5-fold with the label, preferably 10-fold. The concentration of microspheres used is 1 mg / mL.

[0401] 1) Cleaning microspheres

[0402] Add 50 μL of 1% microspheres to a 1.5 mL centrifuge tube, then add 450 μL of activation buffer A, shake at 1000 rpm for 1 min, then centrifuge at 14800 rpm for 30 min, discard the supernatant, add 400 μL of activation buffer A to reconstitute, and wash once.

[0403] 2) Activated microspheres

[0404] Prepare a 10 mg / mL solution of EDC and Sulfo-NHS using Activation Buffer A. For example, weigh 1 mg of EDC and dissolve it in 100 μL of Buffer A. Add 50 μL of Sulfo-NHS solution and 50 μL of EDC solution to the cleaned microspheres, respectively, so that the concentration of EDC and NHS used is 1 mg / mL. Activate the microspheres by vortexing at 1000 rpm for 30 min.

[0405] 3) Cleaning after activation

[0406] After activation, wash and replace the solution with reaction buffer B: After activation, centrifuge at 14800 rpm for 20 min, discard the supernatant, add 500 μL of reaction buffer B, reconstitute, and wash once. After washing, centrifuge at 14800 rpm for 20 min, discard the supernatant, and add 500 μL of reaction buffer B to reconstitute.

[0407] 4) Antibody-conjugated

[0408] Add Galectin-3 protein detection antibody to the reconstituted microspheres and rotate to mix for 2 hours. Different antibody labeling concentrations range from 0.02 to 0.1 mg / mg.

[0409] Antibody volume = Antibody labeling concentration × Microsphere mass / Antibody concentration

[0410] 5) Closed

[0411] After 2.0 h of coupling reaction, centrifuge at 14800 rpm for 20 min, remove the supernatant, add 500 μL of blocking buffer C to reconstitute, and place on a rotary incubator to rotate and mix for 60 min.

[0412] 6) Cleaning and storage

[0413] After sealing, centrifuge at 14800 rpm for 20 min, discard the supernatant, and resuspend in 250 μL of Buffer D (final microsphere concentration 2 mg / mL). Store at 2–8 °C for later use. Dilute 10-fold with the marked diluent before use.

[0414] 2. Preparation of the marking pad:

[0415] Polyester film (30cm*25cm) was cut into 0.9cm wide pieces and antibody-microsphere conjugates were prepared. The spraying rate was set to 4μL / cm, and gold sputtering was performed. Then, the labeled pads were placed in a drying oven (37±1℃, humidity 10%-30%) and dried for 23-24 hours.

[0416] 3. Preparation of coated antibodies:

[0417] (1) Prepare NC film and PVC base plate for later use.

[0418] (2) Detection line coating: Add 1 mg / mL of Galectin-3 protein capture antibody to the coating diluent, mix thoroughly, and set aside.

[0419] (3) Quality control line: Measure the prepared coating diluent and add 0.5 mg / mL of goat anti-mouse IgG, mix thoroughly and set aside.

[0420] (4) Set the streaking solution volume to 1 μL / cm and perform the streaking operation. Place the NC membrane in a drying oven (temperature 50±1℃, humidity 10%-30%) and dry for 71-73 hours.

[0421] 4. Sample pad preparation:

[0422] Glass cellulose membranes (30cm*25cm) were cut to a width of 21mm. The spraying rate was set to 4μL / cm, the length to be 300mm, and the spacing to be 6mm. This was repeated 3 times. Gold sputtering was performed using the sample pad treatment solution. Then, the marking pads were placed in a drying oven (37±1℃, humidity 10%-30%) and dried for 23-24 hours.

[0423] 5. Preparation of test strips:

[0424] Test strip preparation process (conducted in a dry environment, temperature: 18-28℃, humidity 10%-30%)

[0425] (1) Arrange the dried marking pad, PVC base plate with NC film, absorbent paper, and sample pad according to... Figure 10 Assemble as shown.

[0426] 1) Adhesion of absorbent paper: Peel off the protective film of the absorbent paper area of ​​the PVC base plate, align one end of the cut absorbent paper with section B of the PVC base plate and stick it, and place the other end on the NC film.

[0427] 2) Adhesion of the marking pad: Peel off the protective film of the marking pad area of ​​the PVC base plate, align the prepared marking pad with one end of the marking pad area (close to the sample pad), and mount the other end on the NC film.

[0428] 3) Attaching the sample pad: Peel off the protective film from the PVC base plate sample pad or filter membrane area, align one end of the cut sample pad with end A of the PVC base plate, and place the other end on the marking pad.

[0429] (2) Set the cutting width to 3.3mm, place the assembled gold standard plate on the cutting machine to cut it into strips. After cutting, collect the cut test strips into a test strip sealed box (humidity <30%) for storage.

[0430] (3) The test strips are packaged in a shell, with one test card and one bag of desiccant per bag for sealing.

[0431] 6. Sample testing:

[0432] The method for determining the full-length or total Galectin-3 protein content in biological samples using the above-mentioned fluorescence chromatography kit and associated instruments comprises the following steps:

[0433] (1) After placing the serum sample to be tested, the standard sample, and the positive control sample at room temperature for pre-temperature equilibration, dilute the serum sample by half with biological sample diluent (if the sample has a very high concentration, it can be diluted by one-quarter and one-eighth); dilute the standard sample to eight gradients: 100 ng / mL, 50 ng / mL, 25 ng / mL, 10 ng / mL, 5 ng / mL, 2.5 ng / mL, 1 ng / mL, and 0.5 ng / mL; directly use the standard diluent as the negative control.

[0434] (2) Take out the dried and sealed reagent card and place it on a horizontal table. Use a pipette to add 70 μL of calibrator and sample to the sample well. After reacting for 15 minutes, insert the immunoassay analyzer to test and obtain the corresponding T / C value.

[0435] (3) The T / C value is positively correlated with the Galectin-3 protein content in the sample. A standard curve was constructed with the standard concentration as the X-axis and the T / C value as the Y-axis. Figure 11 or Figure 12 or Figure 13 (Using Galectin-3 protein cleaved by MMP2 as a control) as shown.

[0436] (4) Calculate the concentration of Galectin-3 protein in the sample: If the coefficient of variation of the measured value and the labeled value of the positive control sample is less than 10%, it indicates that the measurement process is reliable. The concentration of human Galectin-3 protein in the measured sample can be calculated based on the standard curve obtained in the previous step.

[0437] Example 5: Application of Antibody in Galectin-3 Protein Chemiluminescence Detection Kit

[0438] This invention provides a chemiluminescent detection kit for detecting full-length Galectin-3 protein in human fluid samples, employing a double-antibody sandwich detection method. The Galectin-3 monoclonal antibody comprises two antibodies: one is an epitope antibody targeting amino acids 1-62 of the N-terminal protein of Galectin-3, and the other is an epitope antibody targeting amino acids 63-250 of the Galectin-3 protein, used as the detection antibody. The optimal combination is selected through pairing, for example, using UV4E4 as the capture antibody and E15F10 as the detection antibody.

[0439] This invention also provides a chemiluminescent detection kit for detecting total Galectin-3 protein in human fluid samples, employing a double-antibody sandwich assay. The Galectin-3 protein capture antibody and Galectin-3 protein detection antibody are antibodies against different epitopes within the N-terminal amino acid range of Galectin-3 protein, selected through pairing to determine the optimal combination, such as Q1E2 for the capture antibody and E15F10 for the detection antibody. Alternatively, the Galectin-3 monoclonal antibodies are antibodies against different epitopes within the amino acid range of Galectin-3 protein, selected through pairing to determine the optimal combination, such as UV4E4 for the capture antibody and Y7E12 for the detection antibody.

[0440] In this embodiment, the chemiluminescence detection kit for full-length Galectin-3 protein and the chemiluminescence detection kit for total Galectin-3 protein are essentially the same in terms of process, except for the antibody combination. The specific implementation steps are as follows:

[0441] The kit in this embodiment includes a magnetic separation reagent, a first reagent, a second reagent, and a series of Galecin-3 protein calibrators.

[0442] 1. The preparation method of the magnetic separation reagent is as follows:

[0443] The magnetic microparticles were resuspended in 0.05 mol / L, pH 8.0 borate buffer to a concentration of 6 mg / mL. Galecin-3 monoclonal antibody was added at a mass ratio of 80:1, and the mixture was homogeneous. 1 mol / L ammonium sulfate solution was added, with the volume of ammonium sulfate being half the sum of the volumes of the magnetic microparticles and Galecin-3 antibody. The mixture was incubated at 25°C for 8 hours. After the reaction, magnetic separation was performed, the supernatant was removed, and the precipitate was added to blocking buffer. 250 μL of blocking buffer was added for every 10 mg of magnetic beads, and the mixture was incubated at 25°C for 1 hour. The mixture was then washed three times with Tris buffer (pH 7.4) containing 1% Tween-20. Finally, 0.007 mol / L, pH 7.4 Tris buffer containing 0.06% BSA was added to achieve a concentration of 0.1 mg / mL of magnetic microparticles coated with Galecin-3 monoclonal antibody.

[0444] 2. The preparation method of the first reagent is as follows:

[0445] The coupling agent N-hydroxysuccinimide biotin ester (BNHS) was dissolved in DMSO to prepare a BNHS solution with a concentration of 12 mmol / L. The BNHS solution was added to the Galecin-3 monoclonal antibody solution at a molar ratio of 15:1 (BNHS to Galecin-3 monoclonal antibody), mixed well, and incubated at 25°C for 50 min. The reaction was then terminated by adding 1.5 mol / L, pH 7.4 TRIS buffer. The solution was then diluted with 0.03 mol / L, pH 7.4 TRIS buffer containing 2% BSA to achieve a concentration of 2 μg / mL of BNHS-labeled Galecin-3 monoclonal antibody.

[0446] 3. The preparation method of the second reagent is as follows:

[0447] 0.3 mg / mL of alkaline phosphatase was added to 10 mg / mL of EDC coupling agent, and the mixture was allowed to stand at 20 °C for 30 minutes. The solution was then desalted using a G-25 gel column, and the activated alkaline phosphatase was collected. 0.6 mg / mL of streptavidin was added to the activated alkaline phosphatase solution, with a molar ratio of streptavidin to alkaline phosphatase of 1:1. The mixture was stirred and mixed at 20 °C for 5 hours. 1.0 mol / L glycine solution was added, and the mixture was stirred and mixed for 1 hour. Then, 0.06 mol / L HEPES buffer containing 0.3% BSA at pH 6.8 was added to dilute the streptavidin-labeled alkaline phosphatase solution to a concentration of 1.5 μg / mL.

[0448] 4. Preparation method of Galecin-3 protein series calibrators:

[0449] The Galecin-3 protein was diluted with a protectant to calibrate concentrations of 60 ng / mL, 40 ng / mL, 20 ng / mL, 10 ng / mL, 5 ng / mL, 1 ng / mL and 0.1 ng / mL. The protectant was used directly as a negative control. The protectant buffer was 0.08 mol / L pH 7.4 TRIS buffer containing 1% BSA.

[0450] 5. Instructions for using this kit:

[0451] (1) Add 50 μL of the sample to be tested and the calibrator to the test tube, then add 50 μL of magnetic separation reagent and 50 μL of the first reagent, mix well, and incubate at 37°C for 10 min.

[0452] (2) Add 50 μL of the second reagent, mix well, and incubate at 37°C for 3 min;

[0453] (3) Place the test tube in the magnetic separator, add a magnetic field, settle in the magnetic field for 1 minute, remove the supernatant, and then wash repeatedly with the washing solution 3 times.

[0454] (4) Add 100 μL of the luminescent substrate catalyzed by alkaline phosphatase, suspend for 3 seconds, and then detect with a luminescence detector.

[0455] (5) Calculate the GALECIN-3 concentration in the sample from the standard curve based on the relative luminescence intensity (RLU) of the sample to be tested.

[0456] Example 6: Application of Antibodies in Single-Molecular Immunoassay Array Kit

[0457] This invention provides a single-molecule immunoassay kit for detecting full-length Galectin-3 protein in human fluid samples. The kit employs a double-antibody sandwich assay. Specifically, one of the Galectin-3 monoclonal antibodies is an epitope antibody targeting amino acids 1-62 of the N-terminal protein of Galectin-3, and the other is an epitope antibody targeting amino acids 63-250 of the Galectin-3 protein, used as the detection antibody. The optimal combination is selected through pairing, for example, using UV4E4 as the capture antibody and E15F10 as the detection antibody.

[0458] This invention also provides a single-molecule immunoassay kit for detecting total Galectin-3 protein in human fluid samples, which employs a double-antibody sandwich assay. The Galectin-3 protein capture antibody and Galectin-3 protein detection antibody are antibodies against different epitopes within the N-terminal amino acid range of Galectin-3 protein, selected through pairing to determine the optimal combination, such as Q1E2 for the capture antibody and E15F10 for the detection antibody. Alternatively, the Galectin-3 monoclonal antibodies are antibodies against different epitopes within the amino acid range of Galectin-3 protein, selected through pairing to determine the optimal combination, such as UV4E4 for the capture antibody and Y7E12 for the detection antibody.

[0459] In this embodiment, the single-molecule immunoassay kit for full-length Galectin-3 protein and the single-molecule immunoassay kit for total Galectin-3 protein are essentially the same in terms of process, except for the antibody combination. The single-molecule immunoassay kit for full-length Galectin-3 protein or the single-molecule immunoassay kit for total Galectin-3 protein provided in this embodiment includes magnetic beads coated with capture antibodies, biotinylated detection antibodies, Galectin-3 standards of known concentration, streptavidin-β-galactosidase solution, fluorescent substrate solution, sample diluent, magnetic bead diluent, and SBG diluent. The specific implementation steps are as follows:

[0460] The method for preparing capture antibody-coated magnetic beads is as follows:

[0461] The capture antibody was liquid-displaced using magnetic bead conjugation buffer (BCB) through an ultrafiltration tube to collect Galectin-3 capture antibody. The magnetic beads were washed three times with BCB and then activated with EDC (0.3 mg / mL) at 4°C for 30 min. The activated magnetic beads were then washed twice with BCB and then activated again with 1.4 × 10⁻⁶ ppm of BCB. 9 The magnetic beads coated with Galectin-3 capture antibody were coupled with the replaced capture antibody (0.2 mg / mL) at 4 °C for 2 h; after washing three times with magnetic bead washing solution, the uncoupled sites were blocked with magnetic bead blocking buffer; finally, after washing with magnetic bead washing solution, the magnetic beads were stored with magnetic bead dilution buffer to obtain Galectin-3 capture antibody-coated magnetic beads.

[0462] Preparation method of biotinylated Galectin-3 detection antibody:

[0463] The detection antibody was replaced with biotinylated reaction buffer via ultrafiltration; the detection antibody was then mixed with NHS-PEG4-Biotin at room temperature and reacted for 30 min; after the reaction, it was purified by ultrafiltration with biotinylated reaction buffer to obtain the biotinylated Galectin-3 detection antibody stored in biotinylated reaction buffer. The molar ratio of the detection antibody to NHS-PEG4-Biotin was 1:40.

[0464] Dilution methods for standard solutions and SBG solutions:

[0465] Galectin-3 standards of known concentrations were diluted with sample diluent to seven concentration points: 60 ng / mL, 40 ng / mL, 20 ng / mL, 10 ng / mL, 5 ng / mL, 1 ng / mL, and 0.1 ng / mL, which were used as Galectin-3 standards for fitting the curve.

[0466] The SBG solution was diluted to 150 pM with SBG diluent to serve as the working solution.

[0467] Magnetic bead coupling buffer, magnetic bead cleaning solution, magnetic bead diluent, biotinylation reaction buffer, blocking buffer, fluorescent substrate, sample diluent, SBG and SBG diluent were all purchased from Quanterix.

[0468] The specific detection steps of the reagent kit in this embodiment are as follows:

[0469] (1) Import the HD-X Homebrew Assay Definition 1 file into the Quanterix HD-X instrument and set the experimental conditions: a two-step method, i.e., a reaction time of 35 min for capturing antibody-coated magnetic beads, sample, and biotinylated detection antibody, and a 5 min reaction time for SBG. Set the standard curve concentration points (60 ng / mL, 40 ng / mL, 20 ng / mL, 10 ng / mL, 5 ng / mL, 1 ng / mL and 0.1 ng / mL, 0 ng / mL). Dilute the test sample to 1-10 times with sample diluent (depending on the sample measurement volume).

[0470] (2) Load the magnetic bead solution coated with Galectin-3 capture antibody (25 μL), the biotinylated Galectin-3 detection antibody solution (20 μL), the SBG working solution (100 μL), the RGP solution (50 μL), and a 96-well plate containing 100 μL of standard and 100 μL of sample into the instrument.

[0471] Informal sequence list

[0472] SEQ ID NO:1

[0473] Met Ala Asp Asn Phe Ser Leu His Asp Ala Leu Ser Gly Ser Gly Asn ProAsn Pro Gln Gly

[0474] Trp Pro Gly Ala Trp Gly Asn Gln Pro Ala Gly Ala Gly Gly Tyr Pro GlyAla Ser Tyr Pro

[0475] Gly Ala Tyr Pro Gly Gln Ala Pro Pro Gly Ala Tyr Pro Gly Gln Ala ProPro Gly Ala

[0476] SEQ ID NO:2

[0477] Tyr Pro Gly Ala Pro Gly Ala Tyr Pro Gly Ala Pro Ala Pro Gly Val TyrPro Gly Pro Pro Ser

[0478] Gly Pro Gly Ala Tyr Pro Ser Ser Gly Gln Pro Ser Ala Thr Gly Ala TyrPro Ala Thr Gly Pro

[0479] Tyr Gly Ala Pro Ala Gly Pro Leu Ile Val Pro Tyr Asn Leu Pro Leu ProGly Gly Val Val Pro

[0480] Arg Met Leu Ile Thr Ile Leu Gly Thr Val Lys Pro Asn Ala Asn Arg IleAla Leu Asp Phe

[0481] Gln Arg Gly Asn Asp Val Ala Phe His Phe Asn Pro Arg Phe Asn Glu AsnAsn Arg Arg Val

[0482] Ile Val Cys Asn Thr Lys Leu Asp Asn Asn Trp Gly Arg Glu Glu Arg GlnSer Val Phe Pro

[0483] Phe Glu Ser Gly Lys Pro Phe Lys Ile Gln Val Leu Val Glu Pro Asp HisPhe Lys Val Ala Val

[0484] Asn Asp Ala His Leu Leu Gln Tyr Asn His Arg Val Lys Lys Leu Asn GluIle Ser Lys Leu

[0485] Gly Ile Ser Gly Asp Ile Asp Leu Thr Ser Ala Ser Tyr Thr Met Ile

[0486] SEQ ID NO:3

[0487] Met Pro Pro Gly Leu Thr Tyr Val Asp Tyr Thr Gly

[0488] SEQ ID NO:4

[0489] Gln Met Ala Val His Asn Ser Thr Lys Asp Gly Asn Pro Thr Leu Arg

[0490] SEQ ID NO:5

[0491] Gly Asp Leu Ile Ala Cys His Tyr

[0492] SEQ ID NO:6

[0493] Ser Gly Ser Gly Phe Gly Asp Tyr Val Asn Ser Asp Asn Val

[0494] SEQ ID NO:7

[0495] Gly Ala Thr Ser Arg Arg Val

[0496] SEQ ID NO:8

[0497] Gly Ser Gly Gly Gly Tyr Val Asn Ser Arg

[0498] SEQ ID NO:9

[0499] Met Ala Ile His Asp Phe Ile Asn

[0500] SEQ ID NO:10

[0501] Arg Thr Arg Asn Ala Asp Asp Phe Lys Gly Trp Ile Asn Lys Ser Thr Tyr

[0502] SEQ ID NO:11

[0503] Ser Arg His Phe Ala Asp Trp Tyr Tyr

[0504] SEQ ID NO:12

[0505] Leu Thr Ser Ser Gln His Ser Thr Ile Glu Thr Tyr

[0506] SEQ ID NO:13

[0507] Val Ser Leu Ser Thr Gly Asp Glu Lys Asp Gly

[0508] SEQ ID NO:14

[0509] Gly Val Glu Gln Phe Val Tyr Val Gly Asp Thr Ile Glu

[0510] SEQ ID NO:15

[0511] Ser Tyr Met Asn

[0512] SEQ ID NO:16

[0513] Arg Glu Thr Asn Tyr Asn Glu Lys Phe Lys Gly Ile Tyr Pro Gly Glu TrpAspSEQ ID NO:17

[0514] Gly Ser Gly Arg Gly Leu Ala Tyr Ala Trp Thr

[0515] SEQ ID NO:18

[0516] Arg Ser Arg Gln Ser Ile Gly Asn Thr Tyr Leu Glu Val Tyr Ser Asn

[0517] SEQ ID NO:19

[0518] Asn Arg Phe Ser Lys Val Ser

[0519] SEQ ID NO:20

[0520] Gly Ser His Tyr Thr Phe Gln Val Pro

[0521] SEQ ID NO:21

[0522] Asn Tyr Met Ser

[0523] SEQ ID NO:22

[0524] Arg Ala Asp Gly Tyr Thr Tyr Val Lys Gly Thr Ile Ser Gly Tyr Pro AspSerSEQ ID NO:23

[0525] Gly Asp Trp Tyr Pro Ser Thr Phe Ala Thr

[0526] SEQ ID NO:24

[0527] Ile Val Phe Ser Asn Glu Lys Ser Ser Gln Ser Gly Ile Thr Tyr Leu

[0528] SEQ ID NO:25

[0529] Asn Arg Ser Lys Val Ser Phe

[0530] SEQ ID NO:26

[0531] Gly Ser His Trp Thr Phe Gln Leu Pro

[0532] SEQ ID NO:27

[0533] Glu Val Gln Leu Gln Gln Ser Gly Pro Gly Leu Val Lys Pro Lys Gln SerLeu Ser Leu Thr

[0534] Cys Thr Val Ser Val Gly Thr Val Gly Met Pro Pro Gly Leu Thr Tyr ValAsp Tyr Thr Gly

[0535] Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile Gly Gln Met AlaVal His Asn Ser Thr

[0536] Lys Asp Gly Asn Pro Thr Leu Arg Arg Val Thr Ile Ser Glu Asp Thr SerLys Asn Gln Phe

[0537] Pro Leu Gln Leu Ser Ser Val Thr Glu Ala Asp Thr Ala Leu Tyr Phe CysThr Arg Gly Asp

[0538] Leu Ile Ala Cys His Tyr Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser

[0539] SEQ ID NO:28

[0540] Gln Ile Gln Leu Thr Gln Ser Pro Ala Thr His Leu Val Ser Pro Gly GlySer Ile Thr Ile Ser

[0541] Cys Ser Gly Ser Gly Phe Gly Asp Tyr Val Asn Ser Asp Asn Val Trp PheLeu Gln Arg Pro

[0542] Gly Gln Ala Pro Glu Leu Leu Ile Tyr Gly Ala Thr Ser Arg Arg Val GlyVal Pro Ala Arg Phe

[0543] Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Gly Ile Ser Asn Val GlnAla Glu Asp Leu

[0544] Gly Ile Tyr Tyr Cys Gly Ser Gly Gly Gly Tyr Val Asn Ser Arg Phe GlyGly Gly Thr Lys

[0545] Leu Glu Ile Lys

[0546] SEQ ID NO:29

[0547] Glu Val Gln Leu Val Gly Ser Gly Gly Gly Leu Val Gln Pro Lys Gly SerLeu Ser Leu Ser

[0548] Cys Lys Ala Ser Val Gly Thr Val Gly Met Ala Ile His Asp Phe Ile AsnTrp Ile Arg Gln Arg

[0549] Pro Gly Gln Gly Leu Glu Trp Ile Gly Arg Thr Arg Asn Ala Asp Asp PheLys Gly Trp Ile

[0550] Asn Lys Ser Thr Tyr Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn GlnPhe Pro Leu Gln

[0551] Leu Asn Ser Val Thr Glu Ala Asp Thr Ala Leu Tyr Phe Cys Val Arg SerArg His Phe Ala

[0552] Asp Trp Tyr Tyr Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser

[0553] SEQ ID NO:30

[0554] Asp Ile Glu Leu Thr Gln Ser Pro Ala Tyr Val Ala Ala Ser Leu Gly GlnArg Ile Ser Ile Ser

[0555] Cys Leu Thr Ser Ser Gln His Ser Thr Ile Glu Thr Tyr Trp Phe Leu GlnArg Pro Gly Gln Ser

[0556] Pro Glu Leu Leu Ile Tyr Val Ser Leu Ser Thr Gly Asp Glu Lys Asp GlyGly Val Pro Ala

[0557] Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Gly Ile Ser AsnVal Gln Ala Glu

[0558] Asp Leu Gly Ile Tyr Tyr Cys Gly Val Glu Gln Phe Val Tyr Val Gly AspThr Ile Glu Phe Gly

[0559] Gly Gly Thr Lys Leu Glu Ile Lys

[0560] SEQ ID NO:31

[0561] Glu Val Gln Leu Gln Glu Ser Gly Ala Gly Leu Val Lys Pro Ser Gly SerLeu Ser Leu Thr

[0562] Cys Thr Val Ser Asp Leu Asn Ser Tyr Met Asn Trp Val Arg Gln Ala ProGly Lys Gly Leu

[0563] Glu Trp Val Ala Arg Glu Thr Asn Tyr Asn Glu Lys Phe Lys Gly Ile TyrPro Gly Glu Trp

[0564] Asp Arg Ile Thr Ile Ser Arg Asp Thr Ser Lys Asn Gln Phe Ser Leu ArgLeu Ser Ser Leu Thr

[0565] Ser Ala Asp Thr Ala Val Tyr Tyr Cys Ala Arg Gly Ser Gly Arg Gly LeuAla Tyr Ala Trp

[0566] Thr Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ala

[0567] SEQ ID NO:32

[0568] Asp Ile Gln Leu Thr Gln Ser Pro Ala Ser Leu Ser Ala Ser Pro Gly GluThr Val Thr Ile Ser

[0569] Cys Arg Ser Arg Gln Ser Ile Gly Asn Thr Tyr Leu Glu Val Tyr Ser AsnTrp Tyr Gln Gln

[0570] Lys Pro Gly Gln Ser Pro Lys Leu Leu Ile Tyr Asn Arg Phe Ser Lys ValSer Gly Val Pro Asp

[0571] Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser ArgVal Glu Ala Glu

[0572] Asp Phe Ala Ile Tyr Tyr Cys Gly Ser His Tyr Thr Phe Gln Val Pro PheGly Gly Gly Thr

[0573] Lys Leu Glu Ile Lys

[0574] SEQ ID NO:33

[0575] Glu Val Gln Leu Lys Glu Ser Gly Gly Gly Leu Val Gln Pro Lys Gln SerLeu Lys Leu Ser

[0576] Cys Thr Val Ser Asp Met Ser Asn Tyr Met Ser Trp Val Arg Gln Thr ProGly Lys Gly Leu

[0577] Glu Trp Val Ala Arg Ala Asp Gly Tyr Thr Tyr Val Lys Gly Thr Ile SerGly Tyr Pro Asp Ser

[0578] Arg Ile Thr Ile Ser Arg Asp Thr Ser Lys Asn Gln Phe Ser Leu Lys LeuAsn Ser Leu Thr Ser

[0579] Ala Asp Thr Ala Val Tyr Tyr Cys Ala Arg Gly Asp Trp Tyr Pro Ser ThrPhe Ala Thr Trp

[0580] Gly Gln Gly Thr Ser Val Thr Val Ser Ala

[0581] SEQ ID NO:34

[0582] Gly Ile Leu Leu Thr Gln Ser Pro Ala Ser Leu Ser Ala Ser Pro Gly GluLeu Val Thr Ile Thr

[0583] Cys Ile Val Phe Ser Asn Glu Lys Ser Ser Gln Ser Gly Ile Thr Tyr LeuTrp Tyr Gln Gln Lys

[0584] Pro Gly Gln Ser Pro Lys Leu Leu Ile Tyr Asn Arg Ser Lys Val Ser PheGly Val Pro Asp Arg

[0585] Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg ValGlu Ala Glu Asp

[0586] Phe Ala Ile Tyr Tyr Cys Gly Ser His Trp Thr Phe Gln Leu Pro Phe GlyGly Gly Thr Lys

[0587] Leu Glu Ile Lys

[0588] SEQ ID NO:35

[0589] ATGGGTGCCAGTGTCTCTTAGGA

[0590] SEQ ID NO:36

[0591] GAAGCCTCCAAGACCTTAGAAGGGAA

[0592] SEQ ID NO:37

[0593] AAGCAGTGGTATCAACGCAGA

[0594] SEQ ID NO:38

[0595] AACATTGATGTCTTTGGGGTAGAA

[0596] SEQ ID NO:39

[0597] AATCGTACACACCAGTGTGTGGG

[0598] SEQ ID NO:40

[0599] AGGGATCCAGAGTTCCAGGT

Claims

1. An antibody or an antigen-binding portion thereof, wherein the antibody is capable of binding to human galectin-3, and the binding epitope is located within the amino acid sequence region of positions 1-62 at the N-terminus of human galectin-3 shown in SEQ ID NO: 1, wherein the antibody comprises HCDR1 shown in SEQ ID NO: 3, HCDR2 shown in SEQ ID NO: 4, HCDR3 shown in SEQ ID NO: 5, LCDR1 shown in SEQ ID NO: 6, LCDR2 shown in SEQ ID NO: 7, and LCDR3 shown in SEQ ID NO: 8; or the antibody comprises HCDR1 shown in SEQ ID NO: 9, HCDR2 shown in SEQ ID NO: 10, HCDR3 shown in SEQ ID NO: 11, LCDR1 shown in SEQ ID NO: 12, LCDR2 shown in SEQ ID NO: 13, and LCDR3 shown in SEQ ID NO: 14, and the sequences of the above CDRs are defined according to Kabat.

2. The antibody or an antigen-binding portion thereof according to claim 1, wherein: the antibody comprises a heavy chain variable region sequence shown in SEQ ID NO: 27 and a light chain variable region sequence shown in SEQ ID NO: 28; or the antibody comprises a heavy chain variable region sequence shown in SEQ ID NO: 29 and a light chain variable region sequence shown in SEQ ID NO:

30.

3. An antibody or an antigen-binding portion thereof, wherein the antibody is capable of binding to human galectin-3, and the binding epitope is located within the amino acid sequence region of positions 63-250 at the N-terminus of human galectin-3 shown in SEQ ID NO: 2, wherein the antibody comprises HCDR1 shown in SEQ ID NO: 15, HCDR2 shown in SEQ ID NO: 16, HCDR3 shown in SEQ ID NO: 17, LCDR1 shown in SEQ ID NO: 18, LCDR2 shown in SEQ ID NO: 19, and LCDR3 shown in SEQ ID NO: 20; or the antibody comprises HCDR1 shown in SEQ ID NO: 21, HCDR2 shown in SEQ ID NO: 22, HCDR3 shown in SEQ ID NO: 23, LCDR1 shown in SEQ ID NO: 24, LCDR2 shown in SEQ ID NO: 25, and LCDR3 shown in SEQ ID NO: 26, and the sequences of the above CDRs are defined according to Kabat.

4. The antibody or an antigen-binding portion thereof according to claim 3, wherein: the antibody comprises a heavy chain variable region sequence shown in SEQ ID NO: 31 and a light chain variable region sequence shown in SEQ ID NO: 32; or the antibody comprises a heavy chain variable region sequence shown in SEQ ID NO: 33 and a light chain variable region sequence shown in SEQ ID NO:

34.

5. An antibody combination product, comprising a first antibody and a second antibody, wherein, the first antibody is selected from the antibody or its antigen-binding portion described in any one of claims 1 to 2, and the second antibody is selected from the antibody or its antigen-binding portion described in any one of claims 3 to 4; or the first antibody comprises HCDR1 shown in SEQ ID NO:3, HCDR2 shown in SEQ ID NO:4, HCDR3 shown in SEQ ID NO:5, LCDR1 shown in SEQ ID NO:6, LCDR2 shown in SEQ ID NO:7, and LCDR3 shown in SEQ ID NO:8, and the second antibody comprises HCDR1 shown in SEQ ID NO:9, HCDR2 shown in SEQ ID NO:10, HCDR3 shown in SEQ ID NO:11, LCDR1 shown in SEQ ID NO:12, LCDR2 shown in SEQ ID NO:13, and LCDR3 shown in SEQ ID NO:14; or the first antibody comprises HCDR1 shown in SEQ ID NO:15, HCDR2 shown in SEQ ID NO:16, HCDR3 shown in SEQ ID NO:17, LCDR1 shown in SEQ ID NO:18, LCDR2 shown in SEQ ID NO:19, and LCDR3 shown in SEQ ID NO:20, and the second antibody comprises HCDR1 shown in SEQ ID NO:21, HCDR2 shown in SEQ ID NO:22, HCDR3 shown in SEQ ID NO:23, LCDR1 shown in SEQ ID NO:24, LCDR2 shown in SEQ ID NO:25, and LCDR3 shown in SEQ ID NO:26, the sequences of the above CDRs are defined according to Kabat.

6. The antibody combination product according to claim 5, wherein the first antibody is labeled with a detectable marker or the second antibody is labeled with a detectable marker.

7. The antibody combination product according to claim 6, wherein the detectable marker is selected from enzymes, cofactors, fluorescent substances, luminescent substances, latex particles, gold particles, bioluminescent substances, and radioactive substances.

8. A kit for detecting the level of galectin-3 in a sample from a human subject, comprising the antibody combination product according to any one of claims 5 to 7.

9. The kit according to claim 8, wherein the level of galectin-3 is the level of human galectin-3 full-length protein or the total level of human galectin-3 protein.

10. The kit according to claim 8, wherein the kit detects the level of galectin-3 by a sandwich immunoassay; wherein the sandwich immunoassay is selected from ELISA, colloidal gold, immunochromatography, surface-enhanced Raman scattering immunochromatography, chemiluminescence, microfluidics, and single molecule immunoarray.

11. The kit according to claim 10, wherein the kit is an ELISA detection kit, a colloidal gold detection kit, an immunochromatographic detection kit, a surface-enhanced Raman scattering immunochromatographic detection kit, a chemiluminescent detection kit, a microfluidic detection kit or a single molecule immunoarray detection kit.

12. A kit for detecting the level of galectin-3 total protein in a sample from a human subject, comprising the antibody or antigen-binding portion thereof according to any one of claims 1 to 4.

13. Use of the antibody or antigen-binding portion thereof according to any one of claims 1 to 4 or the antibody combination product according to any one of claims 5 to 7 in the preparation of a kit for detecting the level of galectin-3 in a biological sample.

14. Use of the antibody or antigen-binding portion thereof according to any one of claims 1 to 4 or the antibody combination product according to any one of claims 5 to 7 in the preparation of a kit for diagnosing or assisting in the diagnosis of a disease, wherein the disease is selected from cardiovascular diseases, tumors, rheumatic immune diseases, kidney diseases, respiratory diseases, digestive system diseases or infectious diseases; wherein, the cardiovascular disease is heart failure, coronary heart disease or atrial fibrillation; the tumor is thyroid cancer, breast cancer, ovarian cancer, gastric cancer, esophageal cancer, non-small cell lung cancer, colon adenocarcinoma or endometrial cancer; the rheumatic immune disease is rheumatoid arthritis; the kidney disease is chronic kidney disease; the respiratory disease is bronchial asthma, chronic obstructive pulmonary disease or primary Sjögren's syndrome; the digestive system disease is ulcerative colitis or liver cirrhosis; or the infectious disease is sepsis.

15. A method for detecting the level of human Galectin-3, the method being for non-disease diagnosis purposes, the method comprising, labeling the first antibody or the second antibody in the antibody combination product according to claim 5 with a detectable label; detecting the level of human galectin-3 using a sandwich immunoassay; wherein the sandwich immunoassay is selected from ELISA, colloidal gold, immunochromatography, surface-enhanced Raman scattering immunochromatography, chemiluminescence, microfluidics and single molecule immunoarray.

16. The method according to claim 15, wherein the level of human galectin-3 is the level of human galectin-3 full-length protein or the level of human galectin-3 total protein.

Images